Metformin Protects the Intestinal Barrier by Activating Goblet Cell Maturation and Epithelial Proliferation in Radiation-Induced Enteropathy
Abstract
:1. Introduction
2. Results
2.1. Metformin Alleviated Radiation-Induced Enteropathy and Partially Inhibited Inflammation Response in a Mouse Model
2.2. Metformin Protected Intestinal Barrier Function by Indirectly Regulating Goblet Cell Maturation in Radiation Damage
2.3. Metformin Enhanced Tight-Junction Expression and Epithelial Proliferation in Irradiated Intestine
2.4. Metformin Promoted Stem Cell Properties with Wnt/B-Catenin Pathway Activation in Radiation Damage
2.5. Metformin Increased Budding Organoid Formation and Epithelial Proliferation by Activating Wnt/B-Catenin Signaling
3. Discussion
4. Material and Methods
4.1. Mice
4.2. Irradiation and Treatment of Metformin
4.3. Histological Analysis of the Small Intestine
4.4. RNA Extraction, Reverse Transcription Polymerase Chain Reaction (RT-PCR), and Real-Time PCR Quantification
4.5. Bacterial Translocation Assay
4.6. Culture, Budding, and MTT Assay of Mouse Intestinal Organoids
4.7. Cell Culture, Irradiation, and Viability Assay
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Citrin, D.; Cotrim, A.P.; Hyodo, F.; Baum, B.J.; Krishna, M.C.; Mitchell, J.B. Radioprotectors and mitigators of radiation-induced normal tissue injury. Oncologist 2010, 15, 360–371. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Hu, W.; Wang, W.; Chen, P.; Ding, W.; Luo, W. Replanning during intensity modulated radiation therapy improved quality of life in patients with nasopharyngeal carcinoma. Int. J. Radiat. Oncol. Biol. Phys. 2013, 85, e47–e54. [Google Scholar] [CrossRef] [PubMed]
- Damman, C.J.; Surawicz, C.M. The gut microbiota: A microbial arsenal protecting us from infectious and radiation-induced diarrhea. Gastroenterology 2009, 136, 722–724. [Google Scholar] [CrossRef] [PubMed]
- Dubois, A.; Walker, R.I. Prospects for management of gastrointestinal injury associated with the acute radiation syndrome. Gastroenterology 1988, 95, 500–507. [Google Scholar] [CrossRef]
- Potten, C.S. Radiation, the ideal cytotoxic agent for studying the cell biology of tissues such as the small intestine. Radiat. Res. 2004, 161, 123–136. [Google Scholar] [CrossRef]
- Yu, J. Intestinal stem cell injury and protection during cancer therapy. Transl. Cancer Res. 2013, 2, 384–396. [Google Scholar]
- Okumura, R.; Takeda, K. Roles of intestinal epithelial cells in the maintenance of gut homeostasis. Exp. Mol. Med. 2017, 49, e338. [Google Scholar] [CrossRef] [Green Version]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef]
- Martini, E.; Krug, S.M.; Siegmund, B.; Neurath, M.F.; Becker, C. Mend Your Fences: The Epithelial Barrier and its Relationship With Mucosal Immunity in Inflammatory Bowel Disease. Cell. Mol. Gastroenterol. Hepatol. 2017, 4, 33–46. [Google Scholar] [CrossRef] [Green Version]
- Birchenough, G.M.; Johansson, M.E.; Gustafsson, J.K.; Bergström, J.H.; Hansson, G.C. New developments in goblet cell mucus secretion and function. Mucosal Immunol. 2015, 8, 712–719. [Google Scholar] [CrossRef] [Green Version]
- Shirazi, T.; Longman, R.J.; Corfield, A.P.; Probert, C.S. Mucins and inflammatory bowel disease. Postgrad. Med. J. 2000, 76, 473–478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corfield, A.P. Mucins: A biologically relevant glycan barrier in mucosal protection. Biochim. Biophys. Acta 2015, 1850, 236–252. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Kissoon-Singh, V.; Coria, A.L.; Moreau, F.; Chadee, K. Probiotic mixture VSL#3 reduces colonic inflammation and improves intestinal barrier function in Muc2 mucin-deficient mice. Am. J. Physiol.-Gastrointest. Liver Physiol. 2017, 312, G34–G45. [Google Scholar] [PubMed]
- Gersemann, M.; Becker, S.; Kübler, I.; Koslowski, M.; Wang, G.; Herrlinger, K.R.; Griger, J.; Fritz, P.; Fellermann, K.; Schwab, M.; et al. Differences in goblet cell differentiation between Crohn’s disease and ulcerative colitis. Differentiation 2009, 77, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Strugala, V.; Dettmar, P.W.; Pearson, J.P. Thickness and continuity of the adherent colonic mucus barrier in active and quiescent ulcerative colitis and Crohn’s disease. Int. J. Clin. Pract. 2008, 62, 762–769. [Google Scholar] [CrossRef]
- Schulzke, J.D.; Ploeger, S.; Amasheh, M.; Fromm, A.; Zeissig, S.; Troeger, H.; Richter, J.; Bojarski, C.; Schumann, M.; Fromm, M. Epithelial tight junctions in intestinal inflammation. Ann. N. Y. Acad. Sci. 2009, 1165, 294–300. [Google Scholar] [CrossRef]
- Shukla, P.K.; Gangwar, R.; Manda, B.; Meena, A.S.; Yadav, N.; Szabo, E.; Balogh, A.; Lee, S.C.; Tigyi, G.; Rao, R. Rapid disruption of intestinal epithelial tight junction and barrier dysfunction by ionizing radiation in mouse colon in vivo: Protection by N-acetyl-l-cysteine. Am. J. Physiol.-Gastrointest. Liver Physiol. 2016, 310, G705–G715. [Google Scholar] [CrossRef] [Green Version]
- Nejdfors, P.; Ekelund, M.; Weström, B.R.; Willén, R.; Jeppsson, B. Intestinal permeability in humans is increased after radiation therapy. Dis. Colon Rectum 2000, 43, 1582–1587; discussion 1587-8. [Google Scholar] [CrossRef]
- Lindemans, C.A.; Calafiore, M.; Mertelsmann, A.M.; O’Connor, M.H.; Dudakov, J.A.; Jenq, R.R.; Velardi, E.; Young, L.F.; Smith, O.M.; Lawrence, G.; et al. Interleukin-22 promotes intestinal-stem-cell-mediated epithelial regeneration. Nature 2015, 528, 560–564. [Google Scholar] [CrossRef] [Green Version]
- Schuijers, J.; Clevers, H. Adult mammalian stem cells: The role of Wnt, Lgr5 and R-spondins. EMBO J. 2012, 31, 2685–2696. [Google Scholar] [CrossRef]
- Mortezaee, K.; Shabeeb, D.; Musa, A.E.; Najafi, M.; Farhood, B. Metformin as a Radiation Modifier; Implications to Normal Tissue Protection and Tumor Sensitization. Curr. Clin. Pharmacol. 2019, 14, 41–53. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wang, J.; You, Q.; He, S.; Meng, Q.; Gao, J.; Wu, X.; Shen, Y.; Sun, Y.; Wu, X.; et al. Activating AMPK to Restore Tight Junction Assembly in Intestinal Epithelium and to Attenuate Experimental Colitis by Metformin. Front. Pharmacol. 2018, 9, 761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pålsson-McDermott, E.M.; O’Neill, L.A.J. Targeting immunometabolism as an anti-inflammatory strategy. Cell Res. 2020, 30, 300–314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jang, W.I.; Kim, M.S.; Lim, J.S.; Yoo, H.J.; Seo, Y.S.; Han, C.J.; Park, S.C.; Kay, C.S.; Kim, M.; Jang, H.S.; et al. Survival Advantage Associated with Metformin Usage in Hepatocellular Carcinoma Patients Receiving Radiotherapy: A Propensity Score Matching Analysis. Anticancer Res. 2015, 35, 5047–5054. [Google Scholar] [PubMed]
- Zhang, T.; Wang, F.; Li, K.; Lv, C.; Gao, K.; Lv, C. Therapeutic effect of metformin on inflammation and apoptosis after spinal cord injury in rats through the Wnt/β-catenin signaling pathway. Neurosci. Lett. 2020, 739, 135440. [Google Scholar] [CrossRef]
- Shim, S.; Jang, H.S.; Myung, H.W.; Myung, J.K.; Kang, J.K.; Kim, M.J.; Lee, S.B.; Jang, W.S.; Lee, S.J.; Jin, Y.W.; et al. Rebamipide ameliorates radiation-induced intestinal injury in a mouse model. Toxicol. Appl. Pharmacol. 2017, 329, 40–47. [Google Scholar] [CrossRef]
- Chen, G.; Korfhagen, T.R.; Xu, Y.; Kitzmiller, J.; Wert, S.E.; Maeda, Y.; Gregorieff, A.; Clevers, H.; Whitsett, J.A. SPDEF is required for mouse pulmonary goblet cell differentiation and regulates a network of genes associated with mucus production. J. Clin. Investig. 2009, 119, 2914–2924. [Google Scholar] [CrossRef] [Green Version]
- Kwak, S.Y.; Jang, W.I.; Park, S.; Cho, S.S.; Lee, S.B.; Kim, M.J.; Park, S.; Shim, S.; Jang, H. Metallothionein 2 activation by pravastatin reinforces epithelial integrity and ameliorates radiation-induced enteropathy. EBioMedicine 2021, 73, 103641. [Google Scholar] [CrossRef]
- Liu, L.; Yao, J.; Li, Z.; Zu, G.; Feng, D.; Li, Y.; Qasim, W.; Zhang, S.; Li, T.; Zeng, H.; et al. miR-381-3p knockdown improves intestinal epithelial proliferation and barrier function after intestinal ischemia/reperfusion injury by targeting nurr1. Cell Death Dis. 2018, 9, 411. [Google Scholar] [CrossRef] [Green Version]
- Otsuka, K.; Suzuki, K. Differences in Radiation Dose Response between Small and Large Intestinal Crypts. Radiat Res. 2016, 186, 302–314. [Google Scholar] [CrossRef]
- Tan, D.W.; Barker, N. Intestinal stem cells and their defining niche. Curr. Top. Dev. Biol. 2014, 107, 77–107. [Google Scholar] [PubMed]
- Weiser, M.M.; Quaroni, A. A vitamin D-related inhibition of growth of an epithelioid cell line derived from rat small intestine. Biochem. Biophys. Res. Commun. 1979, 90, 788–793. [Google Scholar] [CrossRef]
- Stacey, R.; Green, J.T. Radiation-induced small bowel disease: Latest developments and clinical guidance. Ther. Adv. Chronic Dis. 2014, 5, 15–29. [Google Scholar] [CrossRef] [Green Version]
- Rao, M.; Gao, C.; Guo, M.; Law, B.Y.K.; Xu, Y. Effects of metformin treatment on radiotherapy efficacy in patients with cancer and diabetes: A systematic review and meta-analysis. Cancer Manag. Res. 2018, 10, 4881–4890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, F.; Song, L.; Wang, W. Metformin Improves Overall Survival of Colorectal Cancer Patients with Diabetes: A Meta-Analysis. J. Diabetes Res. 2017, 2017, 5063239. [Google Scholar] [CrossRef] [PubMed]
- Ahmadi, S.; Razazan, A.; Nagpal, R.; Jain, S.; Wang, B.; Mishra, S.P.; Wang, S.; Justice, J.; Ding, J.; McClain, D.A.; et al. Metformin Reduces Aging-Related Leaky Gut and Improves Cognitive Function by Beneficially Modulating Gut Microbiome/Goblet Cell/Mucin Axis. J. Gerontol. A Biol. Sci. Med. Sci. 2020, 75, e9–e21. [Google Scholar] [CrossRef]
- Sheng, Y.H.; Hasnain, S.Z.; Florin, T.H.; McGuckin, M.A. Mucins in inflammatory bowel diseases and colorectal cancer. J. Gastroenterol. Hepatol. 2012, 27, 28–38. [Google Scholar] [CrossRef]
- Ke, H.; Li, F.; Deng, W.; Li, Z.; Wang, S.; Lv, P.; Chen, Y. Metformin Exerts Anti-inflammatory and Mucus Barrier Protective Effects by Enriching Akkermansia muciniphila in Mice With Ulcerative Colitis. Front. Pharmacol. 2021, 12, 726707. [Google Scholar] [CrossRef]
- Saha, S.; Bhanja, P.; Liu, L.; Alfieri, A.A.; Yu, D.; Kandimalla, E.R.; Agrawal, S.; Guha, C. TLR9 agonist protects mice from radiation-induced gastrointestinal syndrome. PLoS ONE 2012, 7, e29357. [Google Scholar] [CrossRef]
- Saha, S.; Aranda, E.; Hayakawa, Y.; Bhanja, P.; Atay, S.; Brodin, N.P.; Li, J.; Asfaha, S.; Liu, L.; Tailor, Y.; et al. Macrophage-derived extracellular vesicle-packaged WNTs rescue intestinal stem cells and enhance survival after radiation injury. Nat. Commun. 2016, 7, 13096. [Google Scholar] [CrossRef]
- Clevers, H.; Nusse, R. Wnt/β-catenin signaling and disease. Cell 2012, 149, 1192–1205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Romesser, P.B.; Kim, A.S.; Jeong, J.; Mayle, A.; Dow, L.E.; Lowe, S.W. Preclinical murine platform to evaluate therapeutic countermeasures against radiation-induced gastrointestinal syndrome. Proc. Natl. Acad. Sci. USA 2019, 116, 20672–20678. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sato, T.; Vries, R.G.; Snippert, H.J.; van de Wetering, M.; Barker, N.; Stange, D.E.; van Es, J.H.; Abo, A.; Kujala, P.; Peters, P.J.; et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 2009, 459, 262–265. [Google Scholar] [CrossRef] [PubMed]
- Koelink, P.J.; Wildenberg, M.E.; Stitt, L.W.; Feagan, B.G.; Koldijk, M.; van ’t Wout, A.B.; Atreya, R.; Vieth, M.; Brandse, J.F.; Duijst, S.; et al. Development of Reliable, Valid and Responsive Scoring Systems for Endoscopy and Histology in Animal Models for Inflammatory Bowel Disease. J. Crohn’s Colitis 2018, 12, 794–803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, S.H.; Shim, S.; Kim, M.J.; Shin, H.Y.; Jang, W.S.; Lee, S.J.; Jin, Y.W.; Lee, S.S.; Lee, S.B.; Park, S. Long-term culture-induced phenotypic difference and efficient cryopreservation of small intestinal organoids by treatment timing of Rho kinase inhibitor. World J. Gastroenterol. 2017, 23, 964–975. [Google Scholar] [CrossRef]
- Grabinger, T.; Luks, L.; Kostadinova, F.; Zimberlin, C.; Medema, J.P.; Leist, M.; Brunner, T. Ex vivo culture of intestinal crypt organoids as a model system for assessing cell death induction in intestinal epithelial cells and enteropathy. Cell Death Dis. 2014, 5, e1228. [Google Scholar] [CrossRef] [Green Version]
Species | Primer | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|---|
Mouse | Mmp9 | GCCCTGGAACTCACACGACA | TTGGAAACTCACACGCCAGAAG |
Il1β | GCAACTGTTCCTGAACTCA | CTCGGAGCCTGTAGTGCAG | |
Muc2 | GCTGACGAGTGGTTGGTGAATG | GATGAGGTGGCAGACAGGAGAC | |
Tff-3 | TGGTCCAAGGGTAGCAAGCAT | CAGCCTTGTGTTGGCTGTGAG | |
Atoh-1 | GTGGGGTTGTAGTGGACGAG | GTTGCTCTCCGACATTGGG | |
Gfi-1 | AGAAGGCGCACAGCTATCAC | GGCTCCATTTTCGACTCGC | |
Spedf | GGAGAAGGCAGCATCAGGA | CCAGGGTCTGCTGTGATGT | |
Zo1 | AGGACACCAAAGCATGTGAG | GGCATTCCTGCTGGTTACA | |
Cldn 3 | AAGCCGAATGGACAAAGAA | CTGGCAAGTAGCTGCAGTG | |
Villin | CACCTTTGGAAGCTTCTTCG | CTCTCGTTGCCTTGAACCTC | |
Olfm4 | GCTGGAAGTGAAGGAGATGC | ACAGAAGGAGCGCTGATGTT | |
Lgr5 | TCAGTCAGCTGCTCCCGAAT | CGTTTCCCGCAAGACGTAAC | |
Sox-9 | CTCGCATACCTCCCTTCC | TTCCAGCAGTCACTAGGC | |
b-catenin | ACTGCTGGGACTCTG | TGATGGCGTAGAACAG | |
Myc | GGGACAGTGTTCTCTGCCTCTGC | AAGTTGCCACCGCCACCGTCATC | |
Ascl2 | GCCTACTCGTCGGAGGAA | CCAACTGGAAAAGTCAAGCA | |
Gapdh | AAGATGGTGATGGGCTTCCCG | TGGCAAAGTGGAGATTGTTGCC | |
Rat | b-catenin | TCCCAATCAGTTGGTCAGCC | GAGAAAATCGCCCTTGAGGC |
Myc | GTGCTGCATGAAGAGACACC | CAACCTCTGGCTTCCTACCC | |
Ascl2 | TCTCTGTCCTGCACCTCTACATCC | AGCTGCTGTCCTCCGACGAG | |
Axin2 | CAGGACCCACATCCTTCT | ACGCGGAGGTGCACGCGG | |
Gapdh | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, H.; Kim, S.; Kim, H.; Oh, S.H.; Kwak, S.Y.; Joo, H.-W.; Lee, S.B.; Jang, W.I.; Park, S.; Shim, S. Metformin Protects the Intestinal Barrier by Activating Goblet Cell Maturation and Epithelial Proliferation in Radiation-Induced Enteropathy. Int. J. Mol. Sci. 2022, 23, 5929. https://doi.org/10.3390/ijms23115929
Jang H, Kim S, Kim H, Oh SH, Kwak SY, Joo H-W, Lee SB, Jang WI, Park S, Shim S. Metformin Protects the Intestinal Barrier by Activating Goblet Cell Maturation and Epithelial Proliferation in Radiation-Induced Enteropathy. International Journal of Molecular Sciences. 2022; 23(11):5929. https://doi.org/10.3390/ijms23115929
Chicago/Turabian StyleJang, Hyosun, Soyeon Kim, Hyewon Kim, Su Hyun Oh, Seo Young Kwak, Hyun-Woo Joo, Seung Bum Lee, Won Il Jang, Sunhoo Park, and Sehwan Shim. 2022. "Metformin Protects the Intestinal Barrier by Activating Goblet Cell Maturation and Epithelial Proliferation in Radiation-Induced Enteropathy" International Journal of Molecular Sciences 23, no. 11: 5929. https://doi.org/10.3390/ijms23115929