Generation of Knockout and Transgenic Zebrafish to Characterize Abcc4 Functions in Detoxification and Efflux of Lead
Abstract
:1. Introduction
2. Results
2.1. Induction of Zebrafish abcc4/Abcc4 by Lead Exposure
2.2. Zebrafish Abcc4 Functions in the Detoxification and Excretion of Lead in LLC-PK1 Cells
2.3. Generation of an abcc4-Knockout Zebrafish
2.4. Generation of an abcc4-Transgenic Zebrafish Line
2.5. Functional Characterization of the abcc4-Transgenic Zebrafish
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Zebrafish Maintenance and Lead Treatment
4.3. Generation of Transgenic Construct
4.4. Embryo Microinjection and Cell Culture
4.5. Knockout of Zebrafish Abcc4 by the CRISPR/Cas9 System
4.6. Genomic DNA Extraction and Transgene Detection
4.7. RNA Isolation, Real-Time PCR and Quantitative Real-Time PCR
4.8. Antibody Preparation and Western Blotting
4.9. Dye Accumulation Assay
4.10. Cytotoxicity Assay
4.11. Whole-Mount RNA In Situ Hybridization
4.12. Atomic Absorption Spectrometry Detection
4.13. Detection of Glutathione and ATPase Activity
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ABC | ATP-binding cassette transporters |
ABCC | Subfamily C of ABC superfamily |
ANOVA | One-way analysis of variance |
ATP | Adenosine triphosphate |
BCA | Bicinchoninic acid |
BSO | Buthionine sulfoximine |
bp | Base pair |
cAMP | cyclic adenosine monophosphate |
CCD | Charge coupled device |
Cd | Cadmium |
CDS | Coding sequence |
cGMP | cyclic guanosine monophosphate |
CRISPR | Clustered regularly interspaced palindromic repeats |
CTRL | Empty vector-transfected |
DMSO | Dimethyl sulfoxide |
DOAJ | Directory of open access journals |
ECL | Enhanced chemiluminescence |
E. coli | Escherichia coli |
GSH | Glutathione |
GST | Glutathione-S-transferase |
Hg | Mercury |
Hpf | Hours post-fertilization |
IPTG | Isopropy1-b-D-thiogalactopyranoside |
LLC-PK1 | Pig renal proximal tubule cell line |
MCB | Monochlorobimane |
MDPI | Multidisciplinary Digital Publishing Institute |
MRP | Multidrug resistance-associated protein |
MTT | 3-[4, 5-dimethylthiazol-2-yl]-2, 5 diphenyl tetrazolium bromide |
MXR | Multi-xenobiotic resistance |
NBDs | Nucleotide-binding domains |
Pb | Lead |
PBS | Phosphate buffered saline |
PCR | Polymerase chain reaction |
qPCR | Quantitative real-time PCR |
RIPA | Radio-immunoprecipitation assay |
RT-PCR | Real-time PCR |
ROS | Reactive oxygen species |
SD | Standard deviation |
TMDs | Transmembrane domains |
WISH | Whole-mount RNA in situ hybridization |
WT | Wild-type |
References
- Deeley, R.G.; Westlake, C.; Cole, S.P. Transmembrane transport of endo- and xenobiotics by mammalian ATP-binding cassette multidrug resistance proteins. Physiol. Rev. 2006, 86, 849–899. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hagmann, W.; Jesnowski, R.; Faissner, R.; Guo, C.; Löhr, J.M. ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology 2009, 9, 136–144. [Google Scholar] [CrossRef] [PubMed]
- Leslie, E.M.; Deeley, R.G.; Cole, S.P.C. Multidrug resistance proteins: Role of P-glycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense. Toxicol. Appl. Pharmacol. 2005, 204, 216–237. [Google Scholar] [CrossRef]
- Toyoda, Y.; Hagiya, Y.; Adachi, T.; Hoshijima, K.; Kuo, M.T.; Ishikawa, T. MRP class of human ATP binding cassette (ABC) transporters: Historical background and new research directions. Xenobiotica Fate Foreign Compd. Biol. Syst. 2008, 38, 833. [Google Scholar] [CrossRef]
- Borst, P.; De, W.C.; van de Wetering, K. Multidrug resistance-associated proteins 3, 4, and 5. Pflügers Arch. Eur. J. Physiol. 2007, 453, 661. [Google Scholar] [CrossRef]
- Russel, F.G.M.; Koenderink, J.B.; Masereeuw, R. Multidrug resistance protein 4 (MRP4/ABCC4): A versatile efflux transporter for drugs and signalling molecules. Trends Pharmacol. Sci. 2008, 29, 200. [Google Scholar] [CrossRef]
- Ritter, C.A.; Jedlitschky, G.; Schwabedissen, H.M.Z.; Grube, M.; Köck, K.; Kroemer, H.K. Cellular Export of Drugs and Signaling Molecules by the ATP-binding Cassette Transporters MRP4 (ABCC4) and MRP5 (ABCC5). Drug Metab. Rev. 2005, 37, 253–278. [Google Scholar] [CrossRef]
- van Aubel, R.A.; Smeets, P.H.; Peters, J.G.; Bindels, R.J.; Russel, F.G. The MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney proximal tubules: Putative efflux pump for urinary cAMP and cGMP. J. Am. Soc. Nephrol. 2002, 13, 595–603. [Google Scholar] [PubMed]
- Rius, M.; Nies, A.T.; Hummel-Eisenbeiss, J.; Jedlitschky, G.; Dietrich, K.M.D. Cotransport of reduced glutathione with bile salts by MRP4 (ABCC4) localized to the basolateral hepatocyte membrane. Hepatology 2003, 38, 374–384. [Google Scholar] [CrossRef]
- Kun, L.; Klein-Szanto, A.J.P.; Kruh, G.D. Analysis of the MRP4 Drug Resistance Profile in Transfected NIH3T3 Cells. J. Natl. Cancer Inst. 2000, 23, 1934–1940. [Google Scholar]
- Zhao, X.; Guo, Y.; Yue, W.; Zhang, L.; Gu, M.; Wang, Y. ABCC4 is required for cell proliferation and tumorigenesis in non-small cell lung cancer. Oncol. Targets Ther. 2014, 2014, 343–351. [Google Scholar]
- Lu, X.; Long, Y.; Lin, L.; Sun, R.; Zhong, S.; Cui, Z. Characterization of Zebrafish Abcc4 as an Efflux Transporter of Organochlorine Pesticides. PLoS ONE 2014, 9, e111664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nornberg, B.F.; Batista, C.R.; Almeida, D.V.; Trindade, G.S.; Marins, L.F. ABCB1 and ABCC4 efflux transporters are involved in methyl parathion detoxification in ZFL cells. Toxicol. Vitro Int. J. Publ. Assoc. Bibra 2015, 29, 204–210. [Google Scholar] [CrossRef]
- Leggas, M.; Adachi, M.; Scheffer, G.L.; Sun, D.; Wielinga, P.; Du, G.; Mercer, K.E.; Zhuang, Y.; Panetta, J.C.; Johnston, B. Mrp4 Confers Resistance to Topotecan and Protects the Brain from Chemotherapy. Mol. Cell. Biol. 2004, 24, 7612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Furmanski, B.D.; Hu, S.; Fujita, K.; Li, L.; Gibson, A.A.; Janke, L.J.; Williams, R.T.; Schuetz, J.D.; Sparreboom, A.; Baker, S.D. Contribution of Abcc4-Mediated Gastric Transport to the Absorption and Efficacy of Dasatinib. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2013, 19, 4359. [Google Scholar] [CrossRef] [Green Version]
- El-Khatib, A.A.; Hegazy, A.K.; Abo-El-Kassem, A.M. Bioaccumulation Potential and Physiological Responses of Aquatic Macrophytes to Pb Pollution. Int. J. Phytoremediation 2014, 16, 29–45. [Google Scholar] [CrossRef]
- Sharma, P.; Dubey, R.S. Lead toxicity in plants. Braz. J. Plant Physiol. 2005, 17, 35–52. [Google Scholar] [CrossRef] [Green Version]
- Flora, G.; Gupta, D.; Tiwari, A. Toxicity of lead: A review with recent updates. Interdiscip. Toxicol. 2012, 5, 47–58. [Google Scholar] [CrossRef]
- Lanphear, B.P.; Dietrich, K.N.; Berger, O. Prevention of Lead Toxicity in US Children. Ambul. Pediatrics 2003, 3, 27–36. [Google Scholar] [CrossRef]
- Needleman, H. Lead poisoning. Annu. Rev. Med. 2004, 55, 209–222. [Google Scholar] [CrossRef] [Green Version]
- Prã©Vã©Ral, S.; Gayet, L.; Moldes, C.; Hoffmann, J.; Mounicou, S.; Gruet, A.; Reynaud, F.; Lobinski, R.; Verbavatz, J.M.; Vavasseur, A. A common highly conserved cadmium detoxification mechanism from bacteria to humans: Heavy metal tolerance conferred by the ATP-binding cassette (ABC) transporter SpHMT1 requires glutathione but not metal-chelating phytochelatin peptides. J. Biol. Chem. 2009, 284, 4936–4943. [Google Scholar] [CrossRef] [Green Version]
- Aleo, M.F.; Morandini, F.; Bettoni, F.; Giuliani, R.; Rovetta, F.; Steimberg, N.; Apostoli, P.; Parrinello, G.; Mazzoleni, G. Endogenous thiols and MRP transporters contribute to Hg2+ efflux in HgCl2-treated tubular MDCK cells. Toxicology 2005, 206, 137–151. [Google Scholar] [CrossRef]
- Chen, Z.S.; Mutoh, M.; Sumizawa, T.; Furukawa, T.; Haraguchi, M.; Tani, A.; Akiyama, S. Reversal of heavy metal resistance in multidrug-resistant human KB carcinoma cells. Biochem. Biophys. Res. Commun. 1997, 236, 586–590. [Google Scholar] [CrossRef]
- Hill, A.J.; Teraoka, H.; Heideman, W.; Peterson, R.E. Zebrafish as a model vertebrate for investigating chemical toxicity. Toxicol. Sci. 2005, 86, 6–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spitsbergen, J.M.; Kent, M.L. The State of the Art of the Zebrafish Model for Toxicology and Toxicologic Pathology Research—Advantages and Current Limitations. Toxicol. Pathol. 2003, 31, 62. [Google Scholar]
- Long, Y.; Li, Q.; Wang, Y.; Cui, Z. MRP proteins as potential mediators of heavy metal resistance in zebrafish cells. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2011, 153, 310–317. [Google Scholar] [CrossRef] [PubMed]
- Goyer, R.A. Toxic and essential metal interactions. Annu. Rev. Nutr. 1997, 17, 37–50. [Google Scholar] [CrossRef] [PubMed]
- Sevcikova, M.; Modra, H.; Slaninova, A.; Svobodova, Z. Metals as a cause of oxidative stress in fish: A review. Vet Med-Czech 2011, 56, 537–546. [Google Scholar] [CrossRef] [Green Version]
- Bhattacharya, S. Signal transduction by xenobiotics in fish. Indian J. Exp. Biol. 2000, 38, 753–761. [Google Scholar]
- Hsu, P.C.; Guo, Y.L. Antioxidant nutrients and lead toxicity. Toxicology 2002, 180, 33–44. [Google Scholar] [CrossRef]
- Chen, Z.; Shi, T.; Zhang, L.; Zhu, P.; Deng, M.; Huang, C.; Hu, T.; Jiang, L.; Li, J. Mammalian drug efflux transporters of the ATP binding cassette (ABC) family in multidrug resistance: A review of the past decade. Cancer Lett. 2016, 370, 153–164. [Google Scholar] [CrossRef]
- Long, Y.; Li, Q.; Cui, Z. Molecular analysis and heavy metal detoxification of ABCC1/MRP1 in zebrafish. Mol. Biol. Rep. 2011, 38, 1703–1711. [Google Scholar] [CrossRef] [Green Version]
- Long, Y.; Li, Q.; Zhong, S.; Wang, Y.; Cui, Z. Molecular characterization and functions of zebrafish ABCC2 in cellular efflux of heavy metals. Comp. Biochem. Physiol. Toxicol. Pharmacol. CBP 2011, 153, 381–391. [Google Scholar] [CrossRef] [PubMed]
- Long, Y.; Li, Q.; Li, J.; Cui, Z. Molecular analysis, developmental function and heavy metal-induced expression of ABCC5 in zebrafish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2011, 158, 46–55. [Google Scholar] [CrossRef]
- Gallagher, E.P.; Giulio, R.T.D. Glutathione-mediated chlorothalonil detoxification in channel catfish gills. Marine Environ. Res. 2016, 34, 221–226. [Google Scholar] [CrossRef]
- Luckenbach, T.; Epel, D. ABCB- and ABCC-type transporters confer multixenobiotic resistance and form an environment-tissue barrier in bivalve gills. Am. J. Physiol. Regul. Integr. Comp Physiol. 2008, 294, 1919–1929. [Google Scholar] [CrossRef] [PubMed]
- van de Ven, R.; De, G.J.; Reurs, A.W.; Wijnands, P.G.; van de Wetering, K.; Schuetz, J.D.; de Gruijl, T.D.; Scheper, R.J.; Scheffer, G.L. Unimpaired immune functions in the absence of Mrp4 (Abcc4). Immunol. Lett. 2009, 124, 81–87. [Google Scholar]
- Zhu, Z. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L. 1758). Z Angew. Ichthyol. 1985, 1, 31–34. [Google Scholar] [CrossRef]
- Martínez, R.; Estrada, M.P.; Berlanga, J.; Guillén, I.; Hernández, O.; Cabrera, E.; Pimentel, R.; Morales, R.; Herrera, F.; Morales, A. Growth enhancement in transgenic tilapia by ectopic expression of tilapia growth hormone. Mol. Marine Biol. Biotechnol. 1996, 5, 62. [Google Scholar]
- Cook, J.T.; Mcniven, M.A.; Richardson, G.F.; Sutterlin, A.M. Growth rate, body composition and feed digestibility/conversion of growth-enhanced transgenic Atlantic salmon (Salmo salar). Aquaculture 2000, 188, 15–32. [Google Scholar] [CrossRef]
- Sun, Y.H.; Chen, S.P.; Wang, Y.P.; Hu, W.; Zhu, Z.Y. Cytoplasmic impact on cross-genus cloned fish derived from transgenic common carp (Cyprinus carpio) nuclei and goldfish (Carassius auratus) enucleated eggs. Biol. Reprod. 2005, 72, 510–515. [Google Scholar] [CrossRef]
- Wittbrodt, J.; Shima, A.; Schartl, M. Medaka—A model organism from the far East. Nat. Rev. Genet. 2002, 3, 53–64. [Google Scholar] [CrossRef] [PubMed]
- Feitsma, H.; Cuppen, E. Zebrafish as a cancer model. Mol. Cancer Res. 2008, 6, 685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Wei, H.U.; Gang, W.U.; Sun, Y.; Chen, S.; Zhang, F.; Zhu, Z.; Feng, J.; Zhang, X. Genetic analysis of “all-fish” growth hormone gene transferred carp (Cyprinus carpio L.) and its F1 generation. Chin. Sci. Bull. 2001, 46, 1174–1178. [Google Scholar]
- Vernhet, L.; Courtois, A.; Allain, N.; Payen, L.; Anger, J.P.; Guillouzo, A.; Fardel, O. Overexpression of the multidrug resistance-associated protein (MRP1) in human heavy metal-selected tumor cells. FEBS Lett. 1999, 443, 321–325. [Google Scholar] [CrossRef] [Green Version]
- Zaman, G.J.; Lankelma, J.; Van Tellingen, O.B.J.; Dekker, H.; Paulusma, C.; Oude Elferink, R.P.; Baas, F.; Borst, P. Role of glutathione in the export of compounds from cells by the multidrug-resistance-associated protein. Proc. Natl. Acad. Sci. USA 1995, 92, 7690–7694. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.J.; Park, E.H.; Lim, C.J. Stress-dependent regulation of the gene encoding gamma-glutamylcysteine synthetase from the fission yeast. Mol. Biol. Rep. 2004, 31, 23–30. [Google Scholar] [CrossRef] [PubMed]
- Westerfield, M. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio). In Zebrafish Book A Guide for the Laboratory Use of Zebrafish, 4th ed.; University of Oregon Press: Eugene, OR, USA, 2000. [Google Scholar]
- Hyatt, T.M.; Ekker, S.C. Vectors and techniques for ectopic gene expression in zebrafish. Methods in Cell Biology 1999, 59, 117. [Google Scholar]
- Chang, N.; Sun, C.; Gao, L.; Zhu, D.; Xu, X.; Zhu, X.; Xiong, J.W.; Xi, J.J. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 2013, 23, 465–472. [Google Scholar] [CrossRef] [Green Version]
- He, X.; Li, J.; Long, Y.; Song, G.; Zhou, P.; Liu, Q.; Zhu, Z.; Cui, Z. Gene transfer and mutagenesis mediated by Sleeping Beauty transposon in Nile tilapia (Oreochromis niloticus). Transgenic Res. 2013, 22, 913–924. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Li, Y.Y.; Li, Q.; Long, Y.; Cui, Z.B. Lzts2 Regulates Embryonic Cell Movements and Dorsoventral Patterning through Interaction with and Export of Nuclear beta-Catenin in Zebrafish. J. Biol. Chem. 2011, 286, 45116–45130. [Google Scholar] [CrossRef] [Green Version]
- Mo, S.; Wang, L.; Li, Q.; Li, J.; Li, Y.; Thannickal, V.J.; Cui, Z. Caveolin-1 regulates dorsoventral patterning through direct interaction with beta-catenin in zebrafish. Dev. Biol. 2010, 344, 210–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sepulveda, F.V.; Pearson, J.D. Deficiency in intercellular communication in two established renal epithelial cell lines (LLC-PK1 and MDCK). J. Cell Sci. 1984, 66, 81–93. [Google Scholar]
- Kuteykin-Teplyakov, K.; Luna-Tortos, C.; Ambroziak, K.; Loscher, W. Differences in the expression of endogenous efflux transporters in MDR1-transfected versus wildtype cell lines affect P-glycoprotein mediated drug transport. Br. J. Pharmacol. 2010, 160, 1453–1463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, X.; Xiang, Y.; Yang, G.; Zhang, L.; Wang, H.; Zhong, S. Transcriptomic characterization of zebrafish larvae in response to mercury exposure. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2017, 192, 40–49. [Google Scholar] [CrossRef]
- Thisse, C.; Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 2008, 3, 59–69. [Google Scholar] [CrossRef] [PubMed]
Generation of Transgenic Fish | Positive Fish Number | Total Fish Number | Positive Frequency (%) |
---|---|---|---|
F0 | 79 | 357 | 22.13 |
F1 | 63 | 132 | 47.73 |
F2 | 26 | 72 | 36.11 |
Primer Names | Sequences (5′–3′) | Description | Amplicon Size |
---|---|---|---|
BstB I-actin A-F | GATTTCGAAAAACGGACTGTTACCACTTCACG | Cloning, the BstB I site is underlined | 982 bp |
SBR-actin A-R | CCATGATTACGCCAAGCTCG | Cloning | |
Sph I-actin P-F | AGCTTGCATGCTCAAACTGTGGCACCATCT | Cloning; the Sph I site is underlined | 2134 bp |
Xma I-actin P-R | TGTCCCGGGCTGAACTGTAAATGAATGAG | Cloning; the Xma I site is underlined | |
Carp actin P-F | CAGGAATGCAAGCCTGATTC | Transgene detection | 460 bp |
Carp actin P-R | GAAGCTGGATTGTTTGAAGAGC | Transgene detection | |
abcc4-F | CTTCAGGACTGGTGGCTTTC | Transgene detection | 468 bp |
abcc4-R | CAGGAACAGGAAGCAAATCAAC | Transgene detection | |
Flag-F | GTCAACGGCAGCTCGTCTGTCTG | Transgene detection | 440 bp |
ABC-R3 | GTCATCGTCGTCCTTGTAGTC | Transgene detection | |
abcc4-qPCR-F | GTCCGCCTCACCGTCACTC | qPCR | 150 bp |
abcc4-qPCR-R | CGGCTCTTTCTTCTCCTCCTG | qPCR | |
abcc4-F9.14 | CCTTCCCAATACCATAATCACACT | Knockout mutant detection | |
abcc4-R9.14 | CAAGGTTGAGACTTGAAGCACAG | Knockout mutant detection | |
β-actin-F | CGAGCAGGAGATGGGAACC | qPCR | 102 bp |
β-actin-R | CAACGGAAACGCTCATTGC | qPCR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, X.; Long, Y.; Li, X.; Zhang, L.; Li, Q.; Wen, H.; Zhong, S.; Cui, Z. Generation of Knockout and Transgenic Zebrafish to Characterize Abcc4 Functions in Detoxification and Efflux of Lead. Int. J. Mol. Sci. 2021, 22, 2054. https://doi.org/10.3390/ijms22042054
Lu X, Long Y, Li X, Zhang L, Li Q, Wen H, Zhong S, Cui Z. Generation of Knockout and Transgenic Zebrafish to Characterize Abcc4 Functions in Detoxification and Efflux of Lead. International Journal of Molecular Sciences. 2021; 22(4):2054. https://doi.org/10.3390/ijms22042054
Chicago/Turabian StyleLu, Xing, Yong Long, Xixi Li, Lang Zhang, Qing Li, Hua Wen, Shan Zhong, and Zongbin Cui. 2021. "Generation of Knockout and Transgenic Zebrafish to Characterize Abcc4 Functions in Detoxification and Efflux of Lead" International Journal of Molecular Sciences 22, no. 4: 2054. https://doi.org/10.3390/ijms22042054