Root-to-Shoot Long-Distance Mobile miRNAs Identified from Nicotiana Rootstocks
Abstract
:1. Introduction
2. Results
2.1. Hypocotyl Grafting and Small RNA Deep Sequencing in At Scions and Nb Rootstocks
2.2. Small RNA Movement across the Graft Union
2.3. Mobile miRNA Detection
2.4. Pre- and Mature miRNA, but Not the Pri-miRNA, Can Be Detected in the Scion or Rootstock
2.5. Validation of miRNA Movement Using the MS2 System
2.6. Phenotypic Modification in the Scion by Root-to-Shoot Mobile Nb-miR164v
3. Discussion
3.1. Phloem-Mediated Bulk Flow of Mobile RNAs
3.2. Robustness of Heterografts in the Identification of Root-to-Shoot Long-Distance Mobile miRNA
3.3. Mobile Small RNA and Trait Modification in Grafts
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. Grafting
4.3. Tissue Collection and RNA Extraction
4.4. Small RNA Sequencing and Analysis
4.5. miRNA Detection
4.6. RT-PCR on Grafted Arabidopsis and Nicotiana Transgenic Lines
4.7. Plasmid Construction
4.8. Infiltration and Confocal Microscopy
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brosnan, C.A.; Mitter, N.; Christie, M.; Smith, N.A.; Waterhouse, P.M.; Carroll, B.J. Nuclear gene silencing directs reception of long-distance mRNA silencing in Arabidopsis. Proc. Natl. Acad. Sci. USA 2007, 104, 14741–14746. [Google Scholar] [CrossRef] [Green Version]
- Liang, D.; White, R.; Waterhouse, P. Gene silencing in Arabidopsis spreads from the root to the shoot, through a gating barrier, by template-dependent, nonvascular, cell-to-cell movement. Plant Physiol. 2012, 159, 984–1000. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallagher, K.L.; Sozzani, R.; Lee, C.M. Intercellular protein movement: Deciphering the language of development. Annu. Rev. Cell Dev. Biol. 2014, 30, 207–233. [Google Scholar] [CrossRef]
- Lough, T.; Lucas, W. Integrative plant biology role of phloem long- distance macromolecular trafficking. Annu. Rev. Plant Biol. 2006, 57, 203–232. [Google Scholar] [CrossRef] [Green Version]
- Stegemann, S.; Bock, R. Exchange of genetic material between cells in plant tissue grafts. Science 2009, 324, 649–651. [Google Scholar] [CrossRef] [PubMed]
- Atkins, C.A.; Smith, P.M.; Rodriguez-Medina, C. Macromolecules in phloem exudates—A review. Protoplasma 2011, 248, 165–172. [Google Scholar] [CrossRef]
- Fuentes, I.; Stegemann, S.; Golczyk, H.; Karcher, D.; Bock, R. Horizontal genome transfer as an asexual path to the formation of new species. Nature 2014, 511, 232. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Jia, T.; Chen, X. The ‘how’ and ‘where’ of plant microRNAs. New Phytol. 2017, 216, 1002–1017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corbesier, L.; Vincent, C.; Jang, S.; Fornara, F.; Fan, Q.; Searle, I.; Giakountis, A.; Farrona, S.; Gissot, L.; Turnbull, C.; et al. FT Protein Movement Contributes to Long-Distance Signaling in Floral Induction of Arabidopsis. Science 2007, 316, 1030–1033. [Google Scholar] [CrossRef] [Green Version]
- Lin, M.K.; Belanger, H.; Lee, Y.J.; Varkonyi-Gasic, E.; Taoka, K.; Miura, E.; Xoconostle-Cazares, B.; Gendler, K.; Jorgensen, R.A.; Phinney, B.; et al. FLOWERING LOCUS T protein may act as the long-distance florigenic signal in the cu-curbits. Plant Cell 2007, 19, 1488–1506. [Google Scholar] [CrossRef] [Green Version]
- Yoo, S.; Hong, S.; Jung, H.; Ahn, J. The cotyledons produce sufficient FT protein to induce flowering: Evidence from cotyledon micrografting in Arabidopsis. Plant Cell Physiol. 2013, 54, 119–128. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Liu, L.; Shen, L.; Yu, H. NaKR1 regulates long-distance movement of FLOWERING LOCUS T in Arabidopsis. Nat. Plants 2016, 2, 16075. [Google Scholar] [CrossRef]
- Paultre, D.; Gustin, M.; Molnar, A.; Oparka, K. Lost in transit: Long-distance trafficking and phloem unloading of protein signals in Arabidopsis homografts. Plant Cell 2016, 28, 2016–2025. [Google Scholar] [CrossRef] [Green Version]
- Calderwood, A.; Kopriva, S.; Morris, R.J. Transcript Abundance Explains mRNA Mobility Data in Arabidopsis thaliana. Plant Cell 2016, 28, 610–615. [Google Scholar] [CrossRef] [Green Version]
- Kim, G.; LeBlanc, M.L.; Wafula, E.K.; dePamphilis, C.W.; Westwood, J.H. Genomic-scale exchange of mRNA between a parasitic plant and its hosts. Science 2014, 345, 808–811. [Google Scholar] [CrossRef]
- Zhang, W.; Thieme, C.J.; Kollwig, G.; Apelt, F.; Yang, L.; Winter, N.; Andresen, N.; Walther, D.; Kragler, F. tRNA-Related Sequences Trigger Systemic mRNA Transport in Plants. Plant Cell 2016, 28, 1237–1249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Axtell, M. Classification and comparison of small RNAs from plants. Annu. Rev. Plant Biol. 2013, 64, 137–159. [Google Scholar] [CrossRef] [Green Version]
- Molnar, A.; Melnyk, C.W.; Bassett, A.; Hardcastle, T.J.; Dunn, R.; Baulcombe, D.C. Small Silencing RNAs in Plants Are Mobile and Direct Epigenetic Modification in Recipient Cells. Science 2010, 328, 872–875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alvarez, J.P.; Pekker, I.; Goldshmidt, A.; Blum, E.; Amsellem, Z.; Eshed, Y. Endogenous and Synthetic MicroRNAs Stimulate Simultaneous, Efficient, and Localized Regulation of Multiple Targets in Diverse Species. Plant Cell 2006, 18, 1134–1151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Polydore, S.; Axtell, M.J. Analysis of RDR1/RDR2/RDR6-independent small RNAs in Arabidopsis thaliana improves MIRNA annotations and reveals unexplained types of short interfering RNA loci. Plant J. 2018, 4, 1051–1063. [Google Scholar] [CrossRef] [Green Version]
- Marin-Gonzalez, E.; Suarez-Lopez, P. “And yet it moves”: Cell-to-cell and long-distance signaling by plant microRNAs. Plant Sci. 2012, 196, 18–30. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Chen, X. Intercellular and systemic trafficking of RNAs in plants. Nat. Plants 2018, 4, 869–878. [Google Scholar] [CrossRef] [PubMed]
- Deng, Z.; Wu, H.; Jin, T.; Cai, T.; Jiang, M.; Wang, M.; Liang, D. A Sequential Three-Phase Pathway Constitutes Tracheary Element Connection in the Arabidopsis/Nicotiana Interfamilial Grafts. Front. Plant Sci. 2021, 12, 664342. [Google Scholar] [CrossRef] [PubMed]
- Bhogale, S.; Mahajan, A.; Natarajan, B.; Rajabhoj, M.; Thulasiram, H.; Banerjee, A. MicroRNA156: A potential graft-transmissible microRNA that modulates plant architecture and tuberization in Solanum tuberosum ssp. andigena. Plant Physiol. 2014, 164, 1011–1027. [Google Scholar] [CrossRef] [Green Version]
- Varkonyi-Gasic, E.; Wu, R.; Wood, M.; Walton, E.F.; Hellens, R.P. Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 2007, 3, 12. [Google Scholar] [CrossRef] [Green Version]
- Luo, K.-R.; Huang, N.-C.; Yu, T.-S. Selective Targeting of Mobile mRNAs to Plasmodesmata for Cell-to-Cell Movement. Plant Physiol. 2018, 177, 604–614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thieme, C.; Rojas-Triana, M.; Stecyk, E.; Schudoma, C.; Zhang, W.; Yang, L.; Miñambres, M.; Walther, D.; Schulze, W.; Paz-Ares, J.; et al. Endogenous Arabidopsis messenger RNAs transported to distant tissues. Nat. Plants 2015, 1, 15025. [Google Scholar] [CrossRef]
- Laufs, P.; Peaucelle, A.; Morin, H.; Traas, J. MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems. Development 2004, 131, 4311–4322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raman, S.; Greb, T.; Peaucelle, A.; Blein, T.; Laufs, P.; Theres, K. Interplay of miR164, CUP-SHAPED COTYLEDON genes and LATERAL SUPPRESSOR controls axillary meristem formation in Arabidopsis thaliana. Plant J. 2008, 55, 65–76. [Google Scholar] [CrossRef]
- Berger, Y.; Harpaz-Saad, S.A.; Melnik, H.N.; Alvarez, J.P.; Zinder, M.; Samach, A.; Eshed, Y.; Ori, N. The NAC-domain transcription factor GOBLET specifies leaflet boundaries in compound tomato leaves. Development 2009, 136, 823–832. [Google Scholar] [CrossRef] [Green Version]
- Harada, T. Grafting and RNA transport via phloem tissue in horticultural plants. Sci. Hortic. 2010, 125, 545–550. [Google Scholar] [CrossRef]
- Gaion, L.A.; Carvalho, R.F. Long-Distance Signaling: What Grafting has Revealed? J. Plant Growth Regul. 2017, 37, 694–704. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Jiang, L.; Wu, R. Plant grafting: How genetic exchange promotes vascular reconnection. New Phytol. 2017, 214, 56–65. [Google Scholar] [CrossRef] [Green Version]
- Notaguchi, M.; Higashiyama, T.; Suzuki, T. Identification of mRNAs that move over long distances using an RNA-Seq analysis of Arabidopsis/Nicotiana benthamiana heterografts. Plant Cell Physiol. 2015, 56, 311–321. [Google Scholar] [CrossRef] [Green Version]
- Xia, C.; Zheng, Y.; Huang, J.; Zhou, X.; Li, R.; Zha, M.; Wang, S.; Huang, Z.; Lan, H.; Turgeon, R.; et al. Elucidation of the Mechanisms of Long-Distance mRNA Movement in a Nicotiana benthamiana/Tomato Heterograft System. Plant Physiol. 2018, 177, 745–758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, S.; Wang, X.; Xu, W.; Liu, T.; Cai, C.; Chen, L.; Clark, C.B.; Ma, J. Unidirectional movement of small RNAs from shoots to roots in interspecific heterografts. Nat. Plants 2021, 7, 50–59. [Google Scholar] [CrossRef]
- Lin, S.; Chiang, S.; Lin, W.; Chen, J.; Tseng, C.; Wu, P.; Chiou, T. Regulatory Network of MicroRNA399 and PHO2 by Systemic Signaling. Plant Physiol. 2008, 147, 732–746. [Google Scholar] [CrossRef] [Green Version]
- Pant, B.D.; Buhtz, A.; Kehr, J.; Scheible, W.R. MicroRNA399 is a long-distance signal for the regulation of plant phosphate homeostasis. Plant J. 2008, 53, 731–738. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buhtz, A.; Pieritz, J.; Springer, F.; Kehr, J. Phloem small RNAs, nutrient stress responses, and systemic mobility. BMC Plant Biol. 2010, 10, 64. [Google Scholar] [CrossRef] [Green Version]
- Huen, A.; Rodriguez-Medina, C.; Ho, A.; Atkins, C.; Smith, P.M.C. Long-distance movement of phosphate starvation-responsive microRNAs in Arabidopsis. Plant Biol. 2017, 19, 643–649. [Google Scholar] [CrossRef] [PubMed]
- Yoo, B.-C.; Kragler, F.; Varkonyi-Gasic, E.; Haywood, V.; Archer-Evans, S.; Lee, Y.M.; Lough, T.J.; Lucas, W.J. A Systemic Small RNA Signaling System in Plants. Plant Cell 2004, 16, 1979–2000. [Google Scholar] [CrossRef] [Green Version]
- Buhtz, A.; Springer, F.; Chappell, L.; Baulcombe, D.; Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 2008, 53, 739–749. [Google Scholar] [CrossRef] [PubMed]
- Pant, B.D.; Musialak-Lange, M.; Nuc, P.; May, P.; Buhtz, A.; Kehr, J.; Walther, D.; Scheible, W.-R. Identification of Nutri-ent-Responsive Arabidopsis and Rapeseed MicroRNAs by Comprehensive Real-Time Polymerase Chain Reaction Profiling and Small RNA Sequencing. Plant Physiol. 2009, 150, 1541–1555. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Medina, C.; Atkins, C.A.; Mann, A.J.; Jordan, M.E.; Smith, P.M. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L.). BMC Plant Biol. 2011, 11, 36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gai, Y.-P.; Zhao, H.-N.; Zhao, Y.-N.; Zhu, B.-S.; Yuan, S.-S.; Li, S.; Guo, F.-Y.; Ji, X.-L. MiRNA-seq-based profiles of miRNAs in mulberry phloem sap provide insight into the pathogenic mechanisms of mulberry yellow dwarf disease. Sci. Rep. 2018, 8, 812. [Google Scholar] [CrossRef] [Green Version]
- Tsikou, D.; Yan, Z.; Holt, D.B.; Abel, N.B.; Reid, D.E.; Madsen, L.H.; Bhasin, H.; Sexauer, M.; Stougaard, J.; Markmann, K. Systemic control of legume susceptibility to rhizobial infection by a mobile microRNA. Science 2018, 362, eaat6907. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Mao, L.; Jittayasothorn, Y.; Kang, Y.; Jiao, C.; Fei, Z.; Zhong, G. Message RNA exchange between scions and rootstocks in grafted grapevines. BMC Plant Biol. 2015, 15, 251. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Zheng, Y.; Ham, B.K.; Chen, J.; Yoshida, A.; Kochian, L.V.; Fei, Z.; Lucas, W.J. Vascular-mediated signalling involved in early phosphate stress response in plants. Nat. Plants 2016, 2, 16033. [Google Scholar] [CrossRef] [PubMed]
- Schöning, U.; Kollmann, R. Phloem translocation in regenerating in vitro- heterografts of different compatibility. J. Exp. Bot. 1997, 48, 289–295. [Google Scholar] [CrossRef] [Green Version]
- Espen, L.; Cocucci, M.; Sacchi, G.A. Differentiation and functional connection of vascular elements in compatible and incompatible pear/quince internode micrografts. Tree Physiol. 2005, 25, 1419–1425. [Google Scholar] [CrossRef] [Green Version]
- Benkovics, A.H.; Timmermans, M.C. Developmental patterning by gradients of mobile small RNAs. Curr. Opin. Genet. Dev. 2014, 27, 83–91. [Google Scholar] [CrossRef]
- Banerjee, A.K.; Chatterjee, M.; Yu, Y.; Suh, S.-G.; Miller, W.A.; Hannapel, D.J. Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway. Plant Cell 2006, 18, 3443–3457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, H.; Li, E.; Mansfield, S.D.; Cronk, Q.C.B.; El-Kassaby, Y.A.; Douglas, C.J. The developing xylem transcriptome and ge-nome-wide analysis of alternative splicing in Populus trichocarpa (black cottonwood) populations. BMC Genom. 2013, 14, 359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.; Quan, M.; Zhang, D. Genome-wide identification of novel long non-coding RNAs in Populus tomentosa tension wood, opposite wood and normal wood xylem by RNA-seq. Planta 2015, 241, 125–143. [Google Scholar] [CrossRef]
- Cai, M.; Huang, H.; Ni, F.; Tong, Z.; Lin, E.; Zhu, M. RNA-Seq analysis of differential gene expression in Betula luminifera xylem during the early stages of tension wood formation. PeerJ 2018, 6, e5427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Notaguchi, M.; Okamoto, S. Dynamics of long-distance signaling via plant vascular tissues. Front. Plant Sci. 2015, 6, 161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Knip, M.; Constantin, M.E.; Thordal-Christensen, H. Trans-kingdom Cross-Talk: Small RNAs on the Move. PLoS Genet. 2014, 10, e1004602. [Google Scholar] [CrossRef]
- Ham, B.-K.; Lucas, W.J. Phloem-Mobile RNAs as Systemic Signaling Agents. Annu. Rev. Plant Biol. 2017, 68, 173–195. [Google Scholar] [CrossRef] [PubMed]
- Kawashima, C.G.; Yoshimoto, N.; Maruyama-Nakashita, A.; Tsuchiya, Y.N.; Saito, K.; Takahashi, H.; Dalmay, T. Sulphur starvation induces the expression of microRNA-395 and one of its target genes but in different cell types. Plant J. 2009, 57, 313–321. [Google Scholar] [CrossRef]
- Liang, G.; Yang, F.; Yu, D. MicroRNA395 mediates regulation of sulfate accumulation and allocation in Arabidopsis thaliana. Plant J. 2010, 62, 1046–1057. [Google Scholar] [CrossRef]
- Zhou, Z.S.; Song, J.B.; Yang, Z.M. Genome-wide identification of Brassica napus microRNAs and their targets in response to cadmium. J. Exp. Bot. 2012, 63, 4597–4613. [Google Scholar] [CrossRef] [Green Version]
- Li, T.; Li, H.; Zhang, Y.X.; Liu, J.Y. Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica). Nucleic Acids Res. 2011, 39, 2821–2833. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeong, D.-H.; Park, S.; Zhai, J.; Gurazada, S.G.R.; De Paoli, E.; Meyers, B.C.; Green, P.J. Massive Analysis of Rice Small RNAs: Mechanistic Implications of Regulated MicroRNAs and Variants for Differential Target RNA Cleavage. Plant Cell 2011, 23, 4185–4207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, X.; Wang, H.; Lu, Y.; de Ruiter, M.; Cariaso, M.; Prins, M.; van Tunen, A.; He, Y. Identification of conserved and novel mi-croRNAs that are responsive to heat stress in Brassica rapa. J. Exp. Bot. 2012, 63, 1025–1038. [Google Scholar] [CrossRef] [PubMed]
- Liang, D.; White, R.G.; Waterhouse, P.M. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide. PeerJ 2014, 2, e701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goldschmidt, E.E. Plant grafting: New mechanisms, evolutionary implications. Front. Plant Sci. 2014, 5, 727. [Google Scholar] [CrossRef] [Green Version]
- Albacete, A.; Martínez-Andújar, C.; Martínez-Pérez, A.; Thompson, A.J.; Dodd, I.C.; Pérez-Alfocea, F. Unravelling root-stock×scion interactions to improve food security. J. Exp. Bot. 2015, 66, 2211–2226. [Google Scholar] [CrossRef] [Green Version]
- Warschefsky, E.J.; Klein, L.L.; Frank, M.H.; Chitwood, D.H.; Londo, J.P.; von Wettberg, E.J.B.; Miller, A.J. Rootstocks: Diversity, Domestication, and Impacts on Shoot Phenotypes. Trends Plant Sci. 2016, 21, 418–437. [Google Scholar] [CrossRef]
- Gautier, A.T.; Chambaud, C.; Brocard, L.; Ollat, N.; Gambetta, G.A.; Delrot, S.; Cookson, S.J. Merging genotypes: Graft union formation and scion-rootstock interactions. J. Exp. Bot. 2019, 70, 747–755. [Google Scholar] [CrossRef]
- Melnyk, C.W.; Molnar, A.A.; Baulcombe, D.C. Mobile 24 nt small RNAs direct transcriptional gene silencing in the root meristems of Arabidopsis thaliana. Curr. Biol. 2011, 21, 1678–1683. [Google Scholar] [CrossRef] [Green Version]
- Lewsey, M.G.; Hardcastle, T.J.; Melnyk, C.W.; Molnar, A.; Valli, A.; Urich, M.A.; Nery, J.R.; Baulcombe, D.C.; Ecker, J.R. Mobile small RNAs regulate genome-wide DNA methylation. Proc. Natl. Acad. Sci. USA 2016, 113, E801–E810. [Google Scholar] [CrossRef] [Green Version]
- Kundariya, H.; Yang, X.; Morton, K.; Sanchez, R.; Axtell, M.J.; Hutton, S.F.; Fromm, M.; Mackenzie, S.A. MSH1-induced heritable enhanced growth vigor through grafting is associated with the RdDM pathway in plants. Nat. Commun. 2020, 11, 5343. [Google Scholar] [CrossRef]
- Guo, H.-S.; Xie, Q.; Fei, J.-F.; Chua, N.-H. MicroRNA Directs mRNA Cleavage of the Transcription Factor NAC1 to Downregulate Auxin Signals for Arabidopsis Lateral Root Development. Plant Cell 2005, 17, 1376–1386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Peng, J.; Wen, X.; Guo, H. Ethylene-insensitive3 is a senescence-associated gene that accelerates age-dependent leaf se-nescence by directly repressing miR164 transcription in Arabidopsis. Plant Cell 2013, 25, 3311–3328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andersen, T.G.; Liang, D.; Halkier, B.A.; White, R. Grafting Arabidopsis. BioProtocol 2014, 4, e1164. [Google Scholar] [CrossRef]
- Turner, M.; Adhikari, S.; Subramanian, S. Optimizing stem-loop qPCR assays through multiplexed cDNA synthesis of U6 and miRNAs. Plant Signal. Behav. 2013, 8, e24918. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Gu, M.; Shi, N.; Zhang, H.; Yang, X.; Osman, T.; Liu, Y.; Wang, H.; Vatish, M.; Jackson, S.; et al. Mobile FT mRNA con-tributes to the systemic florigen signalling in floral induction. Sci. Rep. 2011, 1, 73. [Google Scholar] [CrossRef] [Green Version]
Samples | Species | Tissue Samples | Total Reads | Clean Reads (%) | Total sRNA Reads from At | ||||
---|---|---|---|---|---|---|---|---|---|
Scion | Rootstock | sRNA Reads | Mapped sRNA Reads (%) | Unmapped sRNA Reads | Re-Mapping to Nb (%) | ||||
AGS | A.thaliana | N.benthamiana | cauline leaf, stem, flower | 77,896,720 | 62,481,229 (80.21%) | 41,991,400 | 25,206,466 (60.03%) | 16,784,934 | 298,739 (0.71%) |
ACS | A.thaliana | A.thaliana | cauline leaf, stem, flower | 76,187,700 | 57,001,571 (74.82%) | 34,161,421 | 20,766,148 (60.79%) | 13,395,273 | 237,220 (0.69%) |
Sample | Species | Tissue Samples | Total Reads | Clean Reads (%) | Total sRNA Reads from Nb | ||||
---|---|---|---|---|---|---|---|---|---|
Scion | Rootstock | sRNA Reads | Mapped sRNA Reads (%) | Unmapped sRNA Reads | Re-Mapping to At (%) | ||||
NGR | A.thaliana | N.benthamiana | root | 68,325,049 | 62,307,593 (91.19%) | 52,616,678 | 36,897,829 (70.13%) | 15,718,849 | 152,412 (0.29%) |
NCR | N.benthamiana | N.benthamiana | root | 256,050,792 | 223,052,992 (87.11%) | 166,724,440 | 112,256,797 (67.33%) | 54,467,643 | 89,082 (0.05%) |
Sequencing ID | miRNA Family | Mature miRNA Sequence | Length | AGS Read Counts | ACS Read Counts | ||||
---|---|---|---|---|---|---|---|---|---|
AGS1 | AGS2 | AGS3 | ACS1 | ACS2 | ACS3 | ||||
conservative_Niben101Scf00647_2272 (Nb-miR156 variant or Nb-miR156v) | miR156 | UGACAGAAGAGAGUGGGC | 18 | 4 | 9 | 6 | 0 | 0 | 0 |
conservative_Niben101Scf00747_2488 (Nb-miR164 variant or Nb-miR164v) | miR164 | UGGAGAAGCAGGGCACAUGC | 20 | 1 | 1 | 1 | 0 | 0 | 0 |
conservative_Niben101Scf02279_7619 (Nb-miR395-1) | miR395 | CUGAAGUGUUUGGGGGAACUCU | 22 | 3 | 13 | 1 | 0 | 0 | 0 |
conservative_Niben101Scf02027_6631 (Nb-miR1446 variant or Nb-miR1446v) | miR1446 | UUCUGAACUCUCUCCCUCAAU | 21 | 0 | 3 | 0 | 0 | 0 | 0 |
conservative_Niben101Scf02778_9073 (Nb-miR397 variant or Nb-miR397v) | miR397 | UCAUUGAGUGCAGCGUUGAUGA | 22 | 1 | 3 | 5 | 0 | 0 | 0 |
conservative_Niben101Scf01112_4153 (Nb-miR395-2) | miR395 | CUGAAGUGUUUGGGGGAACUCCG | 23 | 25 | 47 | 45 | 0 | 0 | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, Z.; Wu, H.; Li, D.; Li, L.; Wang, Z.; Yuan, W.; Xing, Y.; Li, C.; Liang, D. Root-to-Shoot Long-Distance Mobile miRNAs Identified from Nicotiana Rootstocks. Int. J. Mol. Sci. 2021, 22, 12821. https://doi.org/10.3390/ijms222312821
Deng Z, Wu H, Li D, Li L, Wang Z, Yuan W, Xing Y, Li C, Liang D. Root-to-Shoot Long-Distance Mobile miRNAs Identified from Nicotiana Rootstocks. International Journal of Molecular Sciences. 2021; 22(23):12821. https://doi.org/10.3390/ijms222312821
Chicago/Turabian StyleDeng, Zhuying, Huiyan Wu, Dongyi Li, Luping Li, Zhipeng Wang, Wenya Yuan, Yongzhong Xing, Chengdao Li, and Dacheng Liang. 2021. "Root-to-Shoot Long-Distance Mobile miRNAs Identified from Nicotiana Rootstocks" International Journal of Molecular Sciences 22, no. 23: 12821. https://doi.org/10.3390/ijms222312821