Towards Understanding PRPS1 as a Molecular Player in Immune Response in Yellow Drum (Nibea albiflora)
Abstract
:1. Introduction
2. Results and Discussion
2.1. Molecular Characteristics of NaPRPS1
2.2. NaPRPS1 Expression Tissue Specificity and Subcellular Localization
2.3. Defence Response of NaPRPS1 against V. harveyi Infection
2.4. NaPRPS1-Interacting Protein Isolation and Identification
2.5. Validation of NaPRPS1-MyD88 Interaction
2.6. Participation of MyD88 in Defence Response
3. Materials and Methods
3.1. Experimental Fish and Immune Challenge
3.2. RNA Extraction and cDNA Synthesis
3.3. Cloning of NaPRPS1 and MyD88
3.4. NaPRPS1 Protein Sequence Analysis
3.5. Real-Time PCR Analysis
3.6. NaPRPS1 Subcellular Localization
3.7. Expression and Purification of Recombinant Protein
3.8. Preparation of Antibody and Purification
3.9. Immunohistochemistry
3.10. GST Pull-Down Assay and Mass Spectral Analysis
3.11. Reverse GST Pull-Down and Co-Immunoprecipitation Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xiang, J.; Chen, R.; Xu, D.; Sun, Y.; Liu, H. Characterization of pathological changes and immune-related gene expression in yellow drum (Nibea albiflora) in response to Pseudomonas plecoglossicida and poly I:C challenge. Aquac. Rep. 2020, 17, 100350. [Google Scholar] [CrossRef]
- Liu, G.; Han, Z.; Jiang, D.; Li, W.; Wang, Z. Genome-wide association study identifies loci for traits related to swim bladder in yellow drum (Nibea albiflora). Aquaculture 2020, 526, 735327. [Google Scholar] [CrossRef]
- Liu, H.; Yang, M.; Tang, X.; Liu, J.; Zheng, L.; Xu, D.; Chi, C.; Lv, Z. Molecular insights of a novel fish Toll-like receptor 9 homologue in Nibea albiflora to reveal its function as PRRs. Fish Shellfish Immunol. 2021, 118, 321–332. [Google Scholar] [CrossRef] [PubMed]
- Fei, Y.; Wenchao, L.; Peibo, B.; Baojun, T. Food intake, survival, and immunity of Nibea albiflora to Cryptocaryon irritans infection. Parasitol. Res. 2018, 117, 2379–2384. [Google Scholar] [CrossRef]
- Luo, S.; Li, W.; Xie, Y.; Wu, B.; Sun, Y.; Tian, Q.; Wang, Z.; Han, F. A molecular insight into the resistance of yellow drum to Vibrio harveyi by genome-wide association analysis. Aquaculture 2021, 543, 736998. [Google Scholar] [CrossRef]
- Chen, P.; Li, J.; Ma, J.; Teng, M.; Li, X. A small disturbance, but a serious disease: The possible mechanism of D52H-mutant of human PRS1 that causes gout. IUBMB Life 2013, 65, 518–525. [Google Scholar] [CrossRef]
- Brouwer, A.; Bokhoven, H.V.; Nabuurs, S.B.; Arts, W.F.; Christodoulou, J.; Duley, J. PRPS1 mutations: Four distinct syndromes and potential treatment. Am. J. Hum. Genet. 2010, 86, 506–518. [Google Scholar] [CrossRef]
- Liu, R.; Li, J.; Shao, J.; Lee, J.H.; Chen, Q. Innate immune response orchestrates phosphoribosyl pyrophosphate synthetases to support DNA repair. Cell Metab. 2021, 33, 2076–2089. [Google Scholar] [CrossRef]
- Qian, X.; Li, X.; Tan, L.; Lee, J.H.; Xia, Y.; Cai, Q.; Zheng, Y.; Wang, H.; Lorenzi, P.L.; Lu, Z. Conversion of PRPS hexamer to monomer by AMPK-mediated phosphorylation inhibits nucleotide synthesis in response to energy stress. Cancer Discov. 2018, 8, 94–107. [Google Scholar] [CrossRef]
- Mannava, S.; Grachtchouk, V.; Wheeler, L.J.; Im, M.; Zhuang, D.; Slavina, E.G.; Mathews, C.K.; Shewach, D.S.; Nikiforov, M.A. Direct role of nucleotide metabolism in C-MYC-dependent proliferation of melanoma cells. Cell Cycle 2008, 7, 2392–2400. [Google Scholar] [CrossRef]
- Marie, Z.; Dawn, W.; Arielle, H.; Blanka, S.; Charles, P.; Dita, M.; Václava k Veronika, B.; Olga, S.; Kateina, H. Clinical manifestations and molecular aspects of phosphoribosylpyrophosphate synthetase superactivity in females. Rheumatology 2018, 57, 1180–1185. [Google Scholar] [CrossRef]
- Mateos, J.; Fafián-Labora, J.; Morente-López, M.; Lesende-Rodriguez, I.; Monserrat, L.; Ódena, M.A.; Oliveira, E.; de Toro, J.; Arufe, M.C. Next-generation sequencing and quantitative proteomics of Hutchinson-Gilford progeria syndrome-derived cells point to a role of nucleotide metabolism in premature aging. PloS ONE 2018, 13, e0205878. [Google Scholar] [CrossRef] [PubMed]
- Song, M.H.; Lee, K.Y.; Choi, J.Y.; Bok, J.; Kim, U.K. Nonsyndromic X-linked hearing loss. Front. Biosci. 2012, 4, 924–933. [Google Scholar] [CrossRef]
- Synofzik, M.; Jennifer, M.; Haack, T.B.; Wilhelm, C.; Lindig, T.; Beck-Wödl, S.; Nabuurs, S.B.; Kuilenburg, A.V.; Brouwer, A.D.; Schöls, L. X-linked Charcot-Marie-Tooth disease, Arts syndrome, and prelingual non-syndromic deafness form a disease continuum: Evidence from a family with a novel PRPS1 mutation. Orphanet J. Rare Dis. 2014, 9, 24. [Google Scholar] [CrossRef]
- Begovich, K.; Yelon, D.; Wilhelm, J.E. Phosphoribosyl pyrophosphate synthetase polymerization influences lens fiber organization in zebrafish. Dev. Dyn. 2020, 249, 1018–1031. [Google Scholar] [CrossRef]
- Daignan-Fornier, B.; Pinson, B. Yeast to Study Human Purine Metabolism Diseases. Cells 2019, 8, 67. [Google Scholar] [CrossRef]
- Li, J.; Ye, J.; Zhu, S.; Cui, H. Down-Regulation of Phosphoribosyl Pyrophosphate Synthetase 1 Inhibits Neuroblastoma Cell Proliferation. Cells 2019, 8, 955. [Google Scholar] [CrossRef]
- Taira, M.; Iizasa, T.; Yamada, K.; Shimada, H.; Tatibana, M. Tissue-differential expression of two distinct genes for phosphoribosyl pyrophosphate synthetase and existence of the testis-specific transcript. BBA-Gene Struct. Expr. 1989, 1007, 203–208. [Google Scholar] [CrossRef]
- Srivastava, N.; Shelly, A.; Kumar, M.; Pant, A.; Das, B.; Majumdar, T.; Mazumder, S. Aeromonas hydrophila utilizes TLR4 topology for synchronous activation of MyD88 and TRIF to orchestrate anti-inflammatory responses in zebrafish. Cell Death Discov. 2017, 3, 17067. [Google Scholar] [CrossRef]
- Kai, L.; Shan, N.; Li, L.; Hui, J.; Pnacd, E. Functional characterization of four TIR domain-containing adaptors, MyD88, TRIF, MAL, and SARM in mandarin fish Siniperca chuatsi. Dev. Comp. Immunol. 2021, 122, 104110. [Google Scholar] [CrossRef]
- Yan, X.; Zhao, X.; Huo, R.; Xu, T. IRF3 and IRF8 Regulate NF-κB Signaling by Targeting MyD88 in Teleost Fish. Front. Immunol. 2020, 11, 606–619. [Google Scholar] [CrossRef]
- O’Neill, L.A.J.; Bowie, A.G. The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. Nat. Rev. Immunol. 2007, 7, 353–364. [Google Scholar] [CrossRef] [PubMed]
- Medzhitov, R.; Preston-Hurlburt, P.; Kopp, E.; Stadlen, A.; Chen, C.; Ghosh, S.; Janeway, C.A., Jr. MyD88 Is an Adaptor Protein in the hToll/IL-1 Receptor Family Signaling Pathways. Mol. Cell 1998, 2, 253–258. [Google Scholar] [CrossRef]
- Yu, Y.; Zhong, Q.W.; Zhang, Q.Q.; Wang, Z.G.; Li, C.M.; Yan, F.S.; Jiang, L.M. Full-length sequence and expression analysis of a myeloid differentiation factor 88 (MyD88) in half-smooth tongue sole Cynoglossus semilaevis. Int. J. Immunogenet. 2010, 36, 173–182. [Google Scholar] [CrossRef] [PubMed]
- Takano, T.; Kondo, H.; Hirono, I.; Saito-Taki, T.; Endo, M.; Aoki, T. Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA and gene in Japanese flounder, Paralichthys olivaceus. Dev. Comp. Immunol. 2006, 30, 807–816. [Google Scholar] [CrossRef] [PubMed]
- Rebl, A.; Goldammer, T.; Fischer, U.; Köllner, B.; Seyfert, H.M. Characterization of two key molecules of teleost innate immunity from rainbow trout (Oncorhynchus mykiss): MyD88 and SAA. Vet. Immunol. Immunopathol. 2009, 131, 122–126. [Google Scholar] [CrossRef]
- Liu, Y.; Li, M.; Fan, S.; Lin, Y.; Lin, B.; Luo, F.; Zhang, C.; Chen, S.; Li, Y.; Xu, A. A unique feature of Toll/IL-1 receptor domain-containing adaptor protein is partially responsible for lipopolysaccharide insensitivity in zebrafish with a highly conserved function of MyD88. J. Immunol. 2010, 185, 3391–3400. [Google Scholar] [CrossRef]
- Iliev, D.B.; Sobhkhez, M.; Fremmerlid, K.; Jørgensen, J.B. MyD88 Interacts with Interferon Regulatory Factor (IRF) 3 and IRF7 in Atlantic Salmon (Salmo salar). J. Biol. Chem. 2011, 286, 42715–42724. [Google Scholar] [CrossRef]
- Zhang, X.; Xu, X.; Shen, Y.; Fang, Y.; Zhang, J.; Bai, Y.; Gu, S.; Wang, R.; Chen, T.; Li, J. Myeloid differentiation factor 88 (Myd88) is involved in the innate immunity of black carp (Mylopharyngodon piceus) defense against pathogen infection. Fish Shellfish. Immunol. 2019, 94, 220–229. [Google Scholar] [CrossRef]
- Wu, B.; Song, Q.; Li, W.; Xie, Y.; Luo, S.; Tian, Q.; Zhao, R.; Liu, T.; Wang, Z.; Han, F. Characterization and functional study of a chimera galectin from yellow drum Nibea albiflora. Int. J. Biol. Macromol. 2021, 187, 361–372. [Google Scholar] [CrossRef]
- Cardoso, P.G.; Resende-De-Oliveira, R.; Rocha, E. Combined effects of increased temperature and levonorgestrel exposure on zebrafish female liver, using stereology and immunohistochemistry against catalase, CYP1A, HSP90 and vitellogenin. Environ. Pollut. 2019, 252, 1059–1067. [Google Scholar] [CrossRef] [PubMed]
- Han, F.; Zhang, Y.; Zhang, D.; Liu, L.; Tsai, H.J.; Wang, Z. The Rab5A gene of marine fish, large yellow croaker (Larimichthys crocea), and its response to the infection of Cryptocaryon irritans. Fish Shellfish. Immunol. 2016, 54, 364–373. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′-3′) | Purpose |
---|---|---|
PRPS1-cF | cccctgggatccccgGAATTCATGCCGAATATTAAAATATTC | Prokaryotic expression |
PRPS1-cR | gtcacgatgcggccgCTCGAGTCAGCTTGAGAAGGGGACATG | |
MyD88-cF | cccctgggatccccgGAATTCATGGCGTGTTGCACAAGTC | |
MyD88-cR | gtcacgatgcggccgCTCGAGCTTGGTCCTCTCATATGGC | |
PRPS1-sF | ctaccggactcagatCTCGAGATGCCGAATATTAAAATATTC | Subcellular localization |
PRPS1-sR | gtsccgtcgactgcaGAATTCCGGCTTGAGAAGGGGACATG | |
PRPS1-qF | GCAAGACAAGAAGGACAAGAGCCGT | RT-qPCR analysis |
PRPS1-qR | ATCAACAGGAATATCAAAGAATCCC | |
MyD88-qF | ATGGCGTGTTGCGACAAGTCCGAGG | |
MyD88-qR | TCCAGGGTGAGGCCGACCCTGTCTC | |
β-actin-qF | TTATGAAGGCTATGCCCTGCC | |
β-actin-qR | TGAAGGAGTAGCCACGCTCTGT | |
PRPS1-eF | tgctggatatctgcaCTCGAGATGCCGAATATTAAAATATTC | Overexpression |
PRPS1-eR | agtttttgttctagaGAATTCCGGCTTGAGAAGGGGACATG | |
MyD88-eF | tgctggatatctgcaCTCGAGATGGCGTGTTGCACAAGTC | |
MyD88-eR | agtttttgttctagaGAATTCCTTGGTCCTCTCATATGGC | |
β-actin-eF | tgctggatatctgcaCTCGAGATGGAAGATGAAATCGCCGC | |
β-actin-eR | agtttttgttctagaGAATTCGAAGCATTTGCGGTGGACG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, Q.; Li, W.; Li, J.; Xiao, Y.; Wu, B.; Wang, Z.; Han, F. Towards Understanding PRPS1 as a Molecular Player in Immune Response in Yellow Drum (Nibea albiflora). Int. J. Mol. Sci. 2022, 23, 6475. https://doi.org/10.3390/ijms23126475
Tian Q, Li W, Li J, Xiao Y, Wu B, Wang Z, Han F. Towards Understanding PRPS1 as a Molecular Player in Immune Response in Yellow Drum (Nibea albiflora). International Journal of Molecular Sciences. 2022; 23(12):6475. https://doi.org/10.3390/ijms23126475
Chicago/Turabian StyleTian, Qianqian, Wanbo Li, Jiacheng Li, Yao Xiao, Baolan Wu, Zhiyong Wang, and Fang Han. 2022. "Towards Understanding PRPS1 as a Molecular Player in Immune Response in Yellow Drum (Nibea albiflora)" International Journal of Molecular Sciences 23, no. 12: 6475. https://doi.org/10.3390/ijms23126475