Next Article in Journal
Strategies to Counteract Oxidative Stress and Inflammation in Chronic-Degenerative Diseases
Previous Article in Journal
A NAC Transcription Factor from ‘Sea Rice 86′ Enhances Salt Tolerance by Promoting Hydrogen Sulfide Production in Rice Seedlings
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 12
10.3390/ijms23126437
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization, Tissue Distribution Profile, and Nutritional Regulation of acsl Gene Family in Golden Pompano (Trachinotus ovatus)

by
Zhigang Yang
1,†,
Hangbo Zhu
1,2,†,
Xiaoping Huang
2,
Aimin Wang
3 and
Dizhi Xie
2,*
1
Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture, Shanghai Ocean University, Shanghai 201306, China
2
Guangdong Laboratory for Lingnan Modern Agriculture, College of Marine Sciences, South China Agricultural University, Guangzhou 510642, China
3
College of Marine and Bioengineering, Yancheng Institute of Technology, Yancheng 224000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2022, 23(12), 6437; https://doi.org/10.3390/ijms23126437
Submission received: 8 May 2022 / Revised: 4 June 2022 / Accepted: 7 June 2022 / Published: 9 June 2022
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

:
Long chain acyl-coA synthase (acsl) family genes activate the conversion of long chain fatty acids into acyl-coA to regulate fatty acid metabolism. However, the evolutionary characteristics, tissue expression and nutritional regulation of the acsl gene family are poorly understood in fish. The present study investigated the molecular characterization, tissue expression and nutritional regulation of the acsl gene family in golden pompano (Trachinotus ovatus). The results showed that the coding regions of acsl1, acsl3, acsl4, acsl5 and acsl6 cDNA were 2091 bp, 2142 bp, 2136 bp, 1977 bp and 2007 bp, encoding 697, 714, 712, 659 and 669 amino acids, respectively. Five acsl isoforms divided into two branches, namely, acsl1, acsl5 and acsl6, as well as acsl3 and acsl4. The tissue expression distribution of acsl genes showed that acsl1 and acsl3 are widely expressed in the detected tissues, while acsl4, acsl5 and acsl6 are mainly expressed in the brain. Compared to the fish fed with lard oil diets, the fish fed with soybean oil exhibited high muscular C18 PUFA contents and acsl1 and acsl3 mRNA levels, as well as low muscular SFA contents and acsl4 mRNA levels. High muscular n-3 LC-PUFA contents, and acsl3, acsl4 and acsl6 mRNA levels were observed in the fish fed with fish oil diets compared with those of fish fed with lard oil or soybean oil diets. High n-3 LC-PUFA levels and DHA contents, as well as the acsl3, acsl4 and acsl6 mRNA levels were exhibited in the muscle of fish fed diets with high dietary n-3 LC-PUFA levels. Additionally, the muscular acsl3, acsl4 and acsl6 mRNA expression levels, n-3 LC-PUFA and DHA levels were significantly up-regulated by the increase of dietary DHA proportions. Collectively, the positive relationship among dietary fatty acids, muscular fatty acids and acsl mRNA, indicated that T. ovatus Acsl1 and Acsl3 are beneficial for the C18 PUFA enrichment, and Acsl3, Acsl4 and Acsl6 are for n-3 LC-PUFA and DHA enrichment. The acquisition of fish Acsl potential function in the present study will play the foundation for ameliorating the fatty acids nutrition in farmed fish products.

1. Introduction

Long chain fatty acids (LCFAs) are important components of lipids, such as phospholipid and triglyceride, which are the main structural components of membrane and important energy sources for organism. Due to the inertness of LCFAs, they must first be activated to form fatty acyl-CoA by the long chain acyl-CoA synthetase (ACSL) before participating in cellular metabolism [1,2,3]. In mammals, five ACSL isoforms, including ACSL1, ACSL3, ACSL4, ACSL5 and ACSL6, were isolated and identified [4,5]. Additionally, the mammal ACSL isoforms have diverse tissue expression patterns, varying subcellular localization and distinct substrate preferences [2,6].
For example, ACSL1 locates in the mitochondrial membrane and endoplasmic reticulum, and activates preferentially saturated and monounsaturated FAs from C16 to C18 [2,4]. ACSL3 was found to be localized in the endoplasmic reticulum and lipid droplets, and effectively activates saturated fatty acids [7,8,9]. Several studies revealed that ACSL4 mainly locates in mitochondrial and peroxisome associated membrane, and preferentially activates arachidonic acid (ARA) and eicosapentaenoic acid (EPA) [10,11,12]. ACSL5 localized in mitochondria, which has a substrate preference to linoleic acid [13]. ACSL6 preferentially activates DHA, and participates in the lipogenesis [3,14].
To date, limited study on the physiological function of acsl family has been conducted in fish. For example, the study of grass carp (Ctenopharyngodon idellus) showed that Acsl1 is involved in activating fatty acids into the β-oxidation pathway and provides energy for fish [15]. In our previous study, the molecular and expression characterization of the acsl6 cDNA was identified in common carp (Cyprinus carpio) and golden pompano (Trachinotus ovatus), and explored that Acsl6 performs a critical role in the muscular DHA enrichment of C. carpio and T. ovatus [16,17]. To compare the physiological functions of the acsl gene family in teleost, the molecular and expression characterization of acsl family genes were further investigated in golden pompano. These results will provide useful information on the important physiological significance of the acsl gene family in teleost.

2. Results

2.1. Molecular Characterization and Phylogenetic Analyses of acsl Genes

The full-lengths of acsl1, acsl3, acsl4, acsl5 and acsl6 ORF sequences were 2091 bp, 2142 bp, 2136 bp, 1977 bp and 2007 bp, encoding 697, 714, 712, 659 and 669 amino acids, respectively (Figures S1–S5). The phylogenetic tree of Acsl showed that five Acsl clades comprising Acsl1, Acsl3, Acsl4, Acsl5 and Acsl6 are identified, and Acsl3 and Acsl4 form a distinct group from Acsl1, Acsl5 and Acsl6, as well as the fish Acsl sequences being clustered into one branch, while the Acsl sequences of mammal and bird were closely clustered (Figure 1).

2.2. Tissue Distribution Pattern of acsl Genes

Among the examined tissues, T. ovatus acsl1 and acsl3 genes showed a widespread expression with low acsl1 transcripts in the eyes, and low acsl3 transcripts in the intestine and liver (Figure 2). High expression of acsl4 was detected in the brain and intestine, and with non-detectable level in the eyes and cholecyst. In addition, T. ovatus acsl5 showed a high expression level in the brain and liver, and with non-detectable level in the cholecyst, muscle and gill. Obviously, the T. ovatus acsl6 gene was observed in the brain and eyes, followed by the muscle, spleen, kidney, liver and intestine, but not in the cholecyst (Figure 2).

2.3. Muscular Fatty Acid Composition and acsl mRNA Level in the Fish Fed Diets with Different Lipid Sources

The effects of dietary lipid sources on muscle fatty acid composition and acsl mRNA expression are shown in Figure 3A–C. The detailed effects of dietary lipid sources on the muscle fatty acid composition were reported in our previous study [17]. The content of saturated fatty acid (SFA) was significantly higher in the fish fed LO and FO diets than that of fish fed SO diets (p < 0.05). The fish fed LO diets showed significantly higher muscular monounsaturated fatty acid (MUFA) levels than the other two groups (p < 0.05), while higher C18 polyunsaturated fatty acids (C18 PUFA), and n-3 LC-PUFA and DHA contents were detected in the fish fed with SO and FO diets, respectively (p < 0.05). Regarding the changes of muscular acsl mRNA expression level (Figure 3C), the expression of acsl1 mRNA levels in the fish fed SO diets was higher than that in the fish fed LO and FO diets (p < 0.05), while a high acsl3, acsl4 and acsl6 mRNA level was measured in the fish fed FO diets than that of fish fed LO or SO diets (p < 0.05).

2.4. Muscular Fatty Acid Composition and acsl mRNA Level in the Fish Fed Diets with Different n-3 LC-PUFA Levels

The fatty acid composition and acsl genes expression profile of T. ovatus fed diets with different n-3 LC-PUFA levels are shown in Figure 4A–C. The detailed effects of dietary n-3 LC-PUFA levels on the muscle fatty acid composition was reported in our previous study [18]. Briefly, the muscular n-3 LC-PUFA and DHA contents were gradually increased with increasing levels of dietary n-3 LC-PUFA (p < 0.05), while the contents of SFA and MUFA decreased accordingly in the muscle (p < 0.05) (Figure 4B). Accordingly, the high mRNA expression levels of acsl3, acsl4 and acsl6 were measured in the muscle of fish fed with high n-3 LC-PUFA diets (p < 0.05) (Figure 4C).

2.5. Muscular Fatty Acid Composition and acsl mRNA Level in the Fish Fed Diets with Different DHA/EPA Ratios

The fatty acid composition and acsl genes expression profile of T. ovatus fed diets with different DHA/EPA ratios are shown in Figure 5A–C. The detailed effects of dietary DHA/EPA ratios on the muscle fatty acid composition were presented in our previous study [19]. In short, the muscle SFA, MUFA, C18 PUFA and n-3 LC-PUFA shared comparable levels among the different groups, while the DHA levels showed a gradual upward trend with the dietary DHA/EPA ratios rising (p < 0.05) (Figure 5B). Accordingly, the relative mRNA expression of acsl3, acsl4 and acsl6 in muscle was significantly up-regulated by the increase of dietary DHA proportions (p < 0.05) (Figure 5C).

3. Discussion

Mammal studies showed that the ACSL1-6 are essential enzymes for the utilization of cellular LCFAs, which is the first enzyme to activate LCFAs, and determines their metabolic fate, including fatty acid β-oxidation, lipogenesis and signal lipids [2,20]. For example, ACSL1 and ACSL5 tend to be involved in fatty acids β-oxidation [21,22]. ACSL3 and ACSL4 mediate the lipid synthesis and lipid droplets biogenesis [23,24]. ACSL6 preferentially activates DHA, and mediates the synthesis of lipids such as TAG and phospholipids [14]. In the present study, the molecular characterization, tissue distribution and fatty acids regulation of acsl genes were investigated from the marine teleost, T. ovatus, which provides evidences for their potential roles in the muscle fatty acid metabolism.
The phylogenetic evolutionary analysis of the Acsl family shows that five Acsl clades comprising Acsl1, Acsl3, Acsl4, Acsl5 and Acsl6 are identified, and Acsl3 and Acsl4 form a distinct group from Acsl1, Acsl5 and Acsl6, which is consistent with previous reports of vertebrates [2,25]. In addition, the different Acsl isoforms showed diverse tissue distribution patterns. For example, the T. ovatus acsl1 gene was widely expressed in intestine, brain, muscle and liver, which is consistent with reports in mammals [26] and grass carp [15]. The acsl3 has widespread expression in the intestine, brain, muscle, spleen and kidney of T. ovatus, zebrafish (Danio rerio) and mammals [2,27]. While T. ovatus and zebrafish acsl4, and mammal Acsl4 have a high expression in the brain and intestine, and with non-detectable level in the eyes and cholecyst [2,3]. T. ovatus and zebrafish acsl5 is mainly distributed in the brain, spleen, kidney and liver, which has similar results to zebrafish. In contrast, mammal Acsl5 is mainly expressed in the intestine, with less expression in the liver and kidney [28,29]. Additionally, mammalian Acsl6 is strictly expressed in the brain and testis [2,14], while a widely widespread distribution pattern of the acsl6 gene was found in the analyzed tissues of T. ovatus, zebrafish and grass carp [2,16].
Similar to the diversity of distribution in tissues, ACSL isoforms are also diverse in their preference for fatty acid substrates [4,5]. Studies in mammals have found that ACSL1 preferentially activates saturated and monounsaturated fatty acids, from C16 to C18 [2]. Over-expression of ACSL1 promoted the binding of oleic acid to diacylglycerol and phospholipids in rat liver cells and the internalization of oleic acid in PC12 neuronal cells [30]. Depletion/over-expression of ACSL3 caused a significant reduction/increase in the oleic acid absorption of mammal cells [27,31], ACSL3 exhibits a preference for C18-C20 PUFAs over saturated and monounsaturated fatty acids [32]. T. ovatus acsl1 and acsl3 mRNA expression was increased significantly in SO diets (enriched with C18 PUFA), suggesting that Acsl1 and Acsl3 are closely related to C18 PUFA metabolism. Furthermore, dietary n-3 LC-PUFA levels and DHA/EPA ratio had no significant effect on the acsl1 mRNA expression, and a lower expression of acsl1 transcripts was found in fish fed FO diets than that of fish fed LO and SO diets. The results suggested that T. ovatus Acsl1 hardly plays any role in activated n-3 LC-PUFA. Similarly, the acsl1 mRNA expression was significantly down-regulated in grass carp fed FO diets [15]. The study of Atlantic salmon (Salmo salar) showed a down-regulation of acsl (the specific gene isoforms is not given) expression in the fish fed diets with high EPA + DHA levels [33]. Consistent with the induced acsl1 and acsl3 mRNA abundance, the muscle C18 PUFA levels in the T. ovatus fed SO diets were significantly increased compared with the LO and FO diets. The results speculated that T. ovatus Acsl1 and Acsl3 may be involved in the metabolism of muscular C18 PUFA.
Interestingly, an up-regulation of acsl3 mRNA expression and n-3 LC-PUFA level was observed in the muscle of T. ovatus fed with FO diets (enriched with n-3 LC-PUFA), high dietary n-3 LC-PUFA levels or high DHA ratio, suggestive of increased activity of n-3 LC-PUFA metabolism. Similarly, the hepatic acsl3 mRNA expression was increased in grass carp fed high n-6 LC-PUFA diets [34]. In mammals, ACSL3 was found to preferentially activate EPA and mediates lipid droplet formation [32], which provides acyl-CoA for glyceride synthesis on the surface of lipid droplets [35]. Therefore, the results suggested that T. ovatus Acsl3 may also be involved in the metabolism and deposition of intracellular n-3 LC-PUFA.
In addition to acsl3, both T. ovatus acsl4 and acsl6 mRNA were also increased in the FO, high n-3 LC-PUFA level and high DHA ratio groups, which is consistent with the up-regulation of very long chain acyl-CoA synthetase (acsvl) transcript levels in the Atlantic salmon and grass carp fed dietary docosahexaenoic acid and fish oil diets, respectively [36,37]. Numerous mammal studies have shown that both ACSL4 and ACSL6 have a preference for the activation of n-3 LC-PUFA [14]. ACSL4 is closely associated with the incorporation of EPA and DHA into membrane phospholipids [38], and could improve the intramuscular EPA and DHA content [39]. The enhanced expression of mammal Acsl6 also promoted the deposition of DHA in the skeletal muscle [40], brain [14], spermatids and seminiferous tubules [41,42]. It is noteworthy that the expression of T. ovatus acsl3, acsl4 and acsl6 mRNA was significantly positively correlated with dietary DHA ratio, but not with dietary EPA proportions. However, in mammals, ACSL3 [32] and ACSL4 [39,42] are also involved in activating the cellular EPA. We speculate that the difference may be due to the abundance of DHA in fish. The obvious differences observed in their mRNA expression that responded to dietary DHA and EPA proportions might suggest that T. ovatus Acsl3, Acsl4 and Acsl6 perform greater contribution to the enrichment of DHA than EPA.
In conclusion, five isoforms of the acsl genes family were identified in T. ovatus, which is divided into two branches, namely, acsl1, acsl5 and acsl6, and acsl3 and acsl4. T. ovatus acsl gene isoforms that showed diverse tissue distribution, such as acsl1 and acsl3, are widely expressed in the detected tissues, while acsl4, acsl5 and acsl6 are mainly expressed in the brain. The positive relationship among dietary fatty acids, muscular fatty acids and acsl mRNA suggested that T. ovatus Acsl1 and Acsl3 are beneficial for the C18 PUFA enrichment, and Acsl3, Acsl4 and Acsl6 for n-3 LC-PUFA enrichment (especially for DHA enrichment). The results provided useful information for exploring the physiological significance of fish acsl genes.

4. Materials and Methods

4.1. Ethical Statement

All experimental operations were performed according to the procedures of the Ethics Committee of Animal Experiments of the South China Agricultural University (SCAU) and approved by the Ethics Committee of Animal Experiments of SCAU (SCAU-AEC-2010-0416).

4.2. Animal Experiments

To compare the substrate preference and potential function of Acsl isoforms in T. ovatus, the nutritional regulation of fatty acids on the expression of acsl1, acsl3, acsl4, acsl5 and acsl6 was investigated, and three culture experiments were performed. In culture experiment Ⅰ, using fish meal, fermented soybean meal and soybean meal as protein sources, and lard oil (LO, rich in SFA), soybean oil (SO, rich in C18 PUFA) or fish oil (FO, rich in LC-PUFA) as lipid sources, three isoproteic (about 45.00% crude protein) and isolipidic (about 12.00% crude lipid) diets were formulated [17]. In culture experiment Ⅱ, taking fish meal, fermented soybean meal and soybean protein concentrate as protein sources, and soybean oil, rapeseed oil, perilla oil and DHA- and EPA-enriched oil as lipid sources, three isoproteic (about 44.50% crude protein) and isolipidic (about 12.30% crude fat) diets with different n-3 LC-PUFA levels (5.25%, 10.05% and 14.05%, namely, L, M and H) were prepared [18]. In culture experiment Ⅲ, using fish meal, fermented soybean meal and soybean meal as protein sources, and palm oil, soybean oil and DHA- and EPA-enriched oil as lipid sources, four isoproteic (about 46.81% crude protein) and isolipidic (about 12.50% crude lipid) diets with different DHA/EPA ratios (0.53, 0.81, 1.17 and 2.12, namely, D1, D2, D3 and D4) were formulated [19]. The detailed dietary formulations and proximate and fatty acid compositions were shown in our previous studies [17,18,19].
Each experimental diet was fed to T. ovatus juveniles in triplicate cages for 8 weeks. After the end of the feeding experiments, muscle from three fish per cage (nine fish per dietary group) was sampled to analyze the fatty acid composition and acsl genes expression.

4.3. Trachinotus Ovatus acsl Genes Cloning

Total RNA was extracted from various tissues of golden pompano (Trachinotus ovatus) by using TRizol reagent (Invitrogen, Carlsbad, CA, USA). The purified total golden pompano RNA was reverse-transcribed into cDNA by using the AMV reverse-transcriptase first-strand cDNA synthesis kit. In order to amplify the open reading frame (ORF) of the acsl cDNAs, gene-specific primers complementary to the acsl1, acsl3, acsl4, acsl5 and acsl6 genes were designed according to the whole genome sequencing data of golden pompano (Table 1). PCR was performed using an RT-PCR kit from TAKARA (Takara, Maebashi, Japan). The amplification procedure consisted of 35 cycles of denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s and extension of 2 min at 72 °C. PCR positive fragments were confirmed by DNA sequencing (Shanghai Sangon, Shanghai, China).

4.4. Phylogenetic Analysis

The neighbor-joining (NJ) method was used to analyze the sequence phylogeny of Acsls based on the amino acid sequences from seven fish species (Salmo salar, Oncorhynchus nerka, Astyanax mexicanus, Cyprinus carpio, Takifugu rubripes, Oryzias latipes, Latimeria chalumnae), two bird species (Parus major, Catharus ustulatus) and three mammal species (Monodelphis domestica, Mua musculus, Homo sapiens). The confidence of the phylogenetic tree-branch topology of Acsls was performed through 1000 bootstrap iterations.

4.5. Tissue Distribution Pattern of Trachinotus ovatus acsl Genes

Tissue samples, including liver, eye, intestine, cholecyst, brain, gills, muscle, spleen and kidney, were collected from three juvenile fishes (sex could not be distinguished by means of naked eye) to investigate the tissue distribution pattern of acsl genes. All tissues were immediately frozen in liquid nitrogen and kept at −80 °C until used.
Total RNA was extracted from these above tissue samples, and 1 μg RNA of each sample was reverse transcribed into cDNA using the first-strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). PCR protocol: 94 °C for 4 min, 94 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, 30 cycles and finally 72 °C for 5 min.

4.6. Quantitative Real-Time PCR Analysis

Using the genes-specific primers described in Table 1, the effects of dietary DHA level on the expression of the acsl genes family were analyzed by real-time PCR using the Light Cycler 480 system (Roche, Basel, Switzerland). The qPCR operations were performed according to the protocol previously described [17]. β-actin was selected as the reference gene. Each sample had at least three replicates. The relative expression levels were determined by 2−ΔΔCT method.

4.7. Fatty Acid Compositions Evaluation

The detection of dietary and muscle fatty acid compositions were performed according to the method described previously [17]. Briefly, total dietary and muscle lipids were extracted using a mixture of chloroform/methanol (v/v, 2:1) containing 0.01% butylated hydroxytoluene [43]. The fatty acid methyl esters (FAME) of total lipid were performed using boron trifluoride diethyl etherate (ca. 48%, Acros Organics, Waltham, MA, USA). The FAME were analyzed using gas chromatography (GC-2010 plus; Shimadzu, Kyoto, Japan), and individual FAME were identified through comparison with commercial standards (Sigma, St. Louis, MO, USA), and quantified by CLASS-GC2010-plus workstation (Shimadzu).

4.8. Statistical Analysis

Except for the dietary proximate and fatty acid compositions, all data were presented as mean ± SE (standard error, n = 3), and analyzed by one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison. A significant difference level was considered at p < 0.05. All analyses were performed using SPSS version 19.0 (SPSS Inc., Chicago, IL, USA).

Supplementary Materials

Supplementary materials can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23126437/s1.

Author Contributions

Z.Y., analyzed the data, wrote the paper; H.Z., performed the experiments, analyzed the data, wrote the paper; X.H., contributed materials and samples; A.W., conceived and designed the experiments; D.X., conceived and designed the experiments, revised the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Natural Science Foundation of China (31602176), Guangdong Basic and Applied Basic Research Foundation (2021A1515011123), China Agriculture Research System of MOF and MARA (CARS-47).

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Animal Experiments of SCAU, China (SCAU-AEC-2010-0416).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data supporting reported results can be asked to the authors.

Conflicts of Interest

All authors have no conflict of interest.

Abbreviations

ACSLLong chain acyl-coA synthase
ARAArachidonic acid
DHADocosahexaenoic acid
EPAEicosapentaenoic acid
LCFAsLong chain Fatty acids
LC-PUFALong chain-polyunsaturated fatty acid
MUFAMonounsaturated fatty acid
SFASaturated fatty acid

References

  1. Ellis, J.M.; Frahm, J.L.; Li, L.O.; Coleman, R.A. Acyl-coenzyme A synthetases in metabolic control. Curr. Opin. Lipidol. 2010, 21, 212–217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Lopes-Marques, M.; Cunha, I.; Reis-Henriques, M.A.; Santos, M.M.; Castro, L.F.C. Diversity and history of the long-chain acyl-CoA synthetase (Acsl) gene family in vertebrates. BMC Evol. Biol. 2013, 13, 271. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Quan, J.; Bode, A.M.; Luo, X. ACSL family: The regulatory mechanisms and therapeutic implications in cancer. Eur. J. Pharmacol. 2021, 909, 174397. [Google Scholar] [CrossRef] [PubMed]
  4. Tang, Y.; Zhou, J.; Hooi, S.C.; Jiang, Y.M.; Lu, G.D. Fatty acid activation in carcinogenesis and cancer development: Essential roles of long-chain acyl-CoA synthetases. Oncol. Lett. 2018, 16, 1390–1396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Ma, Y.; Zha, J.; Yang, X.; Li, Q.; Zhang, Q.; Yin, A.; Beharry, Z.; Huang, H.; Huang, J.; Bartlett, M.; et al. Long-chain fatty acyl-CoA synthetase 1 promotes prostate cancer progression by elevation of lipogenesis and fatty acid beta-oxidation. Oncogene 2021, 40, 1806–1820. [Google Scholar] [CrossRef] [PubMed]
  6. Van Horn, C.G.; Caviglia, J.M.; Li, L.O.; Wang, S.; Granger, D.A.; Coleman, R.A. Characterization of recombinant long-chain rat acyl-CoA synthetase isoforms 3 and 6: Identification of a novel variant of isoform 6. Biochemistry 2005, 44, 1635–1642. [Google Scholar] [CrossRef] [PubMed]
  7. Kassan, A.; Herms, A.; Fernandez-Vidal, A.; Bosch, M.; Schieber, N.L.; Reddy, B.J.; Fajardo, A.; Gelabert-Baldrich, M.; Tebar, F.; Enrich, C.; et al. Acyl-CoA synthetase 3 promotes lipid droplet biogenesis in ER microdomains. J. Cell Biol. 2013, 203, 985–1001. [Google Scholar] [CrossRef] [Green Version]
  8. Klett, E.L.; Chen, S.; Yechoor, A.; Lih, F.B.; Coleman, R.A. Long-chain acyl-CoA synthetase isoforms differ in preferences for eicosanoid species and long-chain fatty acids. J. Lipid Res. 2017, 58, 884–894. [Google Scholar] [CrossRef] [Green Version]
  9. Kimura, H.; Arasaki, K.; Ohsaki, Y.; Fujimoto, T.; Ohtomo, T.; Yamada, J.; Tagaya, M. Syntaxin 17 promotes lipid droplet formation by regulating the distribution of acyl-CoA synthetase 3. J. Lipid Res. 2018, 59, 805–819. [Google Scholar] [CrossRef]
  10. Lewin, T.M.; Van Horn, C.G.; Krisans, S.K.; Coleman, R.A. Rat liver acyl-CoA synthetase 4 is a peripheral-membrane protein located in two distinct subcellular organelles, peroxisomes, and mitochondrial-associated membrane. Arch. Biochem. Biophys. 2002, 404, 263–270. [Google Scholar] [CrossRef]
  11. Grevengoed, T.J.; Klett, E.L.; Coleman, R.A. Acyl-CoA metabolism and partitioning. Annu. Rev. Nutr. 2014, 34, 1–30. [Google Scholar] [CrossRef] [Green Version]
  12. Kurotaki, A.; Kuwata, H.; Hara, S. Substrate Specificity of Human Long-Chain Acyl-CoA Synthetase ACSL6 Variants. Biol. Pharm. Bull. 2021, 44, 1571–1575. [Google Scholar] [CrossRef]
  13. Yan, S.; Yang, X.; Liu, H.; Fu, N.; Ouyang, Y.; Qing, K. Long-chain acyl-CoA synthetase in fatty acid metabolism involved in liver and other diseases: An update. World J. Gastroenterol. 2015, 21, 3492–3498. [Google Scholar] [CrossRef]
  14. Fernandez, R.F.; Kim, S.Q.; Zhao, Y.; Foguth, R.M.; Weera, M.M.; Counihan, J.L.; Nomura, D.K.; Chester, J.A.; Cannon, J.R.; Ellis, J.M. Acyl-CoA synthetase 6 enriches the neuroprotective omega-3 fatty acid DHA in the brain. Proc. Natl. Acad. Sci. USA 2018, 115, 12525–12530. [Google Scholar] [CrossRef] [Green Version]
  15. Cheng, H.; Chen, S.; Xu, J.; Yi, L.; Peng, Y.; Pan, Q.; Shen, X.; Dong, Z.; Zhang, X.; Wang, W. Molecular cloning and nutrient regulation analysis of long chain acyl-CoA synthetase 1 gene in grass carp, Ctenopharyngodon idella L. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2017, 204, 61–68. [Google Scholar] [CrossRef]
  16. Xie, D.; He, Z.; Dong, Y.; Gong, Z.; Nie, G.; Li, Y. Molecular Cloning, Characterization, and expression regulation of acyl-CoA synthetase 6 gene and promoter in common carp Cyprinus carpio. Int. J. Mol. Sci. 2020, 21, 4736. [Google Scholar] [CrossRef]
  17. Chen, F.; Huang, X.; Zhu, H.; Li, Y.; Xu, C.; Xie, D. Molecular characterization and expression analysis of acyl-CoA synthetase 6 in golden pompano Trachinotus ovatus reveal its function in DHA enrichment. Aquaculture 2022, 551, 737966. [Google Scholar] [CrossRef]
  18. Li, M.; Zhang, M.; Ma, Y.; Ye, R.; Wang, M.; Chen, H.; Xie, D.; Dong, Y.; Ning, L.; You, C. Dietary supplementation with n-3 high unsaturated fatty acids decreases serum lipid levels and improves flesh quality in the marine teleost golden pompano Trachinotus ovatus. Aquaculture 2020, 516, 734632. [Google Scholar] [CrossRef]
  19. Zhang, M.; Chen, C.; You, C.; Chen, B.; Wang, S.; Li, Y. Effects of different dietary ratios of docosahexaenoic to eicosapentaenoic acid (DHA/EPA) on the growth, non-specific immune indices, tissue fatty acid compositions and expression of genes related to LC-PUFA biosynthesis in juvenile golden pompano Trachinotus ovatus. Aquaculture 2019, 505, 488–495. [Google Scholar]
  20. Soupene, E.; Kuypers, F.A. Mammalian Long-Chain Acyl-CoA Synthetases. Exp. Biol. Med. 2008, 233, 507–521. [Google Scholar] [CrossRef] [Green Version]
  21. Li, L.O.; Ellis, J.M.; Paich, H.A.; Wang, S.; Gong, N.; Altshuller, G.; Thresher, R.J.; Koves, T.R.; Watkins, S.M.; Muoio, D.M.; et al. Liver-specific loss of long chain acyl-CoA synthetase-1 decreases triacylglycerol synthesis and beta-oxidation and alters phospholipid fatty acid composition. J. Biol. Chem. 2009, 284, 27816–27826. [Google Scholar] [CrossRef] [Green Version]
  22. Chen, Y.; He, L.; Yang, Y.; Chen, Y.; Song, Y.; Lu, X.; Liang, Y. The inhibition of Nrf2 accelerates renal lipid deposition through suppressing the ACSL1 expression in obesity-related nephropathy. Renal Failure 2019, 41, 821–831. [Google Scholar] [CrossRef] [Green Version]
  23. Killion, E.A.; Reeves, A.R.; El Azzouny, M.A.; Yan, Q.W.; Surujon, D.; Griffin, J.D.; Bowman, T.A.; Wang, C.; Matthan, N.R.; Klett, E.L.; et al. A role for long-chain acyl-CoA synthetase-4 (ACSL4) in diet-induced phospholipid remodeling and obesity-associated adipocyte dysfunction. Mol. Metab. 2018, 9, 43–56. [Google Scholar] [CrossRef]
  24. Jung, H.S.; Shimizu-Albergine, M.; Shen, X.; Kramer, F.; Shao, D.; Vivekanandan-Giri, A.; Pennathur, S.; Tian, R.; Kanter, J.E.; Bornfeldt, K.E. TNF-α induces acyl-CoA synthetase 3 to promote lipid droplet formation in human endothelial cells. J. Lipid Res. 2020, 61, 33–44. [Google Scholar] [CrossRef]
  25. Tian, W.; Wang, D.; Wang, Z.; Jiang, K.; Li, Z.; Tian, Y.; Kang, X.; Liu, X.; Li, H. Evolution, expression profile, and regulatory characteristics of ACSL gene family in chicken (Gallus gallus). Gene 2021, 764, 145094. [Google Scholar] [CrossRef]
  26. Singh, A.B.; Kan, C.F.K.; Kraemer, F.B.; Sobel, R.A.; Liu, J. Liver-specific knockdown of long-chain acyl-CoA synthetase 4 reveals its key role in VLDL-TG metabolism and phospholipid synthesis in mice fed a high-fat diet. Am. J. Physiol.-Endoc. Metab. 2019, 316, E880–E894. [Google Scholar] [CrossRef]
  27. Poppelreuther, M.; Rudolph, B.; Du, C.; Grossmann, R.; Becker, M.; Thiele, C.; Ehehalt, R.; Fullekrug, J. The N-terminal region of acyl-CoA synthetase 3 is essential for both the localization on lipid droplets and the function in fatty acid uptake. J. Lipid Res. 2012, 53, 888–900. [Google Scholar] [CrossRef] [Green Version]
  28. Oikawa, E.; Iijima, H.; Suzuki, T.; Sasano, H.; Sato, H.; Kamataki, A.; Nagura, H.; Kang, M.J.; Fujino, T.; Suzuki, H. A novel acyl-CoA synthetase, ACS5, expressed in intestinal epithelial cells and proliferating preadipocytes. J. Biochem. 1998, 124, 679–685. [Google Scholar] [CrossRef] [Green Version]
  29. Meller, N.; Morgan, M.E.; Wong, W.P.; Altemus, J.B.; Sehayek, E. Targeting of Acyl-CoA synthetase 5 decreases jejunal fatty acid activation with no effect on dietary long-chain fatty acid absorption. Lipids Health Dis. 2013, 12, 88. [Google Scholar] [CrossRef] [Green Version]
  30. Li, L.O.; Mashek, D.G.; An, J.; Doughman, S.D.; Newgard, C.B.; Coleman, R.A. Overexpression of rat long chain acyl-coa synthetase 1 alters fatty acid metabolism in rat primary hepatocytes. J. Biol. Chem. 2006, 281, 37246–37255. [Google Scholar] [CrossRef] [Green Version]
  31. Ubellacker, J.M.; Tasdogan, A.; Ramesh, V.; Shen, B.; Mitchell, E.C.; Martin-Sandoval, M.S.; Gu, Z.; Mccormick, M.L.; Durham, A.B.; Spitz, D.R.; et al. Lymph protects metastasizing melanoma cells from ferroptosis. Nature 2020, 585, 113–118. [Google Scholar] [CrossRef] [PubMed]
  32. Fujino, T.; Kang, M.J.; Suzuki, H.; Iijima, H.; Yamamoto, T. Molecular characterization and expression of rat acyl-CoA synthetase 3. J. Biol. Chem. 1996, 271, 16748–16752. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Betancor, M.B.; Li, K.; Bucerzan, V.S.; Sprague, M.; Sayanova, O.; Usher, S.; Han, L.; Norambuena, F.; Torrissen, O.; Napier, J.A. Oil from transgenic Camelina sativa containing over 25% n-3 long-chain PUFA as the major lipid source in feed for Atlantic salmon (Salmo salar). Br. J. Nutr. 2018, 119, 1378–1392. [Google Scholar] [CrossRef] [Green Version]
  34. Tian, J.; Lei, C.; Ji, H.; Jin, A. Role of cyclooxygenase-mediated metabolites in lipid metabolism and expression of some immune-related genes in juvenile grass carp (Ctenopharyngodon idellus) fed arachidonic acid. Fish Physiol. Biochem. 2017, 43, 703–717. [Google Scholar] [CrossRef]
  35. Fujimoto, Y.; Itabe, H.; Kinoshita, T.; Homma, K.J.; Onoduka, J.; Mori, M.; Yamaguchi, S.; Makita, M.; Higashi, Y.; Yamashita, A.; et al. Involvement of ACSL in local synthesis of neutral lipids in cytoplasmic lipid droplets in human hepatocyte HuH7. J. Lipid Res. 2007, 48, 1280–1292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Glencross, B.D.; De Santis, C.; Bicskei, B.; Taggart, J.B.; Bron, J.E.; Betancor, M.B.; Tocher, D.R. A comparative analysis of the response of the hepatic transcriptome to dietary docosahexaenoic acid in Atlantic salmon (Salmo salar) post-smolts. BMC Genom. 2015, 16, 684. [Google Scholar] [CrossRef] [Green Version]
  37. Tian, J.; Lu, R.; Ji, H.; Sun, J.; Li, C.; Liu, P.; Lei, C.; Chen, L.; Du, Z. Comparative analysis of the hepatopancreas transcriptome of grass carp (Ctenopharyngodon idellus) fed with lard oil and fish oil diets. Gene 2015, 565, 192–200. [Google Scholar] [CrossRef]
  38. Shimbara-Matsubayashi, S.; Kuwata, H.; Tanaka, N.; Kato, M.; Hara, S. Analysis on the substrate specificity of recombinant human acyl-CoA synthetase ACSL4 variants. Biol. Pharm. Bull. 2019, 42, 850–855. [Google Scholar] [CrossRef] [Green Version]
  39. Ren, H.; Zhang, H.; Hua, Z.; Zhu, Z.; Tao, J.; Xiao, H.; Zhang, L.; Bi, Y.; Wang, H. ACSL4 Directs Intramuscular Adipogenesis and Fatty Acid Composition in Pigs. Animals 2022, 12, 119. [Google Scholar] [CrossRef]
  40. Teodoro, B.G.; Sampaio, I.H.; Bomfim, L.H.; Queiroz, A.L.; Silveira, L.R.; Souza, A.O.; Fernandes, A.M.; Eberlin, M.N.; Huang, T.Y.; Zheng, D. Long-chain acyl-CoA synthetase 6 regulates lipid synthesis and mitochondrial oxidative capacity in human and rat skeletal muscle. J. Physiol. 2017, 595, 677–693. [Google Scholar] [CrossRef] [Green Version]
  41. Hale, B.J.; Fernandez, R.F.; Kim, S.Q.; Diaz, V.D.; Jackson, S.N.; Liu, L.; Brenna, J.T.; Hermann, B.P.; Geyer, C.B.; Ellis, J.M. Acyl-CoA synthetase 6 enriches seminiferous tubules with the ω-3 fatty acid docosahexaenoic acid and is required for male fertility in the mouse. J. Biol. Chem. 2019, 294, 14394–14405. [Google Scholar] [CrossRef]
  42. Shishikura, K.; Kuroha, S.; Matsueda, S.; Iseki, H.; Matsui, T.; Inoue, A.; Arita, M. Acyl-CoA synthetase 6 regulates long-chain polyunsaturated fatty acid composition of membrane phospholipids in spermatids and supports normal spermatogenic processes in mice. FASEB J. 2019, 33, 14194–14203. [Google Scholar] [CrossRef] [Green Version]
  43. Li, Y.; Monroig, O.; Zhang, L.; Wang, S.; Zheng, X.; Dick, J.R.; You, C.; Tocher, D.R. Vertebrate fatty acyl desaturase with Δ4 activity. Proc. Natl. Acad. Sci. USA 2010, 107, 16840–16845. [Google Scholar] [CrossRef] [Green Version]
Ijms 23 06437 g001 550
Figure 1. Phylogenetic analysis of the Trachinotus ovatus acsl family from different animal species. The phylogenetic tree was generated based on an alignment corresponding to the amino acid sequences using ClustalW and MEGA (11.0). The number at nodes represent percentage bootstrap values (only values above 40% are shown) on 1000 replicates.
Figure 1. Phylogenetic analysis of the Trachinotus ovatus acsl family from different animal species. The phylogenetic tree was generated based on an alignment corresponding to the amino acid sequences using ClustalW and MEGA (11.0). The number at nodes represent percentage bootstrap values (only values above 40% are shown) on 1000 replicates.
Ijms 23 06437 g001
Ijms 23 06437 g002 550
Figure 2. Tissue specificity of Trachinotus ovatus acsl family mRNA expression. Expression of the housekeeping gene β-actin is also shown. Abbreviations: MW, molecular weight marker; In, intestine; Ey, eyes; Ch, cholecyst; Br, brain; Mu, muscle; Gi, gill; Sp, spleen; Ki, kidney; Lv, liver; NCT, negative template control.
Figure 2. Tissue specificity of Trachinotus ovatus acsl family mRNA expression. Expression of the housekeeping gene β-actin is also shown. Abbreviations: MW, molecular weight marker; In, intestine; Ey, eyes; Ch, cholecyst; Br, brain; Mu, muscle; Gi, gill; Sp, spleen; Ki, kidney; Lv, liver; NCT, negative template control.
Ijms 23 06437 g002
Ijms 23 06437 g003 550
Figure 3. Muscular fatty acid contents (B), and acsl family mRNA relative level (C) of juvenile Trachinotus ovatus fed diets with different lipid sources (A). Values are means ± SEM from three treatments of fish (n = 3) with three fish per cage, and bars not sharing a common letter indicated significant differences (p < 0.05) among deletions determined by one-way ANOVA followed by Tukey’s multiple comparison.
Figure 3. Muscular fatty acid contents (B), and acsl family mRNA relative level (C) of juvenile Trachinotus ovatus fed diets with different lipid sources (A). Values are means ± SEM from three treatments of fish (n = 3) with three fish per cage, and bars not sharing a common letter indicated significant differences (p < 0.05) among deletions determined by one-way ANOVA followed by Tukey’s multiple comparison.
Ijms 23 06437 g003
Ijms 23 06437 g004 550
Figure 4. Muscular fatty acid contents (B), and acsl family mRNA relative level (C) of juvenile Trachinotus ovatus fed diets with different n-3 LC-PUFA levels (A). Values are means ± SEM from three treatments of fish (n = 3) with three fish per cage, and bars not sharing a common letter indicated significant differences (p < 0.05) among deletions determined by one-way ANOVA followed by Tukey’s multiple comparison.
Figure 4. Muscular fatty acid contents (B), and acsl family mRNA relative level (C) of juvenile Trachinotus ovatus fed diets with different n-3 LC-PUFA levels (A). Values are means ± SEM from three treatments of fish (n = 3) with three fish per cage, and bars not sharing a common letter indicated significant differences (p < 0.05) among deletions determined by one-way ANOVA followed by Tukey’s multiple comparison.
Ijms 23 06437 g004
Ijms 23 06437 g005 550
Figure 5. Muscular fatty acid contents (B), and acsl family mRNA relative level (C) of juvenile Trachinotus ovatus fed diets with different DHA levels (A). Values are means ± SEM from three treatments of fish (n = 3) with three fish per cage, and bars not sharing a common letter indicated significant differences (p < 0.05) among deletions determined by one-way ANOVA followed by Tukey’s multiple comparison.
Figure 5. Muscular fatty acid contents (B), and acsl family mRNA relative level (C) of juvenile Trachinotus ovatus fed diets with different DHA levels (A). Values are means ± SEM from three treatments of fish (n = 3) with three fish per cage, and bars not sharing a common letter indicated significant differences (p < 0.05) among deletions determined by one-way ANOVA followed by Tukey’s multiple comparison.
Ijms 23 06437 g005
Table
Table 1. PCR primers sequence used in this study.
Table 1. PCR primers sequence used in this study.
SubjectPrimer NamePrimer Sequence (5′-3′)References/
Accession Number
RT-PCRRT-acsl1-FATGCAGGCTCAGGAAGTCCTGAGACPRJNA574781
RT-acsl1-RTTAGATCTTAATTTTAGAATAAAGT
RT-acsl3-FATGAAGCTGAAGGAGGACCTGAAPRJNA574781
RT-acsl3-RTTATTTTCCACCGTACATTCTCTC
RT-acsl4-FATGGGTCTCCAGGCAGACTCAACPRJNA574781
RT-acsl4-RTTATTTGCCCCCATACATCCTCT
RT-acsl5-FATGGAATTCCTTTTCCAGTTGCTCPRJNA574781
RT-acsl5-RTTATTGGATGTTAGCATATAGTT
RT-acsl6-FATGCTCGCATTCGTTTTGGTCTCMN481524
RT-acsl6-RTCACATGGAGATGCTGCTGTAGA
qPCRacsl1-FCTGAAGATCGTGGACAGGAAGAAGCPRJNA574781
acsl1-RCAACCACACAGGAAGTCAGGGTCAG
acsl3-FTGCCTATGCCAACAGTGACCAGTCPRJNA574781
acsl3-RATCGCTCCAGTTTCGCTGAGATAGC
acsl4-FAGGCAAGGACACGCTGGATAAGPRJNA574781
acsl4-RTCCAGTTCATTGTAGGACAGCCA
acsl6-FGCCTCGTTGAGCGCGGCAAGGGCTMN481524
acsl6-RAAGCCTGAGAAATCAGCTACCACG
β-actin-FTACGAGCTGCCTGACGGACAChen et al., 2022
β-actin-RGGCTGTGATCTCCTTCTGC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yang, Z.; Zhu, H.; Huang, X.; Wang, A.; Xie, D. Molecular Characterization, Tissue Distribution Profile, and Nutritional Regulation of acsl Gene Family in Golden Pompano (Trachinotus ovatus). Int. J. Mol. Sci. 2022, 23, 6437. https://doi.org/10.3390/ijms23126437

AMA Style

Yang Z, Zhu H, Huang X, Wang A, Xie D. Molecular Characterization, Tissue Distribution Profile, and Nutritional Regulation of acsl Gene Family in Golden Pompano (Trachinotus ovatus). International Journal of Molecular Sciences. 2022; 23(12):6437. https://doi.org/10.3390/ijms23126437

Chicago/Turabian Style

Yang, Zhigang, Hangbo Zhu, Xiaoping Huang, Aimin Wang, and Dizhi Xie. 2022. "Molecular Characterization, Tissue Distribution Profile, and Nutritional Regulation of acsl Gene Family in Golden Pompano (Trachinotus ovatus)" International Journal of Molecular Sciences 23, no. 12: 6437. https://doi.org/10.3390/ijms23126437

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop