Next Article in Journal
Structural Diversity of Mercury(II) Halide Complexes Containing Bis-pyridyl-bis-amide with Bulky and Angular Backbones: Ligand Effect and Metal Sensing
Previous Article in Journal
Combined Toxicological Effects of Di (2-Ethylhexyl) Phthalate and UV-B Irradiation through Endoplasmic Reticulum Stress—Tight Junction Disruption in Human HaCaT Keratinocytes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 14
10.3390/ijms23147858
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

PagGRF11 Overexpression Promotes Stem Development and Dwarfing in Populus

by
Yanting Tian
1,
Ye Zhao
1,
Yuhan Sun
1,
Yousry A. El-Kassaby
2,
Guoyong Song
3,
Yueqi Mi
1,
Juan Han
1 and
Yun Li
1,*
1
Engineering Technology Research Center of Black Locust of National Forestry and Grassland Administration, National Engineering Research Center of Tree Breeding and Ecological Restoration, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants of Ministry of Education, College of Biological Sciences and Technology, Beijing Forestry University, Beijing 100083, China
2
Department of Forest and Conservation Sciences, Faculty of Forestry, The University of British Columbia, 2424 Main Mall, Vancouver, BC V6T 1Z4, Canada
3
College of Material Science and Technology, Beijing Forestry University, Beijing 100083, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(14), 7858; https://doi.org/10.3390/ijms23147858
Submission received: 20 June 2022 / Revised: 10 July 2022 / Accepted: 14 July 2022 / Published: 16 July 2022
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

:
Poplar is not only an important woody plant, but also a model species for molecular plant studies. We identified PagGRF11 (pAxG07Gg0005700), a homolog of the Arabidopsis AtGRF1 (AT4G37740) and AtGRF2 (AT2G22840) gene. We transformed the poplar clone “84K” with PagGRF11, and the transgenic overexpressed plants (PagGRF11-OE) showed plant height reduction (dwarfing), stem diameter increase, internode shortening, and larger leaf area. The Arabidopsis overexpression line grf-oe (Overexpression of PagGRF11 in Arabidopsis), mutant line atgrf (a loss-of-function mutant of the AtGRF1 gene of Arabidopsis thaliana), and mutant trans-complementary line atgrf+oe (overexpression of PagGRF11 in mutant plants (atgrf)) also showed different leaf size phenotypes. Further, tissue sections revealed that increased xylem production was the main cause of stem thickening. Transcriptome differential expression analysis of PagGRF11 overexpressed and control plants showed that PagGRF11 promoted CCCH39(C3H39) expression. The expression profile of CCCH39 in different tissues showed that it was highly expressed in xylem. Yeast single hybrid and instantaneous double luciferase assay results showed that PagGRF11 directly transcribed and activated CCCH39 expression through interaction with cis-acting element GARE (TCTGTTG), thus promoting xylem development. This is the first finding that GRF positively regulates xylem development through CCCH39 expression activation and further suggests that PagGRF11 is a potential target for increasing wood yield.

1. Introduction

Poplar is one of the fastest-growing woody species with the largest cultivation area and the highest wood production in the world, and is characterized by its fast growth and high yield [1,2]. Improvement of secondary growth and wood properties through modern biotechnology is a powerful way to produce fast-growing and high-wood quality species. Therefore, strengthening research on the molecular mechanism of forest tree growth and development, especially the molecular mechanism of secondary growth, can provide effective theoretical guidance and technical support for woody species cultivation.
Growth regulating factors (GRF) are a class of plant-specific transcription factors that play an important role in plant growth and development regulation [3,4]. Their proteins are highly conserved, especially the N-terminal region, which contains two specific structural domains; namely, Gln-Leu-Gln (QLQ, glutamine, leucine, glutamine, IPR014978) and Trp-Arg-Cys (WRC, tryptophan, arginine, cysteine, IPR014977) [5,6,7]. In rice, earlier study showed that GRF rapidly responded to GA treatment, suggesting that it might be associated with growth and development [8]. GRFs have also been found in several plant species such as Arabidopsis thaliana, Zea mays, Medicago truncatula, Brassica rapa, and Populus trichocarpa, representing a large gene family, with 9, 12, and 19 genes in A. thaliana, O. sativa, and P. trichocarpa, respectively [9,10,11].
GRFs influence on stem elongation has also been observed. In rice, OsGRF1 is involved in mediating GA-dependent stem growth and in regulating heading time [8,12]. The accumulation of GRF4 in rice resulted in a half-dwarf plant with increased yield, which was associated with the provision of N through increased N use efficiency [13,14]. In addition, GRF upstream regulator, miR396, and GRF-interacting protein GIF were also involved in stem elongation regulation [3,15,16,17]. miR396 target site mutations in OsGRF4 slightly increased rice plant height, and further studies revealed that the reduced height of 35S:OsMIR396d rice was due to the endogenous cell growth being inhibited, causing the cells to become shorter and resulting in shorter stem internodes, while the number of internodes did not change. OsGRF6 can promote GA synthesis and signal transduction, which in turn regulates rice plant height [12,16]. In maize, overexpression of Zm-rGRF1 resulted in dwarfism, probably due to strong ectopic expression of Zm-rGRF1 interfering with the stem elongation process [18,19]. However, the molecular mechanisms of GRF development and formation in woody plants’ xylem are incomplete.
The zinc finger transcription factors are the largest family of transcription factors in plants and are key regulators of a variety of biological processes including morphogenesis, signal transduction, and environmental stress [20]. The CCCH (C3H) gene family is also a family of zinc finger proteins that regulate gene expression by directly binding to mRNA and contain a typical C3H-type motif, and members of this family have already been identified in several organisms from yeast to humans [21,22]. Compared to the largely well-characterized CCCHs in animals, only a small number of CCCH proteins have been functionally characterized in Arabidopsis and rice [23]. Members of higher plant-specific CCCH subfamily in Arabidopsis thaliana, Populus, and other plant species are known to play conserved roles in plant secondary growth, xylem development, and stress response [21,24]. AtC3H14 and AtC3H15 have recently been shown to act as the master regulators for secondary cell wall biosynthesis in Arabidopsis. Overexpression of PuC3H35 was shown to increase drought tolerance through the promotion of ROS-scavenging and lignification of Populus roots [22]. However, there are few studies on the gene function of CCCH39 and its upstream regulators are unclear.
Poplar is an important tree genus with rapid growth and high wood production. Here, the role of the GRF family gene PagGRF11 is characterized in “84K” poplars. Overexpression of PagGRF11 exhibited a thickened and shorter stem node, dwarfing, and larger leaf phenotype. Tissue sections were performed and revealed that widening of the xylem band was the main reason for the stem thickening. Meanwhile, stem compositional analysis showed that overexpression of PagGRF11 was able to increase the lignin content. At the same time, C3H39, which is highly expressed in xylem, can also be up-regulated by PagGRF11. The generated results are expected to provide important insights into the construction of regulatory networks related to woody plant development, especially wood formation, as well as new target sites for wood yield improvement.

2. Results

2.1. Identification of PagGRF11 in 84K

A total of 19 GRF genes were identified from the Populus trichocarpa genome (Populus_trichocarpa-Ensembl Genomes 53 http://plants.ensembl.org/Populus_trichocarpa/Info/Index accessed on 9 October 2020) and compared to clone “84K” genome (https://www.ncbi.nlm.nih.gov/bioproject/?term=Populus%20alba%20x%20Populus%20tremula%20var.%20glandulosa%20clone%2084K accessed on 22 October 2020) with a similarity expectation value of 1.0 × 10−100. We screened 24 GRF gene family members from the “84K” genome, among them, “84K” PagGRF11 (PAxG07Gg0005700.1) is homologous to Populus trichocarpa PtGRF11 (Potri.007G007100.1) and Arabidopsis AtGRF1/2 (AT4G37740, AT2G22840), indicating a possible similar gene function (Figure 1a). PagGRF11 encodes 419 amino acids containing a QLQ structural domain and a WRC structural domain specific to the GRF transcription factor gene family, implying that PagGRF11 is a member of the PagGRFs gene family.
Furthermore, the PagGRF11 subcellular localization showed that it has a strong green fluorescent signal in the nucleus of tobacco leaf subepidermal cells, indicating that it contains a nuclear localization signal (Figure 1b). We also examined the expression pattern of PagGRF11 in different tissues through quantitative reverse transcription polymerase chain reaction (qRT-PCR) (Figure 1c) and the results showed that it was expressed at the highest level in shoots and the lowest level in roots, suggesting that its expression may contribute to stem growth and development.

2.2. Overexpression of PagGRF11 in “84K” Leads to Plant Dwarfism and Stem Thickness

To further investigate the role of PagGRF11 in growth and development, PagGRF11 overexpressed transgenic plants were constructed with a 35S promoter. We obtained 8 PagGRF11-OE (overexpression of PagGRF11 in “84K” poplar) transgenic lines; among them, PagGRF11-OE lines 3, 10, and 11 expressed significantly higher ploidy than the control plants by 130-, 160-, and 90-fold, respectively, and were selected for further analyses (Figure 1c). The three transgenic lines (PagGRF11-OE-3, PagGRF11-OE-10, and PagGRF11-OE-11) had different morphological characteristics from the control and these differences were quantified statistically for plant height, stem third internode length and diameter, and plant dry and fresh weight (Figure 2a–e). The results indicated that the three transgenic lines were significantly shorter (i.e., dwarf) than the control. Similarly, after 100 d growth, the stem third internode lengths of the transgenic line were significantly shorter than the control (Figure 2d,e). Compared to the control, the stem diameter of the third internode of the transgenic lines showed a 32.61, 46.09, and 26.09% increase for PagGRF11-OE-3, PagGRF11-OE-10, and PagGRF11-OE-11, respectively (Figure 2e), while their leaves were longer and wider (Figure 2b), and their roots were longer (range: 10.072–24.487%). Two of the transgenic plants (PagGRF11-OE-3 and PagGRF11-OE-10) produced reduced dry weight (range: 12.30–20.19%) and fresh weight (range: 3.03–5.88%) as compared to control, while the third (PagGRF11-OE-11) produced similar dry weight and fresh weight to the control (Figure 2e).

2.3. Effect of PagGRF11 Overexpression on Stem Xylem Development

To investigate stem thickening in the transgenic plants, we sampled the stem 3rd and 12th internodes from 3-month-old plants (transgenic and control) and histologically stained their cross-section. The results showed that PagGRF-OE plants exhibited a significant increase in xylem thickness, suggesting that PagGRF11 may be involved in the early lignin synthesis pathway (Figure 3a–d). Analysis of the stem composition of the transgenic and control plants showed that the transgenic plants’ lignin and cellulose content were significantly higher and the hemi-lignin content was significantly lower than that of the control.
To further compare whether the proportion of lignin monomer types differed between the control and PagGRF11-OE plants, we examined the proportion of G- and S-type lignin monomers by Thiolysis (Figure 3f) and a slight decrease in the S-type lignin monomers proportion was found in PagGRF11-OE plants, further confirming PagGRF11 involvement in the lignin regulatory pathway.

2.4. Overexpression of PagGRF11 in Arabidopsis Causes Leaf Enlargement

To investigate whether PagGRF11 overexpression in other plants has a similar function to that in poplar, we overexpressed PagGRF11 in Arabidopsis to obtain a transgenic line grf-oe. The results indicated that the grf-oe exhibited a similar phenotype to that of transformed poplar with enlarged leaves compared to the Arabidopsis wild type (WT) (Figure 4a). Compared to the WT, the original atgrf mutant (a loss-of-function mutant of the AtGRF1 gene of Arabidopsis) showed smaller leaves. However, atgrf+oe lines were obtained after PagGRF11 was overexpressed in atgrf plants, and the transformed atgrf+oe produced larger leaves than those of atgrf (Figure 4b–e). For Arabidopsis thaliana plants grown for two weeks, the dry and fresh weights of grf-oe were significantly higher than the WT, while the dry weight was significantly lower than the WT (Figure 4c,d). These results suggest that PagGRF11 is capable of producing a leaf phenotype similar to that of Arabidopsis AtGRF1, implying that the homologous pair of PagGRF11 and AtGRF1 are functionally similar. On the other hand, a significant expansion of the GRF gene family from lower to higher plants has been documented in previous studies [5,25]. Here, we found that PagGRF11 did not result in phenotypic changes other than those in Arabidopsis leaves, whereas PagGRF11 transgenic poplars had more phenotypic changes, such as a wider xylem band, suggesting that PagGRF11 has a secondary growth regulatory function unique to woody plants. Further studies are needed to determine this regulatory mechanism.

2.5. PagGRF11 Interacted with CCCH39 Promoter Sequences and Induced Their Expression

GRFs, as a class of transcription factors unique to plants, are involved in a variety of developmental processes by regulating the expression of downstream genes. To find out which genes are regulated by PagGRF11, we selected one-month-old control (control) and transgenic plants (PagGRF11-OE-3 and PagGRF11-OE-10) for comparative transcriptome analysis. There were three comparison groups: 1) mixed samples of lines PagGRF11-OE-3 and PagGRF11-OE-10 compared with controls (Control-vs-OE), 2) the transgenic line PagGRF11-OE-3 compared with control (Control-vs-OE-3), and 3) the transgenic line PagGRF11-OE-10 compared with control (Control-vs-OE-10) and were screened for 234, 284, and 271 significantly differentially expressed genes (DEG), respectively (Figure 5e and Table S2). Among these DEGs, 135 co-occurred in the three combinations. KEGG enrichment analysis revealed that the top 20 pathways were significantly enriched in the lignin biosynthesis pathway, results consistent with our previous statistical analysis of this trait (Figure 5d). Further analysis revealed that 56 transcription factors were significantly enriched into 15 transcription factor families. Of these, the CCCH gene family was associated with lignin biosynthesis. In our transcriptome results, only CCCH39 was found to be significantly enriched (Figure 5f). KEGG enrichment analysis was also annotated to the hormone signaling pathway. We examined the endogenous hormone content of control and PagGRF11-OE plants using high performance liquid chromatography and found that PagGRF-OE-3 and PagGRF-OE-10 plants had significantly lower IAA and salicylic acid contents than the control (Figure 5a–c). Meanwhile, KEGG enrichment analysis was annotated to the phenylpropanoid biosynthesis pathway, which may correlate with phenotypic changes in the wider xylem band (Figure 5d).
In previous studies, the GRF family of proteins had a single C-X8- 9-C-X10-C-X2-H-type zinc-binding motif in the WRC domain corresponding to the Hordeum suppressor (HRT) motif of the barley transcriptional repressor protein, which is thought to bind to the GA response element (GARE) motif [12,26,27]. Analysis of the CCCH39 promoter revealed that it contains a TCTGTTG element; therefore, we speculate that PagGRF11 regulates CCCH39 gene expression by binding to the GARE (TCTGTTG) motif of the CCCH39 promoter.

2.6. PagGRF11 Transcriptional Activation Regulates CCCH39 Expression

Luciferase reporters with CCCH39 promoters cloned from the hybrid poplar “84K” were separately co-transformed into Nicotiana tabacum with the PagGRF11 effector; the CCCH39 reporter produced higher than 2-fold luciferase activity compared to the mock control, which was consistent with the changes in its expression observed by RNA-seq and qRT-PCR (Figure 6a,b).
In a previous study, GARE (TCTGTTG) was determined to be the binding element for OsGRF7 [28]. Thus, we next verified PagGRF11 binding to the target gene CCCH39 in a yeast single-hybrid assay. All four-yeast reporter PagGRF11-AD fusion expression vectors of GARE (TCTGTTG), GARE-3 (TCTGTTCTCTCTGTTGTCTGTTG), ProC3H39 (CCCH39 promoter sequence length 533 bp), and GARE-M (TCCCCCC) were constructed by the GAL4 system and transformed yeast together, and all were found to grow normally except for the TCTGTTG mutation site (Figure 6d), suggesting that PagGRF11 is able to bind directly to the GARE element on the CCCH39 promoter.
CCCH39 expression analysis at different sites showed that CCCH39 was most highly expressed in the xylem. The expression level of CCCH39 gene was also analyzed in the stem 3rd, 6th and 12th internodes of two-month-old wild-type seedlings. The 3rd internode of the stem includes primary growth vascular tissue and is younger. The stem 12th internodes have well developed secondary phloem tissues and secondary xylem vessels, as well as fibers with well lignified secondary walls. The analysis showed that CCCH39 expression was highest in the stem 3rd internode, implying that CCCH39 is highly expressed in the young stem (Figure 6c). This is consistent with previous findings on the CCCH gene family [23], suggesting that CCCH39 has a positive regulatory effect on xylem synthesis. Additionally, previous studies have suggested that the gibberellin synthesis gene GA20ox has a positive regulatory effect on plant height. Our results showed that GA20ox-D expression was down-regulated by RNA-seq and qRT-PCR in PagGRF11-OE plants compared to control, implying that PagGRF11 may regulate poplar plant height by participating in the gibberellin synthesis pathway (Figure 6a).

3. Discussion

The GRF gene family, a plant-specific class of transcription factor families associated with growth and development, has an important role in plant growth and developmental processes. There are 19 members of the GRF gene family in Populus trichocarpa, which is 2-fold higher than the number of AtGRFs genes in Arabidopsis (9). In the “84K” poplar genome, 24 members of the GRF gene family were found, which is 2.67-fold more than the number of members of the Arabidopsis GRF family, and even more than the genome of the Populus trichocarpa. This may be related to the fact that the “84K” poplar has two different sets of chromosomes. However, in any case, these ratios are much greater than the 1.4–1.6 ratio between poplar homologs and Arabidopsis genes in comparative genomics [29], suggesting that they have greater amplification in woody compared to herbaceous plants. In our study, PagGRF11 was found to have similar gene functions in Arabidopsis and Populus in regulating leaf size. However, PagGRF11 poplar transgenic plants had wider xylem bands and dwarfed plants, suggesting that PagGRF11 is involved in secondary growth of woody plants, which is a woody plant-specific growth and development process that distinguishes herbaceous plants. Suggesting that GRF has a specific biological function in the evolution from lower to higher plants.
The structure of GRFs is very conserved, but they have their own characteristics in terms of motifs. For example, previous studies have shown that PagGRF12a negatively regulated lignin synthesis [5,25]. In contrast, in our study, PagGRF11 positively regulated lignin synthesis, probably because although it is the same gene family, different members are involved in different signaling pathways.
Despite the important role of GRFs in secondary plant growth and development, it is unclear how they affect lignin formation. Here, our analysis of the expression pattern of CCCH39 (downstream genes of PagGRF11) in different parts of “84K” poplar revealed that CCCH39 was highly expressed mainly in the xylem, suggesting that it affects lignin accumulation. In contrast, PagGRF11 could affect lignin synthesis and accumulation through CCCH39 regulation. Further studies revealed that the proportion of S-type monomers tended to decrease and the total amount of lignin increased in PagGRF-OE plants, suggesting that PagGRF11 may affect the production of S-type monomers or their polymerisation through CCCH, but the exact process in which it affects monomer synthesis is unclear and needs further study. Lignin, as an important biomolecule of great economic and application value and its anabolic pathway has also received great attention, thus it is important to investigate the molecular mechanism of its synthesis.
Plant CCCH zinc finger proteins regulate plant growth and development mainly at the post-transcriptional level and are considered to be an important gene family associated with wood development [20,30]. The family underwent a large number of replication events in the poplar genome and therefore its family members (91) are significantly higher than those of herbaceous plants such as Arabidopsis thaliana (68) and rice (67) [20,23]. However, the specific functions of some of its members are unclear. In previous studies, PuC3H35 was found to be involved in mediating proanthocyanidin (PA) biosynthesis and lignin in poplar roots in response to drought stress in Populus ussuriensis, and overexpression of PuC3H35 promoted PA and lignin biosynthesis and vascular tissue development, resulting in enhanced tolerance to drought stress by means of antioxidant and mechanical support [22]. Overexpression of PdC3H17 in poplar caused dwarfism, produced more xylem vascular cells, resulted in higher stem water potential and showed increased photosynthesis [31]. Analysis of CCCH39 expression pattern in different tissue parts showed that it was highly expressed in the xylem. Analysis of CCCH39 expression in different stem developmental stages also showed that it was highly expressed in relatively young stems with well lignified secondary walls. These results are consistent with previous studies and suggest that it is most likely to be involved in the lignin synthesis pathway. In order to reveal more specific biological functions of CCCH39, we are undertaking a functional study of the “84K” poplar transgene, with a view to further elucidating how the PagGRF11-CCCH39 module regulates xylem formation and affects lignin accumulation in specific ways.

4. Materials and Methods

4.1. Vector Construction and Plant Transformation

PagGRF11 homologs’ amino acid sequences were retrieved from the National Center for Biotechnology Information (NCBI) database. PagGRF11 full coding and promoter sequences were cloned in the hybrid poplar “84K” using the primer clones listed in Table S1. 35S::PagGRF11 constructs were generated using PBI121 vectors. PCR amplification was performed using the primers listed in Table S1. PagGRF11 stop codon was replaced with the nucleotide sequence encoding the GFP domain (encoding a fluorescent protein), and the PagGRF11-GFP amplicon was then inserted into the PBI121 vector to generate the 35S::PagGRF11-GFP construct. 35S::PagGRF11 constructs were introduced into Populus alba×P.glandulosa via the leaf disc method [32]. 35S::PagGRF11 constructs were transformed by infesting Arabidopsis inflorescences with Arabidopsis Columbia 0 and atgrf mutants (AtGRF1 loss-of-function mutants). All transgenic plants were identified and verified by PCR amplification and expression. Atgrf mutants were obtained from the Chinese Arabidopsis Mutant Sharing Center (Arashare, Fuzhou, China). All transgenic Populus and Arabidopsis lines were kept in the Tissue Culture Room of the High Precision Innovation Centre at Beijing Forestry University, China. All plants were grown at 24 °C with 16 h of light and 8 h of darkness.

4.2. RNA Extraction and RT-qPCR Analysis

The cetyltrimethylammonium bromide (CTAB, Coolaber, Beijing, China) method was used to extract total RNA [33]. cDNA reverse transcription was carried out using the reverse transcription kit RR0316A from Takara Bio (Takara Dalian, China), according to the manufacturer’s instructions. RT-qPCR was carried out by a one-step method using the SYBR kit (AG, Hunan, China) according to the manufacturer’s instructions.

4.3. Histochemical and Histological Analyses

Cross sections of the basal stems were produced from 3-month-old transgenic poplars and control. Briefly, 0.5 cm stem segments were submerged in ddH2O, then fixed in 7% agarose. Thin slices were cut to 35 μm thickness using a vibrating microtome (Leica EM UC7), stained with toluidine blue, and photographed under a microscope (Axio Imager A1, Carl Zeiss, Beijing, China).

4.4. Subcellular Localization Analysis

The 35S::PagGRF11::GFP vector was constructed and transformed into Agrobacterium tumefaciens GV3101. Young (4-week-old) tobacco plant leaves were used for needleless syringe infiltration following [5]. After injection and incubation in the dark for 24 h, plants were then transferred to light for 2 days, followed by observing and photographing with a laser confocal microscope (Nikon Super Resolution Laser Scanning Confocal Microscope (Instrument No. A14000021, Tsinghua University, Beijing, China).

4.5. Development and Growth Analysis

Three-month-old control and transgenic plants were used as the experimental material for morphological analysis to determine plant height, stem diameter, and root length. Fresh biomass and dry weight yield of control and transgenic positive plants were examined after 100 d of growth in hydroponic culture in a light incubator. All stem dry tissues were ground and the lignin–lignin monomer ratio was quantified by the mercaptolysis. All stem dry tissues were ground and the lignin content was quantified by the Klason method and the supernatant was used to determine cellulase and hemicellulose content.

4.6. Transcriptome Analysis

Total RNA was isolated from shoot-tip tissue collected from three independent CK and PagGRF11 OE-3 and OE-10 plants (2-month-old) using the RNeasy Plant Mini Kit (Qiagen, Shanghai, China), followed by determining total RNA quantity and purity using Qubit RNA HS, and RNA integrity quality control using the 2100 RNA Nano/Pico kit. RNA sequencing libraries were constructed from transgenic and control plants (three biological replicates per sample). Raw data obtained from sequencing were filtered and the filtered clean reads were compared to the Populus genome (http://plants.ensembl.org/Populus_trichocarpa/Search/Results?species=Populus_trichocarpa;idx=;q=;site=ensemblunit accessed on 17 August 2021). Differential expression analysis was performed based on gene expression between samples, and GO and pathway functional analysis was performed on the screened differentially expressed genes.

4.7. Yeast One-Hybrid Assays

PagGRF11 cDNA full-length was fused to the PAGDT7 (AD) vector (PagGRF11-AD). Yeast reporters were constructed by fusing promoter regions or transcriptional activation element sequences to the pAbAi vector. Four yeast reporters (CCCH39 promoter 500 bp, TCTGTTG motif element, TCTGTTGTCTGTTGTCTGTTG motif element, and TCCCCCC motif element) were constructed to transform the yeast strain Y1HGold to generate a Bait-Reporter yeast strain. PagGRF11-AD was transformed into the Bait-Reporter yeast strain from the previous step and all strains were grown on SD selection medium (SD/-His-Leu) for 7 days. Y1H assay was performed according to the manufacturer’s instructions (Code No. 630,491 Takara, Dalian, China).

4.8. Dual Luciferase Reporter Assay of Transient Expression

The dual luciferase reporter transcriptional activation assay was performed as previously reported [22]. Briefly, the CDs region of PagGRF11 and the CCCH39 promoter region (2000 bp upstream of ATG) were separately cloned into effectors (pGreen-62-sk, 35S::transcription factor) and reporters (pGreen-0800-LUC, promoter-luciferase) in a vector. The effector and reporter were then co-transformed into tobacco leaves and after 2 d incubation, the dual luciferase activity was measured using a dual luciferase reporter system (Promega, GloMax 20/20 Luminometer Beijing, China).

5. Conclusions

We transformed the poplar clone “84K” with PagGRF11, and the transgenic overexpressed plants showed a reduction in plant height (dwarfing), an increase in stem diameter, internode shortening, and a larger leaf area. Further, tissue sections revealed that increased xylem was the main cause of stem thickening. The expression profile of CCCH39 in different tissues showed that CCCH39 was highly expressed in xylem. Yeast single hybrid and instantaneous double luciferase assay results showed that PagGRF11 directly transcribed and activated CCCH39 expression through interaction with cis-acting element GARE (TCTGTTG), thus promoting xylem development. This is the first finding that GRF positively regulates xylem development through CCCH39 expression activation and further suggests that PagGRF11 is a potential target for increasing wood yield.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23147858/s1.

Author Contributions

Y.L. and Y.T. conceived the project and designed the experiments; Y.T., Y.Z., Y.S., J.H., Y.M., G.S. performed the experiments; Y.L. and Y.T. assisted the research, Y.T., Y.L. and Y.A.E.-K. analyzed data and wrote the article. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Fundamental Research Funds for the Central Universities (2015ZCQ-SW-03), the Major National Science and Technology Projects (2018ZX08020002-003-002), the Naturnal Science Foundation of China (31971675).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

RNAseq data is being uploaded to https://ngdc.cncb.ac.cn/omix/database accessed on 15 July 2022. All data are included in the article or in supplementary data published online. Data supporting the findings of this study are available from the corresponding author, Yanting Tian, upon request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bradshaw, H.; Ceulemans, R.; Davis, J.; Stettler, R. Emerging Model Systems in Plant Biology: Poplar (Populus) as A Model Forest Tree. J. Plant Growth Regul. 2000, 19, 306–313. [Google Scholar] [CrossRef]
  2. Zhou, H.; Song, X.; Wei, K.; Zhao, Y.; Jiang, C.; Wang, J.; Tang, F.; Lu, M. Growth-regulating factor 15 is required for leaf size control in Populus. Tree Physiol. 2018, 39, 381–390. [Google Scholar] [CrossRef] [PubMed]
  3. Kim, J.H.; Tsukaya, H. Regulation of plant growth and development by the GROWTH-REGULATING FACTOR and GRF-INTERACTING FACTOR duo. J. Exp. Bot. 2015, 66, 6093–6107. [Google Scholar] [CrossRef] [Green Version]
  4. Omidbakhshfard, M.A.; Proost, S.; Fujikura, U.; Mueller-Roeber, B. Growth-Regulating Factors (GRFs): A Small Transcription Factor Family with Important Functions in Plant Biology. Mol. Plant 2015, 8, 998–1010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Wang, J.; Zhou, H.; Zhao, Y.; Sun, P.; Tang, F.; Song, X.; Lu, M.-Z. Characterization of poplar growth-regulating factors and analysis of their function in leaf size control. BMC Plant Biol. 2020, 20, 509. [Google Scholar] [CrossRef] [PubMed]
  6. Horiguchi, G.; Kim, G.T.; Tsukaya, H. The transcription factor AtGRF5 and the transcription coactivator AN3 regulate cell proliferation in leaf primordia of Arabidopsis thaliana. Plant J. 2005, 43, 68–78. [Google Scholar] [CrossRef]
  7. Kim, J.S.; Mizoi, J.; Kidokoro, S.; Maruyama, K.; Nakajima, J.; Nakashima, K.; Mitsuda, N.; Takiguchi, Y.; Ohme-Takagi, M.; Kondou, Y. Arabidopsis growth-regulating factor7 functions as a transcriptional repressor of abscisic acid- and osmotic stress-responsive genes, including DREB2A. Plant Cell 2012, 24, 3393–3405. [Google Scholar] [CrossRef] [Green Version]
  8. Knaap, E.; Kende, K.H. A Novel Gibberellin-Induced Gene from Rice and Its Potential Regulatory Role in Stem Growth. Plant Physiol. 2000, 122, 695–704. [Google Scholar] [CrossRef] [Green Version]
  9. Kim, J.H.; Choi, D.; Kende, H. The AtGRF family of putative transcription factors is involved in leaf and cotyledon growth in Arabidopsis. Plant J. 2010, 36, 94–104. [Google Scholar] [CrossRef]
  10. Choi, D.; Kim, J.H.; Kende, H. Whole genome analysis of the OsGRF gene family encoding plant-specific putative transcription activators in rice (Oryza sativa L.). Plant Cell Physiol. 2004, 45, 897–904. [Google Scholar] [CrossRef] [Green Version]
  11. Cao, Y.; Han, Y.; Jin, Q.; Lin, Y.; Cai, Y. Comparative Genomic Analysis of the GRF Genes in Chinese Pear (Pyrus bretschneideri Rehd), Poplar (Populous), Grape (Vitis vinifera), Arabidopsis and Rice (Oryza sativa). Front. Plant Sci. 2016, 7, 1750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Zla, B.; Bo, W.; Zz, A.; Wei, L.A.; Yt, A.; Yn, A.; Kang, C.; Yxa, C. OsGRF6 interacts with SLR1 to regulate OsGA2ox1 expression for coordinating chilling tolerance and growth in rice. J. Plant Physiol. 2021, 260, 153406. [Google Scholar]
  13. Liu, Q.; Wu, K.; Song, W.; Zhong, N.; Wu, Y.; Fu, X. Improving crop nitrogen use efficiency toward sustainable green revolution. Annu. Rev. Plant Biol. 2022, 73, 523–551. [Google Scholar] [CrossRef]
  14. Wu, K.; Wang, S.; Song, W.; Zhang, J.; Wang, Y.; Liu, Q.; Yu, J.; Ye, Y.; Li, S.; Chen, J.; et al. Enhanced sustainable green revolution yield via nitrogen-responsive chromatin modulation in rice. Science 2020, 367, eaaz2046. [Google Scholar] [CrossRef]
  15. Debernardi, J.; Rodriguez, R.; Mecchia, M.; Palatnik, J.F. Functional Specialization of the Plant miR396 Regulatory Network through Distinct MicroRNA–Target Interactions. PLoS Genet. 2012, 8, e1002419. [Google Scholar] [CrossRef] [PubMed]
  16. Ma, K.; Liu, Y.-G. DELLA-GRF4-mediated coordination of growth and nitrogen metabolism paves the way for a new Green Revolution. Sci. China Life Sci. 2018, 61, 1130–1131. [Google Scholar] [CrossRef] [PubMed]
  17. Rodriguez, R.E.; Mecchia, M.A.; Debernardi, J.M.; Schommer, C.; Weigel, D.; Palatnik, J.F. Control of cell proliferation in Arabidopsis thaliana by microRNA miR396. Development 2010, 137, 103. [Google Scholar] [CrossRef] [Green Version]
  18. Wu, L.; Zhang, D.; Xue, M.; Qian, J.; He, Y.; Wang, S. Overexpression of the maize GRF10, an endogenous truncated growth-regulating factor protein, leads to reduction in leaf size and plant height. J. Integr. Plant Biol. 2014, 56, 1053–1063. [Google Scholar] [CrossRef]
  19. Nelissen, H.; Eeckhout, D.; Demuynck, K.; Persiau, G.; Walton, A.; Van Bel, M.; Vervoort, M.; Candaele, J.; De Block, J.; Aesaert, S.; et al. Dynamic Changes in ANGUSTIFOLIA3 Complex Composition Reveal a Growth Regulatory Mechanism in the Maize Leaf. Plant Cell 2015, 27, 1605–1619. [Google Scholar] [CrossRef] [Green Version]
  20. Wang, D.; Guo, Y.; Wu, C.; Yang, G.; Li, Y.; Zheng, C. Genome-wide analysis of CCCH zinc finger family in Arabidopsis and rice. BMC Genom. 2008, 9, 44. [Google Scholar] [CrossRef] [Green Version]
  21. Jang, J.-C. Arginine-rich motif-tandem CCCH zinc finger proteins in plant stress responses and post-transcriptional regulation of gene expression. Plant Sci. 2016, 252, 118–124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Li, D.; Yang, J.; Pak, S. PuC3H35 confers drought tolerance by enhancing lignin and proanthocyanidin biosynthesis in the roots of Populus ussuriensis. New Phytol. 2021, 233, 390–408. [Google Scholar] [CrossRef] [PubMed]
  23. Chai, G.; Hu, R.; Zhang, D.; Qi, G.; Zuo, R.; Cao, Y.; Chen, P.; Kong, Y.; Zhou, G. Comprehensive analysis of CCCH zinc finger family in poplar (Populus trichocarpa). BMC Genom. 2012, 13, 253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Wang, H.; Avci, U.; Nakashima, J.; Hahn, M.G.; Chen, F.; Dixon, R.A. Mutation of WRKY transcription factors initiates pith secondary wall formation and increases stem biomass in dicotyledonous plants. Proc. Natl. Acad. Sci. USA 2010, 107, 22338–22343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Wang, J.; Zhou, H.; Zhao, Y.; Jiang, C.; Li, J.; Tang, F.; Liu, Y.; Zhao, S.; Hu, J.; Song, X.; et al. PagGRF12a interacts with PagGIF1b to regulate secondary xylem development through modulating PagXND1a expression in Populus alba × P. glandulosa. J. Integr. Plant Biol. 2020, 63, 1683–1694. [Google Scholar] [CrossRef]
  26. Liu, H.; Guo, S.; Xu, Y.; Li, C.; Zhang, Z.; Zhang, D.; Xu, S.; Zhang, C.; Chong, K. OsmiR396d-regulated OsGRFs function in floral organogenesis in rice through binding to their targets OsJMJ706 and OsCR4. Plant Physiol. 2014, 165, 160–174. [Google Scholar] [CrossRef] [Green Version]
  27. Raventós, D.; Skriver, K.; Schlein, M.; Karnahl, K.; Rogers, S.W.; Rogers, J.C.; Mundy, J. HRT, a Novel Zinc Finger, Transcriptional Repressor from Barley. J. Biol. Chem. 1998, 273, 23313–23320. [Google Scholar] [CrossRef] [Green Version]
  28. Chen, Y.; Dan, Z.; Gao, F.; Chen, P.; Li, S. Rice Growth-Regulating Factor7 Modulates Plant Architecture through Regulating GA and IAA Metabolism. Plant Physiol. 2020, 184, 393–406. [Google Scholar] [CrossRef]
  29. Tuskan, G.A.; DiFazio, S.; Jansson, S.; Bohlmann, J.; Grigoriev, I.; Hellsten, U.; Putnam, N.; Ralph, S.; Rombauts, S.; Salamov, A.; et al. The Genome of Black Cottonwood, Populus trichocarpa (Torr. & Gray). Science 2006, 313, 1596–1604. [Google Scholar] [CrossRef] [Green Version]
  30. Dharmawardhana, P.; Brunner, A.M.; Strauss, S.H. Genome-wide transcriptome analysis of the transition from primary to secondary stem development in Populus trichocarpa. BMC Genom. 2010, 11, 150. [Google Scholar] [CrossRef] [Green Version]
  31. Zhuang, Y.; Wang, C.; Zhang, Y.; Chen, S.; Wang, D.; Liu, Q.; Zhou, G.; Chai, G. Overexpression of PdC3H17 Confers Tolerance to Drought Stress Depending on Its CCCH Domain in Populus. Front. Plant Sci. 2020, 10, 1748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Zhao, Y.; Song, X.; Zhou, H.; Wei, K.; Jiang, C.; Wang, J.; Cao, Y.; Tang, F.; Zhao, S.; Lu, M.; et al. KNAT2/6b, a class I KNOX gene, impedes xylem differentiation by regulating NAC domain transcription factors in poplar. New Phytol. 2019, 225, 1531–1544. [Google Scholar] [CrossRef] [PubMed]
  33. Jordon-Thaden, I.E.; Chanderbali, A.S.; Gitzendanner, M.A.; Soltis, D.E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl. Plant Sci. 2015, 3, 1400105. [Google Scholar] [CrossRef] [PubMed]
Ijms 23 07858 g001 550
Figure 1. Evolutionary analysis, subcellular localization and expression analysis. (a) Neighbor-joining phylogenetic tree of PagGRF-related proteins from “84K”, Arabidopsis thaliana, and Populus. The tree was constructed from an alignment conducted using MEGA X with 1000 bootstrap replicates; the bootstrap value for each node is shown on the tree with star symbol. (b) PagGRF11-GFP fusion reporter in N. Subcellular localization of the tobacco cells by confocal laser microscopy. GFP, DAPI and merged images are shown (scale bar = 50 μm). GFP: Green fluorescent signal of PagGRF11-GFP protein, DAPI: Blue nucleus fluorescence signal. (c) Expression patterns of PagGRF11 in different tissues of “84K” poplar (left). The horizontal axis represents different tissues, and the vertical axis represents qRT-PCR value. Expression levels of PagGRF11 in control and transgenic plants (right). The vertical axis represents the values of qRT-PCR and the horizontal axis represents different samples. Control: “84K” populus carried the pBI121 empty vector. PagGRF11-OE-3, PagGRF11-OE-10, PagGRF11-OE-11: Overexpression of PagGRF11 in “84K” poplar.
Figure 1. Evolutionary analysis, subcellular localization and expression analysis. (a) Neighbor-joining phylogenetic tree of PagGRF-related proteins from “84K”, Arabidopsis thaliana, and Populus. The tree was constructed from an alignment conducted using MEGA X with 1000 bootstrap replicates; the bootstrap value for each node is shown on the tree with star symbol. (b) PagGRF11-GFP fusion reporter in N. Subcellular localization of the tobacco cells by confocal laser microscopy. GFP, DAPI and merged images are shown (scale bar = 50 μm). GFP: Green fluorescent signal of PagGRF11-GFP protein, DAPI: Blue nucleus fluorescence signal. (c) Expression patterns of PagGRF11 in different tissues of “84K” poplar (left). The horizontal axis represents different tissues, and the vertical axis represents qRT-PCR value. Expression levels of PagGRF11 in control and transgenic plants (right). The vertical axis represents the values of qRT-PCR and the horizontal axis represents different samples. Control: “84K” populus carried the pBI121 empty vector. PagGRF11-OE-3, PagGRF11-OE-10, PagGRF11-OE-11: Overexpression of PagGRF11 in “84K” poplar.
Ijms 23 07858 g001
Ijms 23 07858 g002 550
Figure 2. Morphological characterization of Pag-GRF11-overexpressing transgenic plants. (a–d) General characteristics of 3-month-old plants overexpressing PagGRF11 and control. Control: “84K” populus carried the pBI121 empty vector (scale bar = 5 cm). (a) Plant height, (b) leaf, (c) root, and (d) stem internode of control and PagGRF11 transgenic plants. (e) Three-month-old plants were used to measure stem dry weight, stem fresh weight, plant height, third internode diameter, root length, stem third internode length. * denotes p < 0.0194, *** denotes p < 0.0002, **** denotes p < 0.0001.
Figure 2. Morphological characterization of Pag-GRF11-overexpressing transgenic plants. (a–d) General characteristics of 3-month-old plants overexpressing PagGRF11 and control. Control: “84K” populus carried the pBI121 empty vector (scale bar = 5 cm). (a) Plant height, (b) leaf, (c) root, and (d) stem internode of control and PagGRF11 transgenic plants. (e) Three-month-old plants were used to measure stem dry weight, stem fresh weight, plant height, third internode diameter, root length, stem third internode length. * denotes p < 0.0194, *** denotes p < 0.0002, **** denotes p < 0.0001.
Ijms 23 07858 g002
Ijms 23 07858 g003 550
Figure 3. Cross-sections of stems at the 3rd and 12th internode of PagGRF11 and control plants. (a,b) Cross section of stem 3rd internode of PagGRF11 and control plants; (c,d) Stem 12th internode cross section of PagGRF11 and control plants; (e) Analysis of the stem composition of transgenic and control plants; **** denotes p < 0.0001. (f) Thiolysis analysis of lignin monomers in 3-month-old PagGRF11-OE and control plants. G: G-type lignin monomer, S: S-type lignin monomer.
Figure 3. Cross-sections of stems at the 3rd and 12th internode of PagGRF11 and control plants. (a,b) Cross section of stem 3rd internode of PagGRF11 and control plants; (c,d) Stem 12th internode cross section of PagGRF11 and control plants; (e) Analysis of the stem composition of transgenic and control plants; **** denotes p < 0.0001. (f) Thiolysis analysis of lignin monomers in 3-month-old PagGRF11-OE and control plants. G: G-type lignin monomer, S: S-type lignin monomer.
Ijms 23 07858 g003
Ijms 23 07858 g004 550
Figure 4. Phenotype of PagGRF11 transformed Arabidopsis plants. (a) Morphological characterization of WT, grf-oe, atgrf, atgrf+oe. WT: Wild-type Arabidopsis Columbia 0. grf-oe: Overexpression of PagGRF11 in Arabidopsis. atgrf: A loss-of-function mutant of the AtGRF1 gene of Arabidopsis thaliana. atgrf+oe: The PagGRF11 gene was overexpressed in mutant plants (atgrf). (b–e): Statistics of leaf length (b), leaf width (e), dry weight (d) and fresh weight (c) of WT, grf-oe, atgrf, atgrf+oe 4 transgenic lines. ** denotes p < 0.0077, *** denotes p < 0.0002, **** denotes p < 0.0001, “ns” denotes the difference is not significant.
Figure 4. Phenotype of PagGRF11 transformed Arabidopsis plants. (a) Morphological characterization of WT, grf-oe, atgrf, atgrf+oe. WT: Wild-type Arabidopsis Columbia 0. grf-oe: Overexpression of PagGRF11 in Arabidopsis. atgrf: A loss-of-function mutant of the AtGRF1 gene of Arabidopsis thaliana. atgrf+oe: The PagGRF11 gene was overexpressed in mutant plants (atgrf). (b–e): Statistics of leaf length (b), leaf width (e), dry weight (d) and fresh weight (c) of WT, grf-oe, atgrf, atgrf+oe 4 transgenic lines. ** denotes p < 0.0077, *** denotes p < 0.0002, **** denotes p < 0.0001, “ns” denotes the difference is not significant.
Ijms 23 07858 g004
Ijms 23 07858 g005 550
Figure 5. Transcriptome analysis of PagGRF11 overexpressing plants and control. (a–c) Contents of salicylic acid and indoleacetic acid in control, PagGRF-OE-3, and PagGRF-OE-10 were detected by high performance liquid chromatography. (d) KEGG enrichment analysis of 135 DEGs. The size of the dots represents the number of genes (the larger the dot, the more genes are enriched). The color of the dots indicates the enrichment significant level (the darker the color, the smaller the Q value, and the more significant the enrichment degree is). (e) Venn diagram analysis of three comparison groups: Control-VS-OE, Control-VS-OE-3, and Control-VS-OE-10.OE: PagGRF11-OE-3 and PagGRF11-OE-10 mixed samples; OE-3: PagGRF11-OE-3 lines; OE-10: PagGRF11-OE-10 lines. (f) All transcription factor families and numbers in the 135 differential genes; the vertical axis represents the number of transcription factors, and the horizontal axis represents the transcription factor families.
Figure 5. Transcriptome analysis of PagGRF11 overexpressing plants and control. (a–c) Contents of salicylic acid and indoleacetic acid in control, PagGRF-OE-3, and PagGRF-OE-10 were detected by high performance liquid chromatography. (d) KEGG enrichment analysis of 135 DEGs. The size of the dots represents the number of genes (the larger the dot, the more genes are enriched). The color of the dots indicates the enrichment significant level (the darker the color, the smaller the Q value, and the more significant the enrichment degree is). (e) Venn diagram analysis of three comparison groups: Control-VS-OE, Control-VS-OE-3, and Control-VS-OE-10.OE: PagGRF11-OE-3 and PagGRF11-OE-10 mixed samples; OE-3: PagGRF11-OE-3 lines; OE-10: PagGRF11-OE-10 lines. (f) All transcription factor families and numbers in the 135 differential genes; the vertical axis represents the number of transcription factors, and the horizontal axis represents the transcription factor families.
Ijms 23 07858 g005
Ijms 23 07858 g006 550
Figure 6. Overexpression of PagGRF11 up-regulated CCCH39 expression and resulted in plant dwarfing and increased lignin. (a) Expression level analysis of CCCH39 and GA20ox1-D in PagGRF-OE and control. OE-3: PagGRF11-OE-3, OE-10: PagGRF11-OE-10. (b) Dual-luciferase assay showing the increase of CCCH39 by the PagGRF11 effector construct compared to the control effector construct. Effect: Effect vectors; Reporter:Report vector. Mock: Effectors co-transform tobacco with empty reporters; OE: Effectors co-transform tobacco with C3H39 pro reporters. * denotes p = 0.0001. (c) Analysis of expression patterns of CCCH39 in different tissues. (d) Yeast single hybrid confirmed that PagGRF11 could directly activate the expression of CCCH39. Four yeast reporters were constructed: GARE (TCTGTTG), GARE-3 (TCTGTTCTCTGTTGTCTGTTG), ProC3H39 (CCCH39 promoter sequence length 533 bp), GARE-M (TCCCCCC), and the PagGRF11-AD fusion expression vector was co-transfected into yeast respectively. Growth on SD/-Ura and SD/-Ura-Leu+AbA medium.
Figure 6. Overexpression of PagGRF11 up-regulated CCCH39 expression and resulted in plant dwarfing and increased lignin. (a) Expression level analysis of CCCH39 and GA20ox1-D in PagGRF-OE and control. OE-3: PagGRF11-OE-3, OE-10: PagGRF11-OE-10. (b) Dual-luciferase assay showing the increase of CCCH39 by the PagGRF11 effector construct compared to the control effector construct. Effect: Effect vectors; Reporter:Report vector. Mock: Effectors co-transform tobacco with empty reporters; OE: Effectors co-transform tobacco with C3H39 pro reporters. * denotes p = 0.0001. (c) Analysis of expression patterns of CCCH39 in different tissues. (d) Yeast single hybrid confirmed that PagGRF11 could directly activate the expression of CCCH39. Four yeast reporters were constructed: GARE (TCTGTTG), GARE-3 (TCTGTTCTCTGTTGTCTGTTG), ProC3H39 (CCCH39 promoter sequence length 533 bp), GARE-M (TCCCCCC), and the PagGRF11-AD fusion expression vector was co-transfected into yeast respectively. Growth on SD/-Ura and SD/-Ura-Leu+AbA medium.
Ijms 23 07858 g006
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tian, Y.; Zhao, Y.; Sun, Y.; El-Kassaby, Y.A.; Song, G.; Mi, Y.; Han, J.; Li, Y. PagGRF11 Overexpression Promotes Stem Development and Dwarfing in Populus. Int. J. Mol. Sci. 2022, 23, 7858. https://doi.org/10.3390/ijms23147858

AMA Style

Tian Y, Zhao Y, Sun Y, El-Kassaby YA, Song G, Mi Y, Han J, Li Y. PagGRF11 Overexpression Promotes Stem Development and Dwarfing in Populus. International Journal of Molecular Sciences. 2022; 23(14):7858. https://doi.org/10.3390/ijms23147858

Chicago/Turabian Style

Tian, Yanting, Ye Zhao, Yuhan Sun, Yousry A. El-Kassaby, Guoyong Song, Yueqi Mi, Juan Han, and Yun Li. 2022. "PagGRF11 Overexpression Promotes Stem Development and Dwarfing in Populus" International Journal of Molecular Sciences 23, no. 14: 7858. https://doi.org/10.3390/ijms23147858

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop