In-Depth Sequence Analysis of Bread Wheat VRN1 Genes
Abstract
:1. Introduction
2. Results
2.1. CNV of VRN1 Homoeologs
2.2. VRN1 Sequence Variability and Gene Expression
2.2.1. Sequence Analysis of VRN-A1 Genes and Promoters
2.2.2. Sequence Analysis of VRN-B1 Genes and Promoters
2.2.3. Sequence Analysis of VRN-D1 Genes and Promoters
2.2.4. Comparison of VRN1 Homoeologous Promoter Regions
2.3. Effect of VRN-A1 CNV on Heading Time
3. Discussion
3.1. VRN1 Sequence Variability
3.2. VRN1 Promoter Secondary Structures
3.3. VRN1 Copy Number Variation
4. Materials and Methods
4.1. Plant Material
4.2. DNA Extraction and Genotyping
4.3. A Chromosome Sorting by Flow Cytometry
4.4. CNV of VRN1 Homoeologs and Ppd-B1
4.5. Sequencing of VRN1 Homoeologs
4.5.1. Sanger Sequencing
4.5.2. Illumina Sequencing
4.5.3. Oxford Nanopore Sequencing
4.5.4. Different Variants of the vrn-A1 Promoter
4.6. Sequencing Data Analysis
4.7. Growth Conditions
4.8. RNA Extraction and Gene Expression
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dubcovsky, J.; Dvorak, J. Genome plasticity a key factor in the success of polyploid wheat under domestication. Science 2007, 316, 1862–1866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beales, J.; Turner, A.; Griffiths, S.; Snape, J.W.; Laurie, D.A. A pseudo-response regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.). Theor. Appl. Genet. 2007, 115, 721–733. [Google Scholar] [CrossRef] [PubMed]
- Wilhelm, E.P.; Turner, A.S.; Laurie, D.A. Photoperiod insensitive Ppd-A1a mutations in tetraploid wheat (Triticum durum Desf.). Theor. Appl. Genet. 2009, 118, 285–294. [Google Scholar] [CrossRef]
- Díaz, A.; Zikhali, M.; Turner, A.S.; Isaac, P.; Laurie, D.A. Copy number variation affecting the photoperiod-B1 and vernalization-A1 genes is associated with altered flowering time in wheat (Triticum aestivum). PLoS ONE 2012, 7, e33234. [Google Scholar] [CrossRef] [Green Version]
- Yan, L.; Loukoianov, A.; Tranquilli, G.; Helguera, M.; Fahima, T.; Dubcovsky, J. Positional cloning of the wheat vernalization gene VRN1. Proc. Natl. Acad. Sci. USA 2003, 100, 6263–6268. [Google Scholar] [CrossRef] [Green Version]
- Trevaskis, B.; Bagnall, D.J.; Ellis, M.H.; Peacock, W.J.; Dennis, E.S. MADS box genes control vernalization-induced flowering in cereals. Proc. Natl. Acad. Sci. USA 2003, 100, 13099–13104. [Google Scholar] [CrossRef] [Green Version]
- Yan, L.; Loukoianov, A.; Blechl, A.; Tranquilli, G.; Ramakrishna, W.; SanMiguel, P.; Bennetzen, J.L.; Echenique, V.; Dubcovsky, J. The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science 2004, 303, 1640–1644. [Google Scholar] [CrossRef] [Green Version]
- Yan, L.; Fu, D.; Li, C.; Blechl, A.; Tranquilli, G.; Bonafede, M.; Sanchez, A.; Valarik, M.; Yasuda, S.; Dubcovsky, J. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc. Natl. Acad. Sci. USA 2006, 103, 19581–19586. [Google Scholar] [CrossRef] [Green Version]
- Tamaki, S.; Matsuo, S.; Hann, L.W.; Yokoi, S.; Shimamoto, K. Hd3a protein is a mobile flowering signal in rice. Science 2007, 316, 1033–1036. [Google Scholar] [CrossRef]
- Chouard, P. Vernalization and its relations to dormancy. Annu. Rev. Plant Physiol. 1960, 11, 191–238. [Google Scholar] [CrossRef]
- Alonso-Peral, M.M.; Oliver, S.N.; Casao, M.C.; Greenup, A.A.; Trevaskis, B. The promoter of the cereal VERNALIZATION1 gene is sufficient for transcriptional induction by prolonged cold. PLoS ONE 2011, 6, e29456. [Google Scholar] [CrossRef] [Green Version]
- Fu, D.; Szucs, P.; Yan, L.; Helguera, M.; Skinner, J.S.; Von Zitzewitz, J.; Hayes, P.M.; Dubcovsky, J. Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol. Genet. Genom. 2005, 273, 54–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, J.; Xu, S.; Li, C.; Xu, Y.; Xing, L.; Niu, Y.; Huan, Q.; Tang, Y.; Zhao, C.; Wagner, D.; et al. O-GlcNAc-mediated interaction between VER2 and TaGRP2 elicits TaVRN1 mRNA accumulation during vernalization in winter wheat. Nat. Commun. 2014, 5, 4572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kippes, N.; Guedira, M.; Lin, L.; Alvarez, M.A.; Brown-Guedira, G.L.; Dubcovsky, J. Single nucleotide polymorphisms in a regulatory site of VRN-A1 first intron are associated with differences in vernalization requirement in winter wheat. Mol. Genet. Genom. 2018, 293, 1231–1243. [Google Scholar] [CrossRef] [Green Version]
- Yan, L.; Helguera, A.M.; Kato, A.K.; Fukuyama, A.S.; Sherman, J.; Dubcovsky, A.J. Allelic variation at the VRN-1 promoter region in polyploid wheat. Theor. Appl. Genet. 2004, 109, 1677–1686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Gao, M.; Wang, S.; Chen, F.; Cui, D. Allelic variation at the vernalization and photoperiod sensitivity loci in Chinese winter wheat cultivars (Triticum aestivum L.). Front. Plant Sci. 2015, 6, 470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santra, D.K.; Santra, M.; Allan, R.E.; Campbell, K.G.; Kidwell, K.K. Genetic and molecular characterization of vernalization genes Vrn-A1, Vrn-B1, and Vrn-D1 in spring wheat germplasm from the pacific northwest region of the U.S.A. Plant Breed. 2009, 128, 576–584. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, Y.; Wu, S.; Yang, J.; Liu, H.; Zhou, Y. A single nucleotide polymorphism at the Vrn-D1 promoter region in common wheat is associated with vernalization response. Theor. Appl. Genet. 2012, 125, 1697–1704. [Google Scholar] [CrossRef]
- Milec, Z.; Tomková, L.; Sumíková, T.; Pánková, K. A new multiplex PCR test for the determination of Vrn-B1 alleles in bread wheat (Triticum aestivum L.). Mol. Breed. 2012, 30, 317–323. [Google Scholar] [CrossRef]
- Shcherban, A.B.; Efremova, T.T.; Salina, E.A. Identification of a new Vrn-B1 allele using two near-isogenic wheat lines with difference in heading time. Mol. Breed. 2012, 29, 675–685. [Google Scholar] [CrossRef]
- Steinfort, U.; Trevaskis, B.; Fukai, S.; Bell, K.L.; Dreccer, M.F. Vernalisation and photoperiod sensitivity in wheat: Impact on canopy development and yield components. Field Crops Res. 2017, 201, 108–121. [Google Scholar] [CrossRef]
- Muterko, A.; Balashova, I.; Cockram, J.; Kalendar, R.; Sivolap, Y. The new wheat vernalization response allele Vrn-D1s is caused by DNA transposon insertion in the first intron. Plant Mol. Biol. Rep. 2015, 33, 294–303. [Google Scholar] [CrossRef] [Green Version]
- Springer, N.M.; Ying, K.; Fu, Y.; Ji, T.; Yeh, C.T.; Jia, Y.; Wu, W.; Richmond, T.; Kitzman, J.; Rosenbaum, H.; et al. Maize inbreds exhibit high levels of copy number variation (CNV) and presence/absence variation (PAV) in genome content. PLoS Genet. 2009, 5, e1000734. [Google Scholar] [CrossRef] [Green Version]
- McHale, L.K.; Haun, W.J.; Xu, W.W.; Bhaskar, P.B.; Anderson, J.E.; Hyten, D.L.; Gerhardt, D.J.; Jeddeloh, J.A.; Stupar, R.M. Structural variants in the soybean genome localize to clusters of biotic stress-response genes. Plant Physiol. 2012, 159, 1295–1308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, Z.; Chen, J.; Liao, Y.; Wang, M.; Liu, R.; Ge, S.; Wing, R.A.; Chen, M. The impact and origin of copy number variations in the Oryza species. BMC Genom. 2016, 17, 261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, P.; Wang, C.; Xu, Q.; Feng, Y.; Yuan, X.; Yu, H.; Wang, Y.; Tang, S.; Wei, X. Detection of copy number variations in rice using array-based comparative genomic hybridization. BMC Genom. 2011, 12, 6–13. [Google Scholar] [CrossRef] [Green Version]
- Muterko, A.; Salina, E. VRN1-ratio test for polyploid wheat. Planta 2019, 250, 1955–1965. [Google Scholar] [CrossRef] [PubMed]
- Guedira, M.; Xiong, M.; Hao, Y.F.; Johnson, J.; Harrison, S.; Marshall, D.; Brown-Guedira, G. Heading date QTL in winter wheat (Triticum aestivum L.) coincide with major developmental genes VERNALIZATION1 and PHOTOPERIOD1. PLoS ONE 2016, 11, e0154242. [Google Scholar] [CrossRef]
- Würschum, T.; Boeven, P.H.G.G.; Langer, S.M.; Longin, C.F.H.; Leiser, W.L. Multiply to conquer: Copy number variations at Ppd-B1 and Vrn-A1 facilitate global adaptation in wheat. BMC Genet. 2015, 16, 96. [Google Scholar] [CrossRef] [Green Version]
- Kippes, N.; Debernardi, J.M.; Vasquez-Gross, H.A.; Akpinar, B.A.; Budak, H.; Kato, K.; Chao, S.; Akhunov, E.; Dubcovsky, J. Identification of the VERNALIZATION 4 gene reveals the origin of spring growth habit in ancient wheats from South Asia. Proc. Natl. Acad. Sci. USA 2015, 112, E5401–E5410. [Google Scholar] [CrossRef] [Green Version]
- Li, G.; Yu, M.; Fang, T.; Cao, S.; Carver, B.F.; Yan, L. Vernalization requirement duration in winter wheat is controlled by TaVRN-A1 at the protein level. Plant J. 2013, 76, 742–753. [Google Scholar] [CrossRef] [Green Version]
- Košner, J.; Pánková, K. Vernalization response of some winter wheat cultivars (Triticum aestivum L.). Czech J. Genet. Plant Breed. 2002, 38, 97–103. [Google Scholar] [CrossRef] [Green Version]
- Khan, A.R.; Enjalbert, J.; Marsollier, A.C.; Rousselet, A.; Goldringer, I.; Vitte, C. Vernalization treatment induces site-specific DNA hypermethylation at the VERNALIZATION-A1 (VRN-A1) locus in hexaploid winter wheat. BMC Plant Biol. 2013, 13, 209. [Google Scholar] [CrossRef] [Green Version]
- Strejčková, B.; Čegan, R.; Pecinka, A.; Milec, Z.; Šafář, J. Identification of polycomb repressive complex 1 and 2 core components in hexaploid bread wheat. BMC Plant Biol. 2020, 20, 175. [Google Scholar] [CrossRef] [PubMed]
- Diallo, A.O.; Ali-Benali, M.A.; Badawi, M.; Houde, M.; Sarhan, F. Expression of vernalization responsive genes in wheat is associated with histone H3 trimethylation. Mol. Genet. Genom. 2012, 287, 575–590. [Google Scholar] [CrossRef]
- Svačina, R.; Karafiátová, M.; Malurová, M.; Serra, H.; Vítek, D.; Endo, T.R.; Sourdille, P.; Bartoš, J. Development of Deletion Lines for Chromosome 3D of Bread Wheat. Front. Plant Sci. 2020, 10, 1756. [Google Scholar] [CrossRef]
- Guiblet, W.M.; Cremona, M.A.; Cechova, M.; Harris, R.S.; Kejnovská, I.; Kejnovsky, E.; Eckert, K.; Chiaromonte, F.; Makova, K.D. Long-read sequencing technology indicates genome-wide effects of non-B DNA on polymerization speed and error rate. Genome Res. 2018, 28, 1767–1778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muterko, A.; Salina, E. Origin and distribution of the VRN-A1 exon 4 and exon 7 haplotypes in domesticated wheat species. Agronomy 2018, 8, 156. [Google Scholar] [CrossRef] [Green Version]
- Pidal, B.; Yan, L.; Fu, D.; Zhang, F.; Tranquilli, G.; Dubcovsky, J. The CArG-box located upstream from the transcriptional start of wheat vernalization gene VRN1 is not necessary for the vernalization response. J. Hered. 2009, 100, 355–364. [Google Scholar] [CrossRef] [Green Version]
- Shcherban, A.B.; Strygina, K.V.; Salina, E.A. VRN-1 gene- associated prerequisites of spring growth habit in wild tetraploid wheat T. dicoccoides and the diploid A genome species. BMC Plant Biol. 2015, 15, 94. [Google Scholar] [CrossRef]
- Loukoianov, A. Regulation of VRN-1 vernalization genes in normal and transgenic polyploid wheat. Plant Physiol. 2005, 138, 2364–2373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Emtseva, M.V.; Efremova, T.T.; Arbuzova, V.S. The influence of Vrn-B1a and Vrn-B1c alleles on the length of developmental phases of substitution and near-isogenic lines of common wheat. Russ. J. Genet. 2013, 49, 545–552. [Google Scholar] [CrossRef]
- Maizels, N.; Gray, L.T. The G4 Genome. PLoS Genet. 2013, 9, e1003468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muterko, A.; Kalendar, R.; Salina, E. Novel alleles of the VERNALIZATION1 genes in wheat are associated with modulation of DNA curvature and flexibility in the promoter region. BMC Plant Biol. 2016, 16, 65–81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cagirici, H.B.; Sen, T.Z. Genome-wide discovery of G-quadruplexes in wheat: Distribution and putative functional roles. G3 Genes Genomes Genet. 2020, 10, 2021–2032. [Google Scholar] [CrossRef] [Green Version]
- Lago, S.; Nadai, M.; Cernilogar, F.M.; Kazerani, M.; Domíniguez Moreno, H.; Schotta, G.; Richter, S.N. Promoter G-quadruplexes and transcription factors cooperate to shape the cell type-specific transcriptome. Nat. Commun. 2021, 12, 3885. [Google Scholar] [CrossRef]
- Wu, F.; Niu, K.; Cui, Y.; Li, C.; Lyu, M.; Ren, Y.; Chen, Y.; Deng, H.; Huang, L.; Zheng, S.; et al. Genome-wide analysis of DNA G-quadruplex motifs across 37 species provides insights into G4 evolution. Commun. Biol. 2021, 4, 98. [Google Scholar] [CrossRef]
- Spiegel, J.; Cuesta, S.M.; Adhikari, S.; Hänsel-Hertsch, R.; Tannahill, D.; Balasubramanian, S. G-quadruplexes are transcription factor binding hubs in human chromatin. Genome Biol. 2021, 22, 117:1–117:15. [Google Scholar] [CrossRef]
- Cagirici, H.B.; Budak, H.; Sen, T.Z. Genome-wide discovery of G-quadruplexes in barley. Sci. Rep. 2021, 11, 7876. [Google Scholar] [CrossRef]
- Chen, Y.; Carver, B.F.; Wang, S.; Zhang, F.; Yan, L. Genetic loci associated with stem elongation and winter dormancy release in wheat. Theor. Appl. Genet. 2009, 118, 881–889. [Google Scholar] [CrossRef]
- Zhu, J.; Pearce, S.; Burke, A.; See, D.R.; Skinner, D.Z.; Dubcovsky, J.; Garland-Campbell, K. Copy number and haplotype variation at the VRN-A1 and central FR-A2 loci are associated with frost tolerance in hexaploid wheat. Theor. Appl. Genet. 2014, 127, 1183–1197. [Google Scholar] [CrossRef] [Green Version]
- Pugsley, A.T. A genetic analysis of the spring-winter habit of growth in wheat. Aust. J. Agric. Res. 1971, 22, 21–31. [Google Scholar] [CrossRef]
- Esquerré, T.; Laguerre, S.; Turlan, C.; Carpousis, A.J.; Girbal, L.; Cocaign-Bousquet, M. Dual role of transcription and transcript stability in the regulation of gene expression in Escherichia coli cells cultured on glucose at different growth rates. Nucleic Acids Res. 2014, 42, 2460–2472. [Google Scholar] [CrossRef]
- Jędrak, J.; Ochab-Marcinek, A. Influence of gene copy number on self-regulated gene expression. J. Theor. Biol. 2016, 408, 222–236. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.; Lemos, B.; Dopman, E.B.; Hartl, D.L. Copy-number variation: The balance between gene dosage and expression in Drosophila melanogaster. Genome Biol. Evol. 2011, 3, 1014–1024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schuster-Böckler, B.; Conrad, D.; Bateman, A. Dosage sensitivity shapes the evolution of copy-number varied regions. PLoS ONE 2010, 5, 20894. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Wang, Y.; Zheng, J.; Wen, Y.; Qu, M.; Kang, S.; Wu, S.; Deng, X.; Hong, K.; Li, S.; et al. A genome-wide survey of copy number variations reveals an asymmetric evolution of duplicated genes in rice. BMC Biol. 2020, 18, 73. [Google Scholar] [CrossRef]
- Akhunova, A.R.; Matniyazov, R.T.; Liang, H.; Akhunov, E.D. Homoeolog-specific transcriptional bias in allopolyploid wheat. BMC Genom. 2010, 11, 505. [Google Scholar] [CrossRef] [Green Version]
- Ramírez-González, R.H.; Borrill, P.; Lang, D.; Harrington, S.A.; Brinton, J.; Venturini, L.; Davey, M.; Jacobs, J.; van Ex, F.; Pasha, A.; et al. The transcriptional landscape of polyploid wheat. Science 2018, 361, eaar6089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Voss-Fels, K.P.; Robinson, H.; Mudge, S.R.; Richard, C.; Newman, S.; Wittkop, B.; Stahl, A.; Friedt, W.; Frisch, M.; Gabur, I.; et al. VERNALIZATION1 modulates root system architecture in wheat and barley. Mol. Plant 2018, 11, 226–229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nishida, H.; Yoshida, T.; Kawakami, K.; Fujita, M.; Long, B.; Akashi, Y.; Laurie, D.A.; Kato, K. Structural variation in the 5′ upstream region of photoperiod-insensitive alleles Ppd-A1a and Ppd-B1a identified in hexaploid wheat (Triticum aestivum L.), and their effect on heading time. Mol. Breed. 2013, 31, 27–37. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
- Vrana, J.; Kubalakova, M.; Simkova, H.; Cihalikova, J.; Lysak, M.A.; Dolezel, J. Flow sorting of mitotic chromosomes in common wheat (Triticum aestivum L.). Genetics 2000, 156, 2033–2041. [Google Scholar] [CrossRef]
- Giorgi, D.; Farina, A.; Grosso, V.; Gennaro, A.; Ceoloni, C.; Lucretti, S. FISHIS: Fluorescence in situ hybridization in suspension and chromosome flow sorting made easy. PLoS ONE 2013, 8, e57994. [Google Scholar] [CrossRef] [Green Version]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Green Version]
- Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 2013, arXiv:1303.3997. [Google Scholar]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and samtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.O.N.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robinson, J.T.; Thorvaldsdóttir, H.; Wenger, A.M.; Zehir, A.; Mesirov, J.P. Variant review with the integrative genomics viewer. Cancer Res. 2017, 77, e31–e34. [Google Scholar] [CrossRef] [Green Version]
- Blake, V.C.; Woodhouse, M.R.; Lazo, G.R.; Odell, S.G.; Wight, C.P.; Tinker, N.A.; Wang, Y.; Gu, Y.Q.; Birkett, C.L.; Jannink, J.L.; et al. GrainGenes: Centralized small grain resources and digital platform for geneticists and breeders. Database 2019, 2019, baz065. [Google Scholar] [CrossRef]
- Bikandi, J.; Millán, R.S.; Rementeria, A.; Garaizar, J. In silico analysis of complete bacterial genomes: PCR, AFLP-PCR and endonuclease restriction. Bioinformatics 2004, 20, 798–799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ivaničová, Z.; Valárik, M.; Pánková, K.; Trávníčková, M.; Doležel, J.; Šafář, J.; Milec, Z. Heritable heading time variation in wheat lines with the same number of Ppd-B1 gene copies. PLoS ONE 2017, 12, e0183745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Oligo ID | 5′–3′ Sequence and Modifications | Amplicon Length | Reference |
---|---|---|---|
Ta-3D_F | CTCATCTCAGGCTGTCTAATTAA | 167 bp | [36] |
Ta-3D_R | CATAGATCCCTCCTTGAAGGA | ||
Ta-3D_taq | VIC-CCTCACTCAAGCACCACATCG-QSY | ||
CNV_VRNB1_F | CAGCATTCATCCAGCGGCAT | 114 bp | [28] |
CNV_VRNB1_R | CTTCAGCCGTTGATGTGGCTA | ||
CNV_VRNB1_taq | FAM-CAGAGGATGCGGCAGTGCAG-QSY | ||
CNV_VRND1_F | AAATTCTTGAACGGTATGAGCGCTAC | 109 bp | This study |
CNV_VRND1_R | GCTAAAGGAAAGCAAACCATTTG | ||
CNV_VRND1_taq | FAM-TGCAGAAAAGGTTCTCGTTTCAAGTG-QSY |
CNV | Winter Wheats | Spring Wheats | |||||||
---|---|---|---|---|---|---|---|---|---|
vrn-A1 | vrn-B1 | vrn-D1 | vrn-A1 | Vrn-A1a | Vrn-A1B | VRN-B1 | VRN-D1 | Vrn-D4 | |
1 | 4 | 65 | 65 | 4 | 15 | - | 40 | 40 | 1 |
2 | 18 | - | - | 6 | 8 | 3 | - | - | - |
3 | 41 | - | - | 4 | - | - | - | - | - |
4 | 2 | - | - | - | - | - | - | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Strejčková, B.; Milec, Z.; Holušová, K.; Cápal, P.; Vojtková, T.; Čegan, R.; Šafář, J. In-Depth Sequence Analysis of Bread Wheat VRN1 Genes. Int. J. Mol. Sci. 2021, 22, 12284. https://doi.org/10.3390/ijms222212284
Strejčková B, Milec Z, Holušová K, Cápal P, Vojtková T, Čegan R, Šafář J. In-Depth Sequence Analysis of Bread Wheat VRN1 Genes. International Journal of Molecular Sciences. 2021; 22(22):12284. https://doi.org/10.3390/ijms222212284
Chicago/Turabian StyleStrejčková, Beáta, Zbyněk Milec, Kateřina Holušová, Petr Cápal, Tereza Vojtková, Radim Čegan, and Jan Šafář. 2021. "In-Depth Sequence Analysis of Bread Wheat VRN1 Genes" International Journal of Molecular Sciences 22, no. 22: 12284. https://doi.org/10.3390/ijms222212284
APA StyleStrejčková, B., Milec, Z., Holušová, K., Cápal, P., Vojtková, T., Čegan, R., & Šafář, J. (2021). In-Depth Sequence Analysis of Bread Wheat VRN1 Genes. International Journal of Molecular Sciences, 22(22), 12284. https://doi.org/10.3390/ijms222212284