Gender-Dependent Deregulation of Linear and Circular RNA Variants of HOMER1 in the Entorhinal Cortex of Alzheimer’s Disease
Abstract
:1. Introduction
2. Results
2.1. HOMER1 mRNA Variants Are Downregulated in Entorhinal Cortex of AD Female Cases Compared to Controls
2.2. HOMER1 circRNA Variants Are Downregulated in Entorhinal Cortex in AD Female Cases Compared to Controls
2.3. Proportional Decreases in HOMER1 mRNA and circRNAs Variants Expression Levels in AD Female Cases Compared to Controls
2.4. Correlation between HOMER1 Protein and RNA Expression Levels in the Entorhinal Cortex of Females
2.5. Correlation between DNA Methylation Levels in HOMER1 Promoter and RNA Expression Levels
2.6. Correlation of HOMER1 RNA Variants Expression Levels with Aβ Deposits
3. Discussion
4. Materials and Methods
4.1. Human Entorhinal Samples
4.2. Quantitative Assessment of Aβ Deposits in Brain Tissues
4.3. RNA Isolation and RT-qPCR
4.4. circRNA Confirmation by Sanger Sequencing
4.5. HOMER1 Protein Expression Analysis by Western Blot
4.6. HOMER1 Methylation by Bisulfite Cloning Sequencing
4.7. Statistical Data Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mayeux, R.; Stern, Y. Epidemiology of Alzheimer disease. Cold Spring Harb Perspect Med. 2012, 2, a006239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reitz, C.; Mayeux, R. Alzheimer disease: Epidemiology, diagnostic criteria, risk factors and biomarkers. Biochem. Pharmacol. 2014, 88, 640–651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeong, S. Molecular and Cllular Basis of Neurodegeneration in Alzheimer’s Disease. Mol. Cells 2017, 40, 613–620. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Millan, M.J. The epigenetic dimension of Alzheimer’s disease: Causal, consequence, or curiosity? Dialogues Clin. Neurosci. 2014, 16, 373–393. [Google Scholar] [PubMed]
- Bukke, V.N.; Archana, M.; Villani, R.; Romano, A.D.; Wawrzyniak, A.; Balawender, K.; Orkisz, S.; Beggiato, S.; Serviddio, G.; Cassano, T. The Dual Role of Glutamatergic Neurotransmission in Alzheimer’s Disease: From Pathophysiology to Pharmacotherapy. Int. J. Mol. Sci. 2020, 21, 7452. [Google Scholar] [CrossRef] [PubMed]
- McDaid, J.; Mustaly-Kalimi, S.; Stutzmann, G.E. Ca2+ dyshomeostasis disrupts neuronal and synaptic function in Alzheimer’s disease. Cells 2020, 9, 2655. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, K.; Ueta, Y.; Wang, L.; Yamamoto, R.; Inoue, N.; Inokuchi, K.; Aiba, A.; Yonekura, H.; Kato, N. Suppression of a neocortical potassium channel activity by intracellular amyloid-β and its rescue with Homer1a. J. Neurosci. 2011, 31, 11100–11109. [Google Scholar] [CrossRef] [Green Version]
- Luo, P.; Li, X.; Fei, Z.; Poon, W. Scaffold protein Homer 1: Implications for neurological diseases. Neurochem. Int. 2012, 61, 731–738. [Google Scholar] [CrossRef]
- Clifton, N.E.; Trent, S.; Thomas, K.L.; Hall, J. Regulation and Function of Activity-Dependent Homer in Synaptic Plasticity. Mol. Neuropsychiatry 2019, 5, 147–161. [Google Scholar] [CrossRef]
- Shiraishi-Yamaguchi, Y.; Furuichi, T. The Homer family proteins. Genome Biol. 2007, 8, 206. [Google Scholar] [CrossRef] [Green Version]
- Zimmerman, A.J.; Hafez, A.K.; Amoah, S.K.; Rodriguez, B.A.; Dell’Orco, M.; Lozano, E.; Hartley, B.J.; Alural, B.; Lalonde, J.; Chander, P.; et al. A psychiatric disease-related circular RNA controls synaptic gene expression and cognition. Mol. Psychiatry 2020, 25, 2712–2727. [Google Scholar] [CrossRef] [Green Version]
- Kent, W.J.; Sugnet, C.W.; Furey, T.S.; Roskin, K.M.; Pringle, T.H.; Zahler, A.M.; Haussler, D. The human genome browser at UCSC. Genome Res. 2002, 12, 996–1006. [Google Scholar] [CrossRef] [Green Version]
- Navarro Gonzalez, J.; Zweig, A.S.; Speir, M.L.; Schmelter, D.; Rosenbloom, K.R.; Raney, B.J.; Powell, C.C.; Nassar, L.R.; Maulding, N.D.; Lee, C.M.; et al. The UCSC Genome Browser database: 2021 update. Nucleic Acids Res. 2021, 49, D1046–D1057. [Google Scholar] [CrossRef]
- Niibori, Y.; Hayashi, F.; Hirai, K.; Matsui, M.; Inokuchi, K. Alternative poly(A) site-selection regulates the production of alternatively spliced vesl-1/homer1 isoforms that encode postsynaptic scaffolding proteins. Neurosci. Res. 2007, 57, 399–410. [Google Scholar] [CrossRef] [PubMed]
- Jardin, I.; López, J.J.; Berna-Erro, A.; Salido, G.M.; Rosado, J.A. Homer proteins in Ca2⁺ entry. IUBMB Life 2013, 65, 497–504. [Google Scholar] [CrossRef] [PubMed]
- Xiao, M.S.; Ai, Y.; Wilusz, J.E. Biogenesis and Functions of Circular RNAs Come into Focus. Trends Cell Biol. 2020, 30, 226–240. [Google Scholar] [CrossRef] [PubMed]
- Vicens, Q.; Westhof, E. Biogenesis of Circular RNAs. Cell 2014, 159, 13–14. [Google Scholar] [CrossRef] [Green Version]
- Bolha, L.; Ravnik-Glavac, M.; Glavac, D. Circular RNAs: Biogenesis, Function, and a Role as Possible Cancer Biomarkers. Int. J. Genom. 2017, 2017, 6218353. [Google Scholar] [CrossRef] [PubMed]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef]
- Rybak-Wolf, A.; Stottmeister, C.; Glazar, P.; Jens, M.; Pino, N.; Giusti, S.; Hanan, M.; Behm, M.; Bartok, O.; Ashwal-Fluss, R.; et al. Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. Mol. Cell 2015, 58, 870–885. [Google Scholar] [CrossRef] [Green Version]
- Hanan, M.; Soreq, H.; Kadener, S. CircRNAs in the brain. RNA Biol 2017, 14, 1028–1034. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.; Schuman, E. Circular RNAs in Brain and Other Tissues: A Functional Enigma. Trends Neurosci. 2016, 39, 597–604. [Google Scholar] [CrossRef] [PubMed]
- You, X.; Vlatkovic, I.; Babic, A.; Will, T.; Epstein, I.; Tushev, G.; Akbalik, G.; Wang, M.; Glock, C.; Quedenau, C.; et al. Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nat. Neurosci. 2015, 18, 603–610. [Google Scholar] [CrossRef] [Green Version]
- Dube, U.; Del-Aguila, J.L.; Li, Z.; Budde, J.P.; Jiang, S.; Hsu, S.; Ibanez, L.; Fernandez, M.V.; Farias, F.; Norton, J.; et al. An atlas of cortical circular RNA expression in Alzheimer disease brains demonstrates clinical and pathological associations. Nat. Neurosci. 2019, 22, 1903–1912. [Google Scholar] [CrossRef]
- Cervera-Carles, L.; Dols-Icardo, O.; Molina-Porcel, L.; Alcolea, D.; Cervantes-Gonzalez, A.; Muñoz-Llahuna, L.; Clarimon, J. Assessing circular RNAs in Alzheimer’s disease and frontotemporal lobar degeneration. Neurobiol. Aging 2020, 92, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Lo, I.; Hill, J.; Vilhjálmsson, B.J.; Kjems, J. Linking the association between circRNAs and Alzheimer’s disease progression by multi-tissue circular RNA characterization. RNA Biol. 2020, 17, 1789–1797. [Google Scholar] [CrossRef] [PubMed]
- Dudekula, D.B.; Panda, A.C.; Grammatikakis, I.; De, S.; Abdelmohsen, K.; Gorospe, M. CircInteractome: A web tool for exploring circular RNAs and their interacting proteins and microRNAs. RNA Biol. 2016, 13, 34–42. [Google Scholar] [CrossRef] [Green Version]
- Clifton, N.E.; Cameron, D.; Trent, S.; Sykes, L.H.; Thomas, K.L.; Hall, J. Hippocampal Regulation of Postsynaptic Density Homer1 by Associative Learning. Neural. Plast 2017, 2017, 5959182. [Google Scholar] [CrossRef] [Green Version]
- Leber, S.L.; Llenos, I.C.; Miller, C.L.; Dulay, J.R.; Haybaeck, J.; Weis, S. Homer1a protein expression in schizophrenia, bipolar disorder, and major depression. J. Neural. Transm. 2017, 124, 1261–1273. [Google Scholar] [CrossRef]
- Matosin, N.; Fernandez-Enright, F.; Lum, J.S.; Engel, M.; Andrews, J.L.; Gassen, N.C.; Wagner, K.V.; Schmidt, M.V.; Newell, K.A. Molecular evidence of synaptic pathology in the CA1 region in schizophrenia. NPJ Schizophr. 2016, 2, 16022. [Google Scholar] [CrossRef] [Green Version]
- Murotomi, K.; Takagi, N.; Muroyama, A.; Kaji, N.; Takeo, S.; Tanonaka, K. Transient focal cerebral ischemia differentially decreases Homer1a and 1b/c contents in the postsynaptic density. Neurosci. Lett. 2012, 515, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Forner, S.; Baglietto-Vargas, D.; Martini, A.C.; Trujillo-Estrada, L.; LaFerla, F.M. Synaptic Impairment in Alzheimer’s Disease: A Dysregulated Symphony. Trends Neurosci. 2017, 40, 347–357. [Google Scholar] [CrossRef] [PubMed]
- Dickey, C.A.; Loring, J.F.; Montgomery, J.; Gordon, M.N.; Eastman, P.S.; Morgan, D. Selectively reduced expression of synaptic plasticity-related genes in amyloid precursor protein + presenilin-1 transgenic mice. J. Neurosci. 2003, 23, 5219–5226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Viña, J.; Lloret, A. Why women have more Alzheimer’s disease than men: Gender and mitochondrial toxicity of amyloid-beta peptide. J. Alzheimers Dis. 2010, 20 (Suppl. 2), S527–S533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scheyer, O.; Rahman, A.; Hristov, H.; Berkowitz, C.; Isaacson, R.S.; Diaz Brinton, R.; Mosconi, L. Female Sex and Alzheimer’s Risk: The Menopause Connection. J. Prev. Alzheimers Dis. 2018, 5, 225–230. [Google Scholar] [CrossRef]
- Hilton, G.D.; Nunez, J.L.; Bambrick, L.; Thompson, S.M.; McCarthy, M.M. Glutamate-mediated excitotoxicity in neonatal hippocampal neurons is mediated by mGluR-induced release of Ca++ from intracellular stores and is prevented by estradiol. Eur. J. Neurosci. 2006, 24, 3008–3016. [Google Scholar] [CrossRef] [Green Version]
- Counts, S.E.; Che, S.; Ginsberg, S.D.; Mufson, E.J. Gender differences in neurotrophin and glutamate receptor expression in cholinergic nucleus basalis neurons during the progression of Alzheimer’s disease. J. Chem. Neuroanat. 2011, 42, 111–117. [Google Scholar] [CrossRef] [Green Version]
- Mazure, C.M.; Swendsen, J. Sex differences in Alzheimer’s disease and other dementias. Lancet Neurol. 2016, 15, 451–452. [Google Scholar] [CrossRef] [Green Version]
- Deming, Y.; Dumitrescu, L.; Barnes, L.L.; Thambisetty, M.; Kunkle, B.; Gifford, K.A.; Bush, W.S.; Chibnik, L.B.; Mukherjee, S.; De Jager, P.L.; et al. Sex-specific genetic predictors of Alzheimer’s disease biomarkers. Acta Neuropathol. 2018, 136, 857–872. [Google Scholar] [CrossRef]
- Iasevoli, F.; Buonaguro, E.F.; Sarappa, C.; Marmo, F.; Latte, G.; Rossi, R.; Eramo, A.; Tomasetti, C.; de Bartolomeis, A. Regulation of postsynaptic plasticity genes’ expression and topography by sustained dopamine perturbation and modulation by acute memantine: Relevance to schizophrenia. Prog. Neuropsychopharmacol. Biol. Psychiatry 2014, 54, 299–314. [Google Scholar] [CrossRef]
- De Bartolomeis, A.; Sarappa, C.; Buonaguro, E.F.; Marmo, F.; Eramo, A.; Tomasetti, C.; Iasevoli, F. Different effects of the NMDA receptor antagonists ketamine, MK-801, and memantine on postsynaptic density transcripts and their topography: Role of Homer signaling, and implications for novel antipsychotic and pro-cognitive targets in psychosis. Prog. Neuropsychopharmacol. Biol. Psychiatry 2013, 46, 1–12. [Google Scholar] [CrossRef]
- Brouillette, J.; Young, D.; During, M.J.; Quirion, R. Hippocampal gene expression profiling reveals the possible involvement of Homer1 and GABA(B) receptors in scopolamine-induced amnesia. J. Neurochem. 2007, 102, 1978–1989. [Google Scholar] [CrossRef]
- Ju, Y.E.; Lucey, B.P.; Holtzman, D.M. Sleep and Alzheimer disease pathology—A bidirectional relationship. Nat. Rev. Neurol. 2014, 10, 115–119. [Google Scholar] [CrossRef]
- Mander, B.A.; Marks, S.M.; Vogel, J.W.; Rao, V.; Lu, B.; Saletin, J.M.; Ancoli-Israel, S.; Jagust, W.J.; Walker, M.P. β-amyloid disrupts human NREM slow waves and related hippocampus-dependent memory consolidation. Nat. Neurosci. 2015, 18, 1051–1057. [Google Scholar] [CrossRef] [Green Version]
- Irwin, M.R.; Vitiello, M.V. Implications of sleep disturbance and inflammation for Alzheimer’s disease dementia. Lancet Neurol. 2019, 18, 296–306. [Google Scholar] [CrossRef]
- Cordone, S.; Annarumma, L.; Rossini, P.M.; De Gennaro, L. Sleep and β-Amyloid Deposition in Alzheimer Disease: Insights on Mechanisms and Possible Innovative Treatments. Front. Pharmacol. 2019, 10, 695. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sato, S.; Bunney, B.G.; Vawter, M.P.; Bunney, W.E.; Sassone-Corsi, P. Homer1a Undergoes Bimodal Transcriptional Regulation by CREB and the Circadian Clock. Neuroscience 2020, 434, 161–170. [Google Scholar] [CrossRef] [PubMed]
- Maret, S.; Dorsaz, S.; Gurcel, L.; Pradervand, S.; Petit, B.; Pfister, C.; Hagenbuchle, O.; O’Hara, B.F.; Franken, P.; Tafti, M. Homer1a is a core brain molecular correlate of sleep loss. Proc. Natl. Acad. Sci. USA 2007, 104, 20090–20095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fjell, A.M.; Sederevicius, D.; Sneve, M.H.; de Lange, A.G.; Bråthen, A.C.; Idland, A.V.; Watne, L.O.; Wang, Y.; Reinbold, C.; Dobricic, V.; et al. Self-reported Sleep Problems Related to Amyloid Deposition in Cortical Regions with High HOMER1 Gene Expression. Cereb Cortex 2020, 30, 2144–2156. [Google Scholar] [CrossRef]
- Ferreira, H.J.; Davalos, V.; de Moura, M.C.; Soler, M.; Perez-Salvia, M.; Bueno-Costa, A.; Setien, F.; Moran, S.; Villanueva, A.; Esteller, M. Circular RNA CpG island hypermethylation-associated silencing in human cancer. Oncotarget 2018, 9, 29208–29219. [Google Scholar] [CrossRef] [Green Version]
- Mahan, A.L.; Mou, L.; Shah, N.; Hu, J.H.; Worley, P.F.; Ressler, K.J. Epigenetic modulation of Homer1a transcription regulation in amygdala and hippocampus with pavlovian fear conditioning. J. Neurosci. 2012, 32, 4651–4659. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Verkaik-Schakel, R.N.; Biber, K.; Plösch, T.; Serchov, T. Antidepressant treatment is associated with epigenetic alterations of Homer1 promoter in a mouse model of chronic depression. J. Affect. Disord. 2021, 279, 501–509. [Google Scholar] [CrossRef]
- Altuna, M.; Urdánoz-Casado, A.; Sánchez-Ruiz de Gordoa, J.; Zelaya, M.V.; Labarga, A.; Lepesant, J.M.J.; Roldán, M.; Blanco-Luquin, I.; Perdones, Á.; Larumbe, R.; et al. DNA methylation signature of human hippocampus in Alzheimer’s disease is linked to neurogenesis. Clin. Epigenetics 2019, 11, 91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zusso, M.; Barbierato, M.; Facci, L.; Skaper, S.D.; Giusti, P. Neuroepigenetics and Alzheimer’s Disease: An Update. J. Alzheimers Dis. 2018, 64, 671–688. [Google Scholar] [CrossRef]
- Bell, J.E.; Alafuzoff, I.; Al-Sarraj, S.; Arzberger, T.; Bogdanovic, N.; Budka, H.; Dexter, D.T.; Falkai, P.; Ferrer, I.; Gelpi, E.; et al. Management of a twenty-first century brain bank: Experience in the BrainNet Europe consortium. Acta Neuropathol. 2008, 115, 497–507. [Google Scholar] [CrossRef]
- Montine, T.J.; Phelps, C.H.; Beach, T.G.; Bigio, E.H.; Cairns, N.J.; Dickson, D.W.; Duyckaerts, C.; Frosch, M.P.; Masliah, E.; Mirra, S.S.; et al. National Institute on Aging-Alzheimer’s Association guidelines for the neuropathologic assessment of Alzheimer’s disease: A practical approach. Acta Neuropathol. 2012, 123, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Braak, H.; Alafuzoff, I.; Arzberger, T.; Kretzschmar, H.; Del Tredici, K. Staging of Alzheimer disease-associated neurofibrillary pathology using paraffin sections and immunocytochemistry. Acta Neuropathol. 2006, 112, 389–404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mirra, S.S.; Heyman, A.; McKeel, D.; Sumi, S.M.; Crain, B.J.; Brownlee, L.M.; Vogel, F.S.; Hughes, J.P.; van Belle, G.; Berg, L. The Consortium to Establish a Registry for Alzheimer’s Disease (CERAD). Part II. Standardization of the neuropathologic assessment of Alzheimer’s disease. Neurology 1991, 41, 479–486. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Casper, J.; Zweig, A.S.; Villarreal, C.; Tyner, C.; Speir, M.L.; Rosenbloom, K.R.; Raney, B.J.; Lee, C.M.; Lee, B.T.; Karolchik, D.; et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Res. 2018, 46, D762–d769. [Google Scholar] [CrossRef] [Green Version]
- Kent, W.J. BLAT—The BLAST-like alignment tool. Genome Res. 2002, 12, 656–664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.C.; Dahiya, R. MethPrimer: Designing primers for methylation PCRs. Bioinformatics 2002, 18, 1427–1431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumaki, Y.; Oda, M.; Okano, M. QUMA: Quantification tool for methylation analysis. Nucleic Acids Res. 2008, 36, W170–W175. [Google Scholar] [CrossRef] [PubMed]
Forward 5’->3’ | Reverse 5’->3’ | |
---|---|---|
HOMER1A | CACATAGGAAGTAGAAATTCGGAAC | TTTCACTTTCCTTAGCTGCATTC |
HOMER1B/C | CAGAGAACTACAAGAACAGAGGG | GACGTTGCTCTAAGTCAGACAG |
hsa_circ_0006916 | TTTGGAAGACATGAGCTCGA | AAGGGCTGAACCAACTCAGA |
hsa_circ_0073127 | GAAACTACAGTTCAGCAATCAGC | AAGTTCAGTCACCCGCTTGT |
hsa_circ_0073128 | AGCCAAGCAAATGCAGTACA | TGTGTTTGGGTCAATTTGGA |
Bis-HOMER1_1 | GATTTTATTTTTTTTAGTTTTTTTT | TAACTCTATAATTCATTCATTCTCC |
Bis-HOMER1_2 | TTTTTTAGGTAAAATGATTTTTTTT | AATTACCTAACTCTCCCTAAATATC |
Female | HOMER1B/C | HOMER1A | hsa_circ_0073127 | hsa_circ_0073128 | hsa_circ_0006916 | |
---|---|---|---|---|---|---|
global average area of Aβ deposits | correlation coeficient (Spearman’s Rho) | −0.483 * | −0.447 * | −0.479 * | −0.005 | −0.038 |
Sig. (bilateral) | 0.036 | 0.048 | 0.038 | 0.982 | 0.873 | |
Male | HOMER1B/C | HOMER1A | hsa_circ_0073127 | hsa_circ_0073128 | hsa_circ_0006916 | |
global average area of Aβ deposits | correlation coeficient (Spearman’s Rho) | −0.487 * | −0.452 | −0.494 * | −0.473 * | −0.486 * |
Sig. (bilateral) | 0.041 | 0.059 | 0.037 | 0.047 | 0.041 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Urdánoz-Casado, A.; Sánchez-Ruiz de Gordoa, J.; Robles, M.; Acha, B.; Roldan, M.; Zelaya, M.V.; Blanco-Luquin, I.; Mendioroz, M. Gender-Dependent Deregulation of Linear and Circular RNA Variants of HOMER1 in the Entorhinal Cortex of Alzheimer’s Disease. Int. J. Mol. Sci. 2021, 22, 9205. https://doi.org/10.3390/ijms22179205
Urdánoz-Casado A, Sánchez-Ruiz de Gordoa J, Robles M, Acha B, Roldan M, Zelaya MV, Blanco-Luquin I, Mendioroz M. Gender-Dependent Deregulation of Linear and Circular RNA Variants of HOMER1 in the Entorhinal Cortex of Alzheimer’s Disease. International Journal of Molecular Sciences. 2021; 22(17):9205. https://doi.org/10.3390/ijms22179205
Chicago/Turabian StyleUrdánoz-Casado, Amaya, Javier Sánchez-Ruiz de Gordoa, Maitane Robles, Blanca Acha, Miren Roldan, María Victoria Zelaya, Idoia Blanco-Luquin, and Maite Mendioroz. 2021. "Gender-Dependent Deregulation of Linear and Circular RNA Variants of HOMER1 in the Entorhinal Cortex of Alzheimer’s Disease" International Journal of Molecular Sciences 22, no. 17: 9205. https://doi.org/10.3390/ijms22179205