Next Article in Journal
The Expression and Function of lincRNA-154324 and the Adjoining Protein-Coding Gene vmp1 in the Caudal Fin Regeneration of Zebrafish
Next Article in Special Issue
Effect of the Interaction between Elevated Carbon Dioxide and Iron Limitation on Proteomic Profiling of Soybean
Previous Article in Journal
Mitogen-Activated Protein Kinases Associated Sites of Tobacco Repression of Shoot Growth Regulates Its Localization in Plant Cells
Previous Article in Special Issue
Local and Systemic Response to Heterogeneous Sulfate Resupply after Sulfur Deficiency in Rice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 16
10.3390/ijms23168943
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Iron Source and Medium pH Affect Nutrient Uptake and Pigment Content in Petunia hybrida ‘Madness Red’ Cultured In Vitro

by
Ge Guo
1,
Jie Xiao
1 and
Byoung Ryong Jeong
1,2,3,*
1
Department of Horticulture, Division of Applied Life Science (BK21 Four), Graduate School of Gyeongsang National University, Jinju 52828, Korea
2
Institute of Agriculture and Life Science, Gyeongsang National University, Jinju 52828, Korea
3
Research Institute of Life Science, Gyeongsang National University, Jinju 52828, Korea
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(16), 8943; https://doi.org/10.3390/ijms23168943
Submission received: 14 July 2022 / Revised: 3 August 2022 / Accepted: 9 August 2022 / Published: 11 August 2022
(This article belongs to the Special Issue Iron and Sulfur in Plants 3.0)
Browse Figures
Versions Notes

Abstract

:
Deficiency or excess of iron (Fe) and improper medium pH will inhibit the growth and development of plants, reduce the transfer and utilization of energy from the root to the leaf, and affect the utilization efficiency of inorganic nutrients. The most common symptom of Fe deficiency in plants is chlorosis of the young leaves. In this study, the effects of the iron source, in combination with the medium pH, on plant growth and development, plant pigment synthesis, and nutrient uptake in a model plant Petunia hybrida cultured in vitro were investigated. Iron sulfate (FeSO4·7H2O) or iron chelated with ethylenediaminetetraacetic acid (Fe-EDTA) were supplemented to the MNS (a multipurpose nutrient solution) medium at a concentration of 2.78 mg·L−1 Fe, and the treatment without any Fe was used as the control. The pH of the agar-solidified medium was adjusted to either 4.70, 5.70, or 6.70 before autoclaving. The experiment was carried out in an environmentally controlled culture room with a temperature of 24 °C with 100 µmol·m−2·s−1 photosynthetic photon flux density (PPFD) supplied by white light emitting diodes (LEDs) during a photoperiod of 16 h a day, 18 °C for 8 h a day in the dark, and 70% relative humidity. Regardless of the Fe source including the control, the greatest number of leaves was observed at pH 4.70. However, the greatest lengths of the leaf and root were observed in the treatment with Fe-EDTA combined with pH 5.70. The contents of the chlorophyll, carotenoid, and anthocyanin decreased with increasing medium pH, and contents of these plant pigments were positively correlated with the leaf color. The highest soluble protein content and activities of APX and CAT were observed in the Fe-EDTA under pH 5.70. However, the GPX activity was the highest in the control under pH 4.70. In addition, the highest contents of ammonium (NH4+) and nitrate (NO3−) were measured in the FeSO4-4.7 and EDTA-5.7, respectively. More than that, the treatment of Fe-EDTA combined with pH 5.70 (EDTA-5.7) enhanced nutrient absorption, as proven by the highest tissue contents of P, K, Ca, Mg, Fe, and Mn. The genes’ ferric reduction oxidase 1 and 8 (PhFRO1 and PhFRO8), iron-regulated transporter 1 (PhIRT1), nitrate transporter 2.5 (PhNRT2.5), and deoxyhypusine synthase (PhDHS) were expressed at the highest levels in this treatment as well. In the treatment of EDTA-5.7, the reduction and transport of chelated iron in P. hybrida leaves were enhanced, which also affected the transport of nitrate and catalyzed chlorophyll level in leaves. In conclusion, when the medium pH was adjusted to 5.70, supplementation of chelated Fe-EDTA was more conducive to promoting the growth and development of, and absorption of mineral nutrients by, the plant and the expression of related genes in the leaves.

1. Introduction

Iron (Fe) is the fourth-most-abundant nutrient on earth, and one of the most important nutrients for biological systems [1,2]. It is involved in the energy generation and utilization of plants and plays an important role in many redox reactions, and the absorption, distribution, and storage of Fe by plants are strictly regulated, so the transfer and absorption of Fe in leaves is the focus of the metabolism of the photosynthetic mechanisms [3]. Fe is primarily present in two forms: ferrous (Fe2+) and ferric (Fe3+). Fe2+ is more soluble and more easily oxidized, forming sediment with inorganic anions [4]. The solubility of Fe3+ decreases with increasing pH, mainly due to the lower solubility of hydroxide polymers, which in most cases cannot satisfy the needs of plants [5]. Since the concentration of free OH– ions exceeds the Fe3+-OH formation threshold at neutral pH, maintaining a reduced pH environment and, thus, providing accessible Fe2+ for metabolic processes is critical [6]. Thus, the variable pH circumstances in a biological system necessitate multiple strategies for Fe–plant-species coordination [3]. Plants have devised two strategies to solubilize Fe. The reduction-based strategy, or so-called strategy I, is observed in most flowering plants. Graminaceous species display the chelation-based strategy, or strategy II [7]. The plants of strategy I take up Fe in roughly three steps: the roots release protons to increase the solubility of Fe3+, the Fe3+ is converted to Fe2+ by ferric chelate reductase (FCR), and then the Fe2+ is absorbed by the roots through the iron-regulated transporters (IRT1) [8]. The plant Fe-absorption system of strategy II synthesizes and secretes mugineic acid (MA) by S-adenosylmethionine (SAM) through an enzymatic reaction [9,10], and the enzymes involved in this synthesis mainly include nicotinamide synthase (NAS), nicotianamine aminotransferase (NAAT), and deoxymugineic acid synthase (DMAS) [11]. The Fe3+ in soils or media forms chelates with MA and is absorbed into cells through yellow stripe-like (YSL) transport.
In the case of Fe deficiency, the photosynthesis of plants is affected, as well as the absorption and accumulation of nutrients, and multiple signaling molecules, such as H2S, ethylene, and nitric oxide (NO), are involved to modulate the deficiency [12,13,14]. As a biologically active free radical, NO participates in and regulates the physiological functions of plants. NO is closely related to the process of Fe absorption, transport, and reoxidation. It can stimulate the Fe chelate reductase, significantly up-regulate the gene expression of ferric reduction oxidase 1 (FRO1) of Fe3+ and transporter IRT1 of Fe2+, thereby increasing Fe absorption and homeostasis [15]. Fe is reduced to the ferrous form at the root surface and transferred to the leaf in a combined form via the xylem. This suggests that the encoded membrane transporter is also active in the aerial parts of the plant, even though MAs are predominantly found in the roots [4]. The acquisition in the plant of Fe and other micronutrients starts in the apoplast of the epidermal cells in roots [16]. The Fe is released into the xylem vessels on behalf of a transfer from symplasm to the apoplast [17,18]. Transporters of ferric–citrate, iron–nicotianamine, or other Fe complexes must moderate Fe absorption from xylem vessels, and photoreduction of the xylem carrying Fe carboxylate appears to play a key role in decreased Fe levels in the aerial parts [19]. The majority of Fe that reaches the leaves are from the Fe absorbed by the roots. The sink-source Fe distribution through the phloem is thought to provide the basis for Fe translocation towards the youngest leaves [20,21].
When plants are Fe-deficient, photosynthesis is affected, and chlorophyll cannot be produced normally; typical Fe-deficiency symptoms are the yellowing of young leaves [1]. In the tetrapyrrole biosynthesis pathway, Fe affects the development of coproporphyrin as well as the formation of chlorophyll [22,23,24]. Moreover, Liu et al. [25] also found that the expression of deoxyhypusine synthase (DHS) protein in P. hybrida was related to photosynthesis, and the chlorophyll level was significantly reduced in DHS-silenced leaves of P. hybrida, showing a chlorotic leaf phenotype. Moreover, Fe deficiency in plants also affects the production and metabolism of carotenoids and anthocyanins. They are synthesized in chloroplasts and play a vital role in the integrity of photosynthetic organs. There is also an inseparable relationship between the anthocyanins and the pH of the substrate [26]. The anthocyanin-production pathway is regulated by transcription factors, such as v-myb avian myeloblastosis viral oncogene homolog (MYB), basic helix-loop-helix (bHLH), etc. [27,28,29,30]. Most of the main biochemical reactions that participate in Fe metabolism are completed in the chloroplast, such that the chloroplast is the Fe pool in the plant cell. Fe deficiency will inhibit the conduction of photosynthetic electron chains in the chloroplast and cause optical damage [31].
More than 70% of the cations and anions absorbed by plants contain ammonium (NH4+) and nitrate (NO3−) [32], and the absorption and accumulation of these two nitrogen (N) sources affect the pH of the plant rhizosphere and apoplast [33], thus influencing the absorption and utilization of Fe. Excessive accumulation of NH4+ in plant cells results in toxicity and decreased photosynthesis, and symptoms such as hindered growth, chlorosis, etc., appear [34]. However, NO3− accumulation in the rhizosphere increases the pH, reduces the Fe reductase activity, and inhibits Fe transport from root to shoot. Plants possess a regulatory system used for coordinating the uptake and distribution of these nutrients. In the cultivation process of A. thaliana, the nitrate and/or glucose supplemented to the medium has been shown to alter the levels of carbon (C) and N metabolic genes [35,36]. Therefore, in this study, the contents of NH4+ and NO3−, and the expression of transport genes were analyzed to explore the indirect effects of Fe and pH on the absorption of NH4+ and NO3− in vitro. During the provision of different contents of NH4+ and NO3−, the uptake and transport of Fe in plants were affected. However, the effects on plant uptake and transport of nutrients in vitro were investigated when the same contents of NH4+ and NO3− were provided, along with different Fe sources and pHs.
The bedding plant P. hybrida belongs to strategy I, has a short growth cycle, and is extensively used as a model plant of developmental biology [37]. P. hybrida is an Fe-inefficient plant that is sensitive to neutral and high pH [38] and responds by reducing the Fe uptake, which generates chlorosis and growth retardation [39]. Moreover, petunia is also very sensitive to the surrounding NH4+ and NO3− [40,41]. In some previous studies, the effects of the Fe source and pH on the growth of shrub ornamental plants Sorbus commixta [42] and Hydrangea macrophylla [43], as well as the regulation of Fe-handling gene expressions, were studied. Moreover, in previous studies, more attention was paid to the effects of the NH4+ and NO3− supply on the Fe absorption of plants, while studies seldom discussed the effects of different Fe sources and pH on plant ammonium and nitrate contents. Therefore, in this study, by providing different Fe sources and pH levels to P. hybrida, we investigate the effects on the growth characteristics, pigment contents, NH4+ and NO3− contents, and their gene expressions.

2. Results

2.1. Plant Morphological and Growth Parameters

The P. hybrida plants were cultured in a growth container for 10 days. The morphology of P. hybrida is shown in Figure 1 and Table 1. The morphological characteristics of P. hybrida were affected by the Fe source and pH level. In the treatment with high pH among these Fe sources, plants showed obvious chlorosis of leaves, which was the most serious at pH 6.70. The shoot length was the greatest in the control (no Fe) at pH 5.70 (6.3 mm) (control-5.7). The shoot length decreased with an increase in pH after supplying FeSO4 and Fe-EDTA. The greatest root length was observed in EDTA-5.7. The greatest shoot fresh weight (FW) was observed when the pH was 5.70 in the control. When the pH was 4.70 in FeSO4 (FeSO4-4.7) and Fe-EDTA (EDTA-4.7) treatments, the FW was greater than in other pH levels. The FW of roots was the greatest when the pH was 5.70, followed by pH 4.70 and 6.70. According to the results of the F-test in Table 1, the Fe source and pH affected the growth characteristics of the shoots and roots.

2.2. Leaf Color and Pigment Contents

At the end of the experiment, the leaf color of three biological replicates of each treatment was identified by the color reader, and the coefficient differences of red (R), green (G), and blue (B) of each treatment in Table 2 were obtained according to the Munsell color system. Leaf color reflects the pigment contents of leaves. In the evaluation of the RGB chromatography, the RGB is a theory of light color mixing, where the value range of R, G, and B is between 0 to 255 [44]. The brighter the color of the leaves was observed to be, the greater the numerical value. When the pH was 6.70, the leaves were chlorotic. The same trend was also reflected in the pigment contents of leaves (Figure 2). When the pH of each Fe source was 4.70, the contents of chlorophyll, carotenoid, and anthocyanin were the highest among the three pH levels. At pH 6.70, these contents were the lowest.
According to Pearson’s correlation analysis results in Table 3, there is a positive correlation among the R value, the G value, and the B value, and there is also a positive correlation between the plant pigment contents in leaves. However, there is a negative correlation between each RGB factor and the plant pigment contents, thus resulting in smaller RGB values (deeper color) that correspond to higher pigment contents. Simultaneously, the values of the correlation were closer to −1 or 1, indicating greater significance of the correlation.

2.3. FCR Activity in Roots

The FCR activity was affected by the Fe source and pH (Figure 3). The pH level in combination with FeSO4 significantly affected the FCR activities, and the FCR activity decreased with increasing pH, resulting in the highest FCR activity in FeSO4-4.7. However, the FCR activity was not affected by the pH in the control and in plants supplied with Fe-EDTA, although the FCR activities were significantly lower in treatments with Fe-EDTA than in the control.

2.4. Soluble Protein Contents and Antioxidant Enzyme Activities

The soluble protein content was significantly different among the treatments. The soluble protein content with Fe-EDTA treatments was generally higher, and when the pH was 5.70, the greatest soluble protein content (15.5 mg·g−1) was observed (Figure 4A). The antioxidant enzyme activities were significantly affected by the Fe source and pH. The maximum guaiacol peroxidase (GPX) activity was observed in control-4.7 (0.046 U·µg−1), while higher activities in the control group and the group with Fe-EDTA corresponded to a lower pH (Figure 4B). According to Figure 4C, the greatest ascorbate peroxidase (APX) activity was observed in EDTA-5.7 (0.127 U·µg−1), while in plants grown with FeSO4, the highest activity was observed in pH 6.70. Similar to the results of APX activity, the highest catalase (CAT) activity was observed in EDTA-5.7 (0.058 U·µg−1), as shown in Figure 4D. The greatest superoxide dismutase (SOD) activity was observed at pH 6.70 in the control and treatments with FeSO4 and at pH 4.70 with Fe-EDTA (Figure 4E).

2.5. NH4+ and NO3− Contents

According to Figure 5, the Fe source and pH had significant effects on the contents of NH4+ and NO3− in P. hybrida leaves. In the control and FeSO4 groups, the highest content of NO3− was measured at pH 6.70. For Fe-EDTA, the highest content of NO3− was observed at pH 5.70. The lowest NO3− content was observed at pH 6.70 with Fe-EDTA, whereas the control and FeSO4 had the greatest NO3− content at pH 6.70. In Figure 5A, the variation of the NH4+ content was influenced by the medium pH. Therein, FeSO4-4.7 had the highest content (35.34 µmol·g−1) among all treatments, and the lowest content was measured in control-5.7 (12.36 µmol·g−1).

2.6. Contents of Macronutrients and Micronutrients in Leaves

As shown in Table 4, the Fe source and pH level directly affected the uptake of nutrients in P. hybrida. In the control and FeSO4, lower pH levels corresponded to higher Fe contents. On the other hand, the Fe content was the greatest at pH 5.70 in the Fe-EDTA and the lowest at pH 4.70. The efficient Fe uptake also promoted the uptake of other nutrients. In EDTA-5.7, which contained the highest Fe content, the contents of micronutrient manganese (Mn) and macronutrients phosphorus (P), potassium (K), calcium (Ca), and magnesium (Mg) were also the greatest.

2.7. Correlation Analysis of Pigments with Fe Content, Growth Parameters, and Nutrient Contents in Leaves

Table 5 and Table 6 show the correlation among the contents of three pigments, growth parameters of shoots, and 12 nutrient contents. The Fe content had a positive correlation with the contents of carotenoid, and had a significant positive correlation with chlorophyll and anthocyanin (Table 5). However, there was no significant correlation between Fe content and the number of leaves or between the length and FW of shoots (Table 6). There was a very significant negative correlation between shoot DW and Fe content. In addition, there is also a very significant negative correlation between DW and contents of Zn, Cu, Mn, Ca, Mg, and K, indicating that the higher contents of these nutrients in shoots corresponds to a lower DW and a higher water content. The contents of Mn, Ca, K, and P had a very significant positive correlation with the number of leaves, indicating that higher contents corresponded to a greater number of leaves. The Fe content had a positive correlation with the contents of other nutrients except sulfur (S), and had a very significant positive correlation with contents of Cu, Mn, Ca, Mg, K and P. In the correlation results between NH4+ and NO3−, NH4+ was significantly negatively correlated with NO3−, while both were not significantly positively correlated with the Fe content. This indicated that there were no significant direct relationships between the Fe content and the NH4+ and NO3− contents in P. hybrida leaves. The correlation values were closer to −1 or 1, indicating a greater significance of the correlation.

2.8. Expressions of Fe, Pigments, and N Transporter Genes

The relative expression levels of genes were significantly different according to the treatments (Figure 6). The expression levels of one gene related to Fe-regulated transporter (PhIRT1) (Figure 6A), two genes related to ferric reduction oxidase (PhFRO1 and PhFRO8) (Figure 6B,C), one gene related to ammonium (PhNRT2.5) (Figure 6D) and one gene related to nitrate transport (PhAMT1;1) (Figure 6E), one gene related to myb domain protein (PhMYB113) (Figure 6F), and one gene related to deoxyhypusine synthase (PhDHS) (Figure 6G) were investigated in this study. All the highest relative expression of gene levels were observed in the treatment with Fe-EDTA, except for PhAMT1;1 and PhMYB113. The highest relative expression levels of PhAMT1;1 were observed in EDTA-4.7. The highest relative expression levels of PhFRO1, PhFRO8, PhIRT1, PhNRT2.5, and PhDHS were observed in EDTA-5.7. However, the highest relative expression level of PhMYB113 was observed in control-4.7, followed by EDTA-5.7.

3. Discussion

Higher plants mainly uptake Fe by the root system. On account of a strong demand for Fe, the photosynthetic system will be established and manipulated in the chloroplast of the photosynthetically active tissue, and Fe is transported from the roots to leaves. Petunia is an Fe-inefficient plant that is sensitive to an environment of neutral or high pH, which would result in reduced Fe uptake, followed by appearance of chlorosis and growth inhibition [45,46]. This was also confirmed in this study (Figure 1), as leaves of petunia showed obvious chlorosis at high pHs. The Fe homeostasis in leaves depends on the binding of Fe to cofactors of oxidoreductases, and the developmental system of plants also determines the direction of the Fe distribution in leaf cells [3]. In this study, the effects of the Fe source and different medium pH on the plant growth and development of P. hybrida were obvious. According to the growth parameters in P. hybrida (Table 1), the plants with the highest number of leaves were observed at pH 4.70 regardless of the Fe source, including the control group. The pH affects the substance solubility and nutrient availability for plants. It is also confirmed in this study (Table 6) that the number of leaves has a significant positive correlation with the contents of Mn, Ca, K, and P in leaves. At the same time, it was also found that there was a significant regularity between the pH of the medium and the number of leaves and the content of these elements (Table 1 and Table 4). Among the iron sources, high pH corresponds to a lesser number of leaves and the content of these nutrient. H+ as a cation will exchange positions while competing with other cations. The metal availability is often inhibited, and micronutrient deficiencies are generated for plants in alkaline soils [47]. Moreover, the solubility of Fe under different pH levels also changes. In neutral pH media, Fe exists in the form of ferric Fe and most of the Fe3+-OH complexes are cross-linked into insoluble ferrihydrite polymers, therefore, the Fe ion content in the medium is extremely low [48]. The solubility of FeSO4 is higher at lower pH (below 5.5), and the solubility of FeSO4 decreases with the increase in the pH [49]. Fe-EDTA, a chelated Fe, is unstable at high pH; it is relatively stable at a pH lower than 6.0, and highly unstable when at a pH higher than 6.5. That explains why in Table 1, when the Fe source was Fe-EDTA, the leaf length and root length of P. hybrida were the greatest at pH 5.70.
In strategy I plants, reduction of Fe chelates is carried out by FCR, and plants are more likely to reduce Fe with weak Fe3+-chelates. In some Fe-sensitive species (such as Vaccinium spp. and Annona glabra), low FCR activity was found in acidic soils with high organic matter and Fe2+, where these conditions are more favorable for Fe uptake [50]. Following the FCR-mediated reduction, Fe2+ is transported through the plasma membrane into the roots [51]. Strategy I plants upregulate the expression of FCR enzymes when the Fe content of the medium is limited, while increasing the pH level will enhance the FCR activity [52,53], which was similar to the findings in Figure 3. The FCR activity was the highest in control-6.7 (pH is greater than 6.5) among the three pH levels in the control, because the Fe level in the medium affects the root response mechanisms to improve the Fe uptake [54]. The excess Fe2+ produced by FCR is re-oxidized by the electron acceptor, but the chelating agent can be re-oxidized by the catalysis of Fe3+-chelate [55]. Furthermore, the Fe availability affects the natural distribution of species and limits the growth of important commercial crops. To prevent the potential high Fe toxicity to plants [56], plants have evolved a series of protective mechanisms that bind Fe and proteins. Plants will reduce Fe uptake by reducing the FCR activity when the Fe content in the medium is excessive; for example, in Spinacia oleracea and Brassica oleracea, the FCR activity of roots decrease with increasing Fe content [57]. The Fe content in the Fe-EDTA was high on account of Fe-EDTA reducing Fe to Fe2+ by the reaction of metal charge transfer (Table 4) [58,59]. Therefore, the Fe-EDTA group showed a lower overall FCR activity.
Among the extensive range of metal transporters in plants, NRAMP (natural resistant-associated macrophage protein), YSL (yellow stripe-like), and ZIP (zrt- and irt-related protein) families are thought to participate in the Fe transport [60]. As a member of the ZIP family, IRT1 is capable of compensating for some defects in the Fe uptake, and IRT2 is also a homologue of the ZIP family [61]. IRT1 and IRT2 uptake ferrous Fe from the medium in Fe deficiency, and its gene expression is induced in the roots as a part of the Fe-deficiency response [62,63]. In Fe-deficient A. thaliana, Fe and other metals are absorbed by AtIRT1 from the medium to regulate Fe homeostasis, and AtIRT1 is highly expressed in the epidermal region of the roots [64] (in strategy I plants, the expression of proton pumping, Fe chelate reductase, and IRT1 are all significantly increased when Fe is deficient) [65]. In the EDTA-5.7 treatment in this study, the expression level of PhIRT1 in P. hybrida leaves was 6947 times higher than that in the control (Figure 6A), which may be because when the ligand inside plants is binding to metal cations, the high mobility relative to the lower affinity of the chelated Fe is at a negative location of cell membranes and vessels [66]. It was also found that in Zea mays, chelating agents such as EDTA or DTPA will increase the Fe transport in leaves. Brian et al. [67] discovered that the expression of FRO1 was low in the Fe-rich leaves of Pisum sativum, while the expression of FRO1 was increased in the Fe-deficient leaves [68]. The highest PhFRO1 expression and Fe content were observed in EDTA-5.7 in this study (Figure 6B); before uptake of Fe3+ by leaf cells, FRO1 participated in the process of composite reduction of Fe3+ to Fe2+ [67,69]. FRO8, which is also a chelate Fe reductase, exists in the mitochondria of cells, mainly acts on Fe reduction during shoot senescence [70], and also participates in the reduction of Fe3+ to Fe2+. Simultaneously, the highest expression of PhFRO8 was observed in EDTA-5.7 (Figure 6C).
The plant pigment contents in leaves are closely related to the physiological function of leaves, which can provide a valuable insight into the physiological functions of leaves. According to the contents of total chlorophyll (chlorophyll a and b), carotenoids, and anthocyanins in Figure 2, the contents of these photosynthetic pigments and secondary metabolites were influenced by the Fe source and medium pH. However, the effects of the medium pH were stronger than that of the Fe source. As shown In Figure 1 of this study, when the pH was 6.70, the leaves were chlorotic. The same trend was also observed in the pigment contents in leaves. This is similar to the results of Smith et al. [38,39], where when the pH of the substrate was increased from 5.0 to 6.0, the contents of the total chlorophyll and carotenoids in leaves of P. hybrida ‘Priscilla’ decreased, chlorosis appeared after 2 weeks, and, when the pH of the medium was raised to 7.0, the contents of total chlorophyll and carotenoid decreased significantly. Chlorosis of young leaves in general is the first visual phenomenon of Fe deficiency. It is associated not only with the damage of chlorophyll but also with changes in the expression and assembly of other components of the photosynthetic organ [71]. In photosynthetic cells, approximately 80% of the Fe is a key determinant in the formation of prosthetic groups in enzymes [72]; the Fe content plays a role in a variety of vital plant activities such as chlorophyll production, electron transport between PSI and PSII, and maintenance of the structure and function of the chloroplast [73].
The function of chloroplasts depends on the plastid and nuclear genomes of proteins encoded, and a normal development of chloroplasts is associated with the leaf color [74,75]. The DHS proteins localized in the cytoplasm and nucleus affect the chlorophyll levels in leaves, and in Solanum lycopersicum and Nicotiana tabacum L., the formation of deoxyhypusine residues is catalyzed by DHS, which plays a role in chloroplast development [76]. Liu et al. [25] observed that in DHS-silenced leaves in petunia, the chloroplast development had abnormal and reduced chlorophyll levels and activity of photosystem II. However, in our study, the highest expression of the DHS gene appeared in EDTA-5.7, where the chlorophyll content and chlorosis state were about the median among all the treatments; it is, therefore, speculated that the DHS expression is more related to the pH. Fe reacts to the porphyrin structure of chlorophyll, the main component of the chloroplast. A famous function of the cytochrome is electron transfer, and cytochrome oxidase is involved in the last step of the respiratory chain [77]. The ratio of condensation for glycine and succinyl-CoA synthesis of ALA (delta-aminolevulinic acid) is reduced when plants are Fe-deficient. At that time, the photosynthetic system remains intact, but the number of photosynthetic units decrease [78]. Nenoval et al. [79] found that excess Fe can increase the pigment contents in pea leaves by at least 28%. The relationship between the chlorophyll content and spectral index is also affected by other pigments [26]. The anthocyanin content tends to be higher in young leaves with low photosynthetic rates [80], and metal ions and pH can alter the anthocyanin color in vitro but only play a minor role in vivo. The biosynthesis of anthocyanins is mainly regulated by several transcription factors in the R2R3-MYB family, of which MYB113 mainly regulates the anthocyanin expression in mature leaves [81]. Several research data indicated that anthocyanin synthesis is enhanced when the MYB113 gene is overexpressed in A. thaliana [30]. It was confirmed in our study that the control-4.7 treatment with the highest expression of PhMYB113 (Figure 6F) also resulted in the greatest anthocyanin content (Figure 2C), indicating that the PhMYB113 expression of the control group corresponded to the anthocyanin level. However, in treatment groups with FeSO4 and EDTA, the expression of PhMYB113 was the highest at pH 5.70. Since nutrients affect the synthesis of anthocyanins and also activate or inhibit the expression of transcription factors [82], it is speculated that the Fe source and pH affect the expression of PhMYB113. In vegetative tissues, anthocyanins are considered important photosynthetic antioxidants [83,84]. When plants are deficient in anthocyanins, photoprotection is achieved through an alternative mechanism [85]. Therefore, the change in the anthocyanin content often also represents the diversity of antioxidants [86]. In the antioxidant processes of plants, H2O2 is oxidized by SOD and then scavenged by GPX, POD, and CAT. Under the influence of Fe and ROS, the activities of GPX, POD, and POD change accordingly [87]. As shown in Figure 2, the pH affects Fe absorption, resulting in reduced anthocyanin content with Fe deficiency.
Several steps of biosynthesis are dependent on Fe. Fe-deficiency chlorosis severely affects crop quality and production. Meanwhile, chlorosis caused by Fe deficiency in a high pH environment is generally ameliorated by other approaches, such as acidification of the medium or the use of amino-based fertilizers, to lower the pH to achieve higher solubility of microelements [45,88]. At the same time, the results of other research indicate that the correlation between the Fe concentration and chlorophyll content is not always the same, as in the case of chlorosis caused by Fe deficiency, and the Fe concentration in chlorotic leaves may be higher than that in non-chlorotic leaves. When the pH is too high, Fe can be fixed in the free space of leaves [89]. The Fe source and pH not only affect the plant pigment content but also the macronutrient and micronutrient contents [90]. Floral crops cultivated under soilless conditions are commonly cultivated with a medium pH range, usually controlled between 5.6 and 6.2. In the leaves of plants, the availability of nutrients correlates with the water solubility of the applied compound [66]. The solubility of nutrients is controlled by the pH. When the pH increases, the solubility of the microelements in the medium decreases, and oxyphilous plants appear as a nutrient-deficiency symptom. Meanwhile, when Fe-efficient plants such as Pelargonium hortorum and Tagetes erecta L. are grown in a low-pH medium with high solubility of Fe and Mn, elemental poisoning occurs, thereby generating necrosis in plants [45]. The high pH of the medium also restricts Mn uptake, and the symptoms of Mn deficiency are similar to those of Fe deficiency [91]. As shown in Table 4, in the control and FeSO4 groups, low Mn content corresponded to a high–medium pH. According to the results of Abadia et al. [92], when the leaves of Prunus persica L. appear to be chlorotic, the content of K ions increases, while the content of Ca ions in the leaves decreases, thereby the value of K/Ca is increased. However, as shown in Figure 1 and Table 4, chlorosis of leaves was obvious with the increase in the pH, and the content of K and Ca ions also decreased, especially in the control and FeSO4 groups. It has been reported that the reduction of chlorophyll is not always due to Fe deficiency but may also be related to the dilution effect of leaves, and the appearance of chlorosis is not necessarily directly related to the nutrient contents.
In addition, N is also an important mineral nutrient for crops, and an important factor for plant growth and development [93]. Some important organic compounds in plants are inseparable from N, such as proteins, chlorophyll, alkaloids, etc. [41]. N is mainly dissolved in the form of NH4+ and NO3−, then absorbed by the roots of plants [94]. A large proportion of NO3− and a fraction of NH4+ are directly transferred to the leaves, and the remainder is assimilated [94,95]. The absorption of NO3− and NH4+ significantly affected the pH of the rhizosphere and apoplast, thereby affecting the absorption and utilization of Fe by plants [96]. As shown in Figure 5 and Table 6, the nutrient contents interact with each other in P. hybrida leaves. In the control group under Fe deficiency, lower pH corresponded to lower NO3− contents, because the increase in pH increased the NO3− content, while reducing the activity of Fe3+ reductase, thereby inhibiting the transport of Fe from roots to shoots [97,98]. In the treatment with FeSO4 or chelated iron EDTA, due to supplementation of Fe2+ or Fe3+, the interaction effect and absorption by leaves of nutrients were changed. The N uptake of plants is mainly determined by specific genes, such as the nitrate transporter NRTs and ammonium transporter AMTs [99]. The regulation of the NRT and AMT expressions are affected by N metabolites, light, pH, sucrose, etc. [100,101]. Among them, NRT2.5 is a high-affinity nitrate transporter that is localized in the plasma membrane and mainly expressed in the epidermis of root hairs and leaves [102]. As shown in Figure 6D, in the control group, the expression level of PhNRT2.5 was lower than that in the FeSO4 and EDTA groups, and the highest expression level was observed in EDTA-5.7. In addition, the overexpression of AMT1 will increase the absorption of ammonium by plants, but, with sufficient ammonium content, AMT1 will reduce the biomass of the aboveground parts in order to reduce ammonium toxicity [94]. As shown in Figure 6E, the expression of PhAMT1;1 in the control group was the lowest and was affected by the pH, with high pH corresponding to high expression. The highest expression of PhAMT1;1 was observed in the EDTA group, and the expression decreased with increasing pH. Therefore, we judged that under the synergistic effects of Fe and pH, the uptake and contents of NO3− and NH4+ were affected in P. hybrida leaves.

4. Materials and Methods

4.1. Seed Materials and Sterilization

The bedding plant seeds of Petunia hybrida ‘Madness Red’ were purchased from PanAmerican Seeds (West Chicago, IL, USA). The seeds were washed with running tap water for 1 h to wash off the coating, then put into glass beakers with 0.3% (v/v) Tween 20 solution and stirred for 3 h using a blender. The seeds were subsequently rinsed with sterilized distilled water (SDW) 7 times. The seeds were then transferred to a sterilized container, and the surfaces of the seeds were sterilized with 70% (v/v) ethanol for 1 min and 0.5% (v/v) sodium hypochlorite (NaClO) for 5 min. Finally, the seeds were rinsed with SDW 5 times before culture.

4.2. Seed Germination and Culture Conditions

The surface-sterilized seeds were cultured in a multipurpose nutrient solution (MNS) medium for germination [103]. The medium contained 3.0% (w/v) sucrose and 0.80% (w/v) agar, and the pH was adjusted to 5.80. Then, 50 mL of the medium was dispensed to each container (Cat. No. Gaooze-0811C, Korea Scientific Technique Industry, Suwon, Korea) before being sterilized in an autoclave at 121 °C for 15 min. A total of 15 seeds were sown in each container and placed in the culture room with a temperature of 24 °C and relative humidity of 70%, and a 16 h photoperiod, provided at 100 µmol·m−2·s−1 photosynthetic photon flux density (PPFD) by white fluorescent light (40 W tubes, Philips, Eindhoven, The Netherlands).

4.3. Experimental Design of the Fe and pH Treatments

The seeds of P. hybrida were germinated and cultured in the MNS medium for 15 days, after which the plantlets were transplanted to the media with the Fe treatments. The composition was (in mg·L−1): Ca(NO3)2·4H2O 436.6, KNO3 232.3, KH2PO4 272.0, MgSO4·7H2O 209.1, NH4NO3 80.0, K2SO4 17.4, H3BO3 1.40, CuSO4·5H2O 0.20, MnSO4·4H2O 2.10, Na2MoO4·2H2O 0.12, and ZnSO4·7H2O 0.80, containing 3.0% (w/v) sucrose and 0.80% (w/v) agar. The iron sulfate (FeSO4·7H2O) or iron chelated with ethylenediaminetetraacetic acid (Fe-EDTA) were used as the Fe sources, according to the protocol of Xiao et al. [42] with a final Fe content of 27.8 mg·L−1 in the MNS medium, and the treatment without Fe was used as the control. Before autoclaving, the pH of the medium was adjusted to 4.70, 5.70, or 6.70 with 1 M NaOH or HCl. Each treatment was repeated three times.

4.4. Measurements of the Growth Parameters

After 10 days, the length of the shoots and roots were examined. The FW of the shoots and roots was measured with a precision electronic balance (NTRIS224I-1S, Sartorius, Gottingen, Germany). Before the dry weights (DW) were measured, the shoot and root samples were dried in a forced convection oven (AAH12245K, Jeio Tech. Co., Ltd. Daejeon, Korea) at 60 °C for 72 h. The leaf-color data were collected with a color reader (CR-11, Konica Minolta Co., Ltd. Osaka, Japan). The obtained Munsell chromatographic data were converted into RGB chromatographic data using an online tool (https://pteromys.melonisland.net/munsell/) (accessed on 7 February 2022), and after obtaining the average of at least 3 biological replicates, the RGB chromatographic data were converted into an exclusive serial number of HEX chromatographic data online (https://www.rgbtohex.net/) (accessed on 7 February 2022).

4.5. Contents of Chlorophyll, Carotenoid, and Anthocyanin

The extraction solution was formed overnight using a 1 cm2 area of the leaf tissue soaked in 80% (v/v) acetone. Then, a UV spectrophotometer (Libra S22, Biochrom Ltd., Cambridge, UK) was used to evaluate the absorbances of the extraction solution at A470nm, A645nm, and A662nm. The contents of chlorophyll a, b, and carotenoid were measured according to the protocol of Sukran et al. [104]. The total anthocyanin was also evaluated using a UV spectrophotometer, according to the protocol of Pirie and Mullins [105].

4.6. Determination of the FCR Activity

The root FCR activity was measured based on the methods of Biengait et al. [106] and Chaney et al. [107]. The fresh roots from each treatment were washed clean of the residual solid medium, immediately put into the saturated stationary CaSO4 solution for 5 min, rinsed with SDW 2–3 times, wiped to remove the surface moisture, and put into a 15 mL FCR reaction solution [0.1 mM Fe-EDTA and 0.4 mM 2,2′-Dipyridyl, pH 5.3]. A solution sample without roots was used as the control, and all samples were incubated in the dark at 24 °C for 1 h. The absorbance of the reaction solution at A520nm [1 mM Fe(dipyridyl)3 at A520nm = 8.650] was measured and calculated with a UV spectrophotometer.

4.7. Soluble Protein Content and Antioxidant Enzyme Activity Assays

After 10 days, leaves of P. hybrida were separated from plantlets and frozen in liquid nitrogen immediately. The leaf tissues from different treatments were ground into a fine powder with liquid nitrogen and stored at −80 °C until the next analysis. The activities of antioxidant enzymes guaiacol peroxidase (GPX), catalase (CAT), ascorbate peroxidase (APX), and superoxide peroxidase (SOD) were measured according to Manivannan et al. [108]. Then, 0.10 g fine powder samples were homogenized with 100 mM phosphate-buffered saline (PBS) solution for the GPX assay and homogenized with 50 mM PBS solution to measure the activities of CAT, APX, and SOD. A 50 mM PBS solution containing 1 mM ethylenediaminetetraacetic acid (EDTA), 1 Mm polyvinylpyrrolidone (PVP), and 0.05% triton-X at pH 7.0 was used. The mixtures were centrifuged at 4 °C for 20 min at 13,000 rpm, then the supernatants were transferred to a new 1.5 mL microtube to analyze the soluble protein contents and activities of the antioxidant enzymes. The unit·µg−1 was used to represent the specific enzyme activity. The enzymes that induced a 0.01 per minute increase was determined as one unit of GPX activity. The enzymes required to reduce 1 µM of H2O2 for each minute was defined as one unit of CAT activity. The enzyme activity catalyzing the oxidation of 1 µM ascorbic acid each minute was defined as one unit of APX activity. The quantity that causes a 50% inhibition of the initial rate of nitro blue tetrazolium (NBT) degradation was determined as one unit of SOD activity.

4.8. Contents of NH4+ and NO3−

The NH4+ and NO3− concentrations in leaves were analyzed based on the methods of Bräutigam et al. [109] and Huang et al. [110]. The NH4+ concentration was analyzed by a colorimetric method based on the Berthelot reaction [109]. The 0.10 g fine powder of frozen leaf tissues was homogenized with an extraction solution containing 1 mL 0.1 M of HCl and 500 µL of chloroform and shaken at 4 °C for 15 min and then centrifuged for 5 min at 12,000 rpm (4 °C). Then, the supernatants were transferred to a new microtube containing 50 mg of activated charcoal and then centrifuged for 5 min at 12,000 rpm (4 °C) after homogenization. The supernatants were analyzed for the NH4+ concentration with a UV-spectrophotometer at A620nm. For the NO3− concentration, 0.10 g fine powder of frozen leaf tissues was extracted with 1 mL DW (deionized water) and incubated at 45 °C for 1 h. After centrifugation for 15 min at 5000 rpm (20 °C), 0.2 mL of the supernatant was transferred to a 30 mL glass tube and mixed with 0.8 mL 5.0% (w/v) salicylic acid in concentrated sulfuric acid. The solution was incubated for 20 min, and 19 mL of 2.0 M sodium hydroxide was then added to raise the pH of the solution to more than 12. After the solution was cooled to room temperature, the concentrations of NO3− were analyzed with a UV-spectrophotometer at A410nm.

4.9. Macronutrient and Micronutrient Contents

The macronutrient and micronutrient contents were analyzed based on the methods of Zhang and Dotson [111]. The dry weight of the leaf samples was measured, and the leaves were then ashed for 4 h in a Nabertherm muffle furnace (Model LV 5/11/B180, Lilienthal, Breman, Germany) at 525 °C. The ashes of the leaves were dissolved in 1 mL of 25% HCl (hydrochloric acid), then dissolved in 2 mL of hot distilled water, and 3 mL of normal temperature distilled water was added. The total mixture (6 mL) was filtered through a quantitative filter paper (Cat no. 02005110, Hyundai Micro Co., Ltd., Seoul, Korea), and the macronutrient and micronutrient contents of mixture were analyzed with an inductively coupled plasma (ICP) spectrometer (Optima 4300DV/5300DV, Perkin Elmer, Baesweiler, Germany). Three biological replicates were performed for each treatment.

4.10. Quantitative RT-PCR Analysis

The RNA of the leaf tissues was extracted with the TRIzol Reagent (Cat no. 15596026, Invitrogen, Carlsbad, CA, USA) in accordance with the standard protocols of the manufacturer. Briefly, 0.1 g frozen powder of leaf tissues was ground with 1.0 mL TRNzol to homogenize, and the homogenate was transferred to a 1.5 mL tube (RNA-free), incubated for 10 min at room temperature, then centrifuged at 4 °C, 12,000 rpm for 11 min. The supernatant (0.8 mL) was transferred to a new 1.5 mL tube, to which 0.2 mL chloroform was added, mixed thoroughly, and centrifuged at 4 °C, 12,000 rpm for 11 min. Next, 0.4 mL of the supernatant was transferred to a new 1.5 mL tube, and an equal volume of isopropanol was added, then the mixture was inverted several times to mix and incubated at −20 °C. After 3 h of incubation, these samples were centrifuged at 4 °C with 12,000 rpm for 11 min. The supernatant was discarded with a pipette, 0.9 mL 75% (v/v) ethanol was added and mixed well with the pellet at 4 °C, 12,000 rpm for 11 min, and the process was repeated twice. Finally, the pellet was dried for 10 min at room temperature, dissolved with 20 µL ddH2O (double distilled water), then kept at −80 °C for further work.
A NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to evaluate the quality of the RNAs. The RNAs were reverse-transcribed cDNA using the PrimeScript kit (Cat no. RR047A, Takara, Shiga, Japan) in accordance with the protocols of the manufacturer.
The target genes following FRO1, FRO8, IRT1, NRT2.5, AMT1, MYB113, and DHS were chosen from the DNA sequence of A. thaliana (Table 7). The CDS sequences of these target genes were found on the National Center for Biotechnology Information ‘https://www.ncbi.nlm.nih.gov/’ (accessed on 10 February 2022) and then compared with the draft genome sequence of Petunia axillaris: ‘https://solgenomics.net/organism/Petunia_axillaris/genome’ (accessed on 10 February 2022), before determining the gene expression levels. The primers are shown in Table 8. The gene expression was analyzed by SYBR Green Master Mix kit and quantitative real-time PCR (RT-PCR) was performed on a CFXconnect system (Bio-Rad, Hercules, CA, USA). The reaction system (10 µL) contained 1 µL of cDNA (100 µM), 1 µL of each primer (10 µM), 2 µL of ddH2O, and 5 µL of SYBR Green Master Mix. The melting temperature of gene-specific primers was designed to be 55 °C. The PhActiin11 gene was selected as a reference and the data were analyzed using the 2−∆∆Ct method. For each treatment, three biological replicates were employed.

4.11. Data Analysis

The analysis of variance (ANOVA) was used to evaluate significant differences between the treatments using the PROC ANOVA function in SAS (SAS, version 8, SAS Institute Inc., Cary, NC, USA). First, Fe pH was considered one-way, then the Duncan’s multiple range testing was conducted at a 5% probability level. Second, pH, Fe, and their interaction (A × B) were also analyzed. The analysis graphics were drawn with the OriginPro 9.0 software (OringinLab Co., Northampton, MA, USA).

5. Conclusions

The results of our study showed that the Fe source and medium pH affected the growth and development of P. hybrida. The Fe increased the leaf width, shoot fresh and dry weights, and root dry weight of P. hybrida. The contents of chlorophyll, carotenoids, and anthocyanins, as well as leaf color, regardless of the Fe source, were significantly affected by the pH, and the results decreased with increasing pH. The highest soluble protein content and activities of APX and CAT were observed in the Fe-EDTA under pH 5.70. In addition, the highest contents of NH4+ and NO3− were measured in the FeSO4-4.7 and EDTA-5.7, respectively. When the Fe source was Fe-EDTA, pH 5.70 of the medium was the most beneficial for nutrient uptake of P. hybrida. The gene-expression results of P. hyrida revealed that the greatest relative gene expressions of PhIRT1, PhFOR1, PhFRO8, PhNRT2.5, and PhDHS were obtained with Fe-EDTA, pH 5.70. In the treatment of EDTA-5.7, the reduction and transport of chelated iron in P. hybrida leaves were enhanced, which also affected the transport of nitrate. In conclusion, when the medium pH was adjusted to 5.70, supplementation of chelated Fe-EDTA was more conducive to promoting the growth and development of, and absorption of mineral nutrients by, the plant, and expression of related genes in leaves. Therefore Fe-EDTA was more conducive to the growth and development of P. hybrida at pH 5.70.

Author Contributions

Conceptualization, B.R.J.; methodology, B.R.J. and G.G.; software, G.G.; validation, B.R.J.; formal analysis, B.R.J. and G.G.; investigation, G.G. and J.X.; resources, B.R.J.; data curation, G.G. and J.X.; writing—original draft preparation, G.G.; writing, review and editing, B.R.J., G.G. and J.X.; visualization, G.G.; supervision, B.R.J.; project administration, B.R.J. and G.G.; funding acquisition, B.R.J. and G.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding. Ge Guo and Jie Xiao were supported by the BK21 Four Program, Ministry of Education, Republic of Korea.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data sharing is not applicable to this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Miller, G.; Pushnik, J.; Welkie, G. Iron chlorosis, a world wide problem, the relation of chlorophyll biosynthesis to iron. J. Plant Nutr. 1984, 7, 1–22. [Google Scholar] [CrossRef]
  2. Abadia, J. Leaf responses to Fe deficiency: A review. J. Plant Nutr. 1992, 15, 1699–1713. [Google Scholar] [CrossRef] [Green Version]
  3. Sági-Kazár, M.; Solymosi, K.; Solti, Á. Iron in leaves: Chemical forms, signalling, and in-cell distribution. J. Exp. Bot. 2022, 73, 1717–1734. [Google Scholar] [CrossRef]
  4. Hell, R.; Stephan, U.W. Iron uptake, trafficking and homeostasis in plants. Planta 2003, 216, 541–551. [Google Scholar] [CrossRef]
  5. Schmidt, W. Mechanisms and regulation of reduction-based iron uptake in plants. New Phytol. 1999, 141, 1–26. [Google Scholar] [CrossRef]
  6. Seregin, I.V.; Kozhevnikova, A.D. Low-molecular-weight ligands in plants: Role in metal homeostasis and hyperaccumulation. Photosynth. Res. 2021, 150, 51–96. [Google Scholar] [CrossRef]
  7. Ricachenevsky, F.K.; Sperotto, R. There and back again, or always there? The evolution of rice combined strategy for Fe uptake. Front. Plant Sci. 2014, 5, 189. [Google Scholar] [CrossRef] [Green Version]
  8. Hindt, M.N.; Guerinot, M.L. Getting a sense for signals: Regulation of the plant iron deficiency response. Biochim. Biophys. Acta-Mol. Cell Res. 2012, 1823, 1521–1530. [Google Scholar] [CrossRef] [Green Version]
  9. Takahashi, M.; Yamaguchi, H.; Nakanishi, H.; Shioiri, T.; Nishizawa, N.-K.; Mori, S. Cloning Two Genes for Nicotianamine Aminotransferase, a Critical Enzyme in Iron Acquisition (Strategy II) in Graminaceous Plants. Plant Physiol. 1999, 121, 947–956. [Google Scholar] [CrossRef] [Green Version]
  10. Higuchi, K.; Suzuki, K.; Nakanishi, H.; Yamaguchi, H.; Nishizawa, N.-K.; Mori, S. Cloning of Nicotianamine Synthase Genes, Novel Genes Involved in the Biosynthesis of Phytosiderophores. Plant Physiol. 1999, 119, 471–480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Bashir, K.; Inoue, H.; Nagasaka, S.; Takahashi, M.; Nakanishi, H.; Mori, S.; Nishizawa, N.K. Cloning and Characterization of Deoxymugineic Acid Synthase Genes from Graminaceous Plants. J. Biol. Chem. 2006, 281, 32395–32402. [Google Scholar] [CrossRef] [Green Version]
  12. Chen, W.W.; Yang, J.L.; Qin, C.; Jin, C.W.; Mo, J.H.; Ye, T.; Zheng, S.J. Nitric Oxide Acts Downstream of Auxin to Trigger Root Ferric-Chelate Reductase Activity in Response to Iron Deficiency in Arabidopsis. Plant Physiol. 2010, 154, 810–819. [Google Scholar] [CrossRef] [Green Version]
  13. Chen, L.; Zhao, X.; Ding, C.; Wang, S.; Ding, Y. Physiological and Molecular Responses Under Fe Deficiency in Two Rice (Oryza sativa) Genotypes Differing in Iron Accumulation Ability in Seeds. J. Plant Growth Regul. 2014, 33, 769–777. [Google Scholar] [CrossRef]
  14. Chen, J.; Wu, F.H.; Shang, Y.T.; Wang, W.H.; Hu, W.J.; Simon, M.; Liu, X.; Shangguan, Z.P.; Zheng, H.L. Hydrogen sulphide improves adaptation of Zea mays seedlings to iron deficiency. J. Exp. Bot. 2015, 66, 6605–6622. [Google Scholar] [CrossRef] [Green Version]
  15. Zhu, C.Q.; Zhang, J.H.; Zhu, L.F.; Abliz, B.; Zhong, C.; Bai, Z.G.; Hu, W.J.; Sajid, H.; James, A.B.; Cao, X.C.; et al. NH4+ facilitates iron reutilization in the cell walls of rice (Oryza sativa) roots under iron-deficiency conditions. Environ. Exp. Bot. 2018, 151, 21–31. [Google Scholar] [CrossRef]
  16. Sattelmacher, B. The apoplast and its significance for plant mineral nutrition. New Phytol. 2001, 149, 167–192. [Google Scholar] [CrossRef]
  17. Stephan, U.; Schmidke, I.; Stephan, V. The nicotianamine molecule is made-to-measure for complexation of metal micronutrients in plants. BioMetals 1996, 9, 84–90. [Google Scholar] [CrossRef]
  18. Tiffin, L.O. Iron Translocation I. Plant Culture, Exudate Sampling, Iron-Citrate Analysis. Plant Physiol. 1966, 41, 510–514. [Google Scholar] [CrossRef] [Green Version]
  19. Bienfait, H.F.; Scheffers, M.R. Some properties of ferric citrate relevant to the iron nutrition of plants. Plant Soil 1992, 143, 141–144. [Google Scholar] [CrossRef]
  20. Klatte, M.; Schuler, M.; Wirtz, M.; Fink-Straube, C.; Hell, R.; Bauer, P. The Analysis of Arabidopsis Nicotianamine Synthase Mutants Reveals Functions for Nicotianamine in Seed Iron Loading and Iron Deficiency Responses. Plant Physiol. 2009, 150, 257–271. [Google Scholar] [CrossRef] [Green Version]
  21. Schuler, M.; Rellán-Álvarez, R.; Fink-Straube, C.; Abadía, J.; Bauer, P. Nicotianamine Functions in the Phloem-Based Transport of Iron to Sink Organs, in Pollen Development and Pollen Tube Growth in Arabidopsis. Plant Cell 2012, 24, 2380–2400. [Google Scholar] [CrossRef] [Green Version]
  22. Lascelles, J. Adaptation to form bacteriochlorophyll in Rhodopseudomonas spheroides: Changes in activity of enzymes con-cerned in pyrrole synthesis. Biochem. J. 1959, 72, 508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Abadia, J.; Morales, F.; Abadía, A. Photosystem II efficiency in low chlorophyll, iron-deficient leaves. Plant Soil 1999, 215, 183–192. [Google Scholar] [CrossRef] [Green Version]
  24. Mishra, S.N.; Srivastava, H.S. Stimulation of nitrate reductase activity by delta amino levulinic acid in excised maize leaves. Experientia 1983, 39, 1118–1120. [Google Scholar] [CrossRef]
  25. Liu, J.; Chang, X.; Ding, B.; Zhong, S.; Peng, L.; Wei, Q.; Meng, J.; Yu, Y. PhDHS Is Involved in Chloroplast Development in Petunia. Front. Plant Sci. 2019, 10, 284. [Google Scholar] [CrossRef] [PubMed]
  26. Sims, D.A.; Gamon, J.A. Relationships between leaf pigment content and spectral reflectance across a wide range of species, leaf structures and developmental stages. Remote Sens. Environ. 2002, 81, 337–354. [Google Scholar] [CrossRef]
  27. Ambawat, S.; Sharma, P.; Yadav, N.R.; Yadav, R.C. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 2013, 19, 307–321. [Google Scholar] [CrossRef] [Green Version]
  28. Docimo, T.; Francese, G.; Ruggiero, A.; Batelli, G.; De Palma, M.; Bassolino, L.; Toppino, L.; Rotino, G.L.; Mennella, G.; Tucci, M. Phenylpropanoids Accumulation in Eggplant Fruit: Characterization of Biosynthetic Genes and Regulation by a MYB Transcription Factor. Front. Plant Sci. 2016, 6, 1233. [Google Scholar] [CrossRef] [Green Version]
  29. Liu, Y.; Lin-Wang, K.; Espley, R.V.; Wang, L.; Yang, H.; Yu, B.; Dare, A.; Gasic, E.V.; Wang, J.; Zhang, J.; et al. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors. J. Exp. Bot. 2016, 67, 2159–2176. [Google Scholar] [CrossRef]
  30. Gonzalez, A.; Zhao, M.; Leavitt, J.M.; Lloyd, A.M. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J. 2008, 53, 814–827. [Google Scholar] [CrossRef]
  31. Zhou, X.; Chen, R.; Fan, Y.I. Molecular mechanism of iron uptake, translocation and storage in plants. Crop Res. 2012, 26, 605–610. [Google Scholar]
  32. Van Beusichem, M.L.; Kirkby, E.A.; Baas, R. Influence of Nitrate and Ammonium Nutrition on the Uptake, Assimilation, and Distribution of Nutrients in Ricinus communis. Plant Physiol. 1988, 86, 914–921. [Google Scholar] [CrossRef] [Green Version]
  33. Thomson, C.J.; Marschner, H.; Römheld, V. Effect of nitrogen fertilizer form on pH of the bulk soil and rhizosphere, and on the growth, phosphorus, and micronutrient uptake of bean. J. Plant Nutr. 1993, 16, 493–506. [Google Scholar] [CrossRef]
  34. Szczerba, M.W.; Britto, D.T.; Balkos, K.D.; Kronzucker, H.J. Alleviation of rapid, futile ammonium cycling at the plasma membrane by potassium reveals K+-sensitive and -insensitive components of NH4+ transport. J. Exp. Bot. 2008, 59, 303–313. [Google Scholar] [CrossRef] [Green Version]
  35. Price, J.; Laxmi, A.; Martin, S.K.S.; Jang, J.-C. Global Transcription Profiling Reveals Multiple Sugar Signal Transduction Mechanisms in Arabidopsis. Plant Cell 2004, 16, 2128–2150. [Google Scholar] [CrossRef] [Green Version]
  36. Wang, R.; Guegler, K.; LaBrie, S.T.; Crawford, N.M. Genomic analysis of a nutrient response in Arabidopsis reveals diverse expression patterns and novel metabolic and potential regulatory genes induced by nitrate. Plant Cell 2000, 12, 1491–1509. [Google Scholar] [CrossRef]
  37. Murata, Y.; Itoh, Y.; Iwashita, T.; Namba, K. Transgenic petunia with the iron (III)-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments. PLoS ONE 2015, 10, e0120227. [Google Scholar] [CrossRef]
  38. Smith, B.R.; Fisher, P.R.; Argo, W.R. Growth and Pigment Content of Container-grown Impatiens and Petunia in Relation to Root Substrate pH and Applied Micronutrient Concentration. HortScience 2004, 39, 1421–1425. [Google Scholar] [CrossRef]
  39. Smith, B.R.; Fisher, P.R.; Argo, W.R. Nutrient uptake in container-grown impatiens and petunia in response to root substrate pH and applied micronutrient concentration. HortScience 2004, 39, 1426–1431. [Google Scholar] [CrossRef] [Green Version]
  40. Nelson, P.V.; Niedziela, C.E., Jr.; Pitchay, D.S.; Mingis, N.C. Effectiveness, ammonium impact and potassium adequacy of soybean-base liquid fertilizer on bedding plants. J. Plant Nutr. 2010, 33, 724–735. [Google Scholar] [CrossRef]
  41. Ramos, L.; Bettin, A.; Herrada, B.M.P.; Arenas, T.L.; Becker, S.J. Effects of Nitrogen Form and Application Rates on the Growth of Petunia and Nitrogen Content in the Substrate. Commun. Soil Sci. Plant Anal. 2013, 44, 473–479. [Google Scholar] [CrossRef]
  42. Xiao, J.; Park, Y.G.; Guo, G.; Jeong, B.R. Effect of iron source and medium pH on growth and development of Sorbus commixta in vitro. Int. J. Mol. Sci. 2020, 22, 133. [Google Scholar] [CrossRef] [PubMed]
  43. Xiao, J.; Guo, G.; Jeong, B.R. Iron Supplement-Enhanced Growth and Development of Hydrangea macrophylla In Vitro under Normal and High pH. Cells 2021, 10, 3151. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, J.; Sokhansanj, S.; Wu, S.; Fang, R.; Yang, W.; Winter, P. A transformation technique from RGB signals to the Munsell system for color analysis of tobacco leaves. Comput. Electron. Agric. 1998, 19, 155–166. [Google Scholar] [CrossRef]
  45. Fisher, P.R.; Wik, R.M.; Smith, B.R.; Pasian, C.C.; Kmetz-González, M.; Argo, W.R. Correcting Iron Deficiency in Calibrachoa Grown in a Container Medium at High pH. HortTechnology 2003, 13, 308–313. [Google Scholar] [CrossRef] [Green Version]
  46. Wik, R.M.; Fisher, P.R.; Kopsell, D.A.; Argo, W.R. Iron form and concentration affect nutrition of container-grown Pelargonium and Calibrachoa. HortScience 2006, 41, 244–251. [Google Scholar] [CrossRef] [Green Version]
  47. Laulhere, J.P.; Briat, J.F. Iron release and uptake by plant ferritin: Effects of pH, reduction and chelation. Biochem. J. 1993, 290, 693–699. [Google Scholar] [CrossRef] [Green Version]
  48. Šrámek, F.; Dubsky, M. Occurrence and correction of chlorosis in young petunia plants. Hortic. Sci. 2009, 36, 147–153. [Google Scholar] [CrossRef] [Green Version]
  49. Boxma, R. Effect of pH on the behaviour of various iron chelates in sphagnum (moss) peat. Commun. Soil Sci. Plant Anal. 1981, 12, 755–763. [Google Scholar] [CrossRef]
  50. Poonnachit, U.; Darnell, R. Effect of ammonium and nitrate on ferric chelate reductase and nitrate reductase in Vaccinium species. Ann. Bot. 2004, 93, 399–405. [Google Scholar] [CrossRef]
  51. Fox, T.C.; Shaff, J.E.; Grusak, M.A.; Norvell, W.A.; Chen, Y.; Chaney, R.L.; Kochian, L. Direct Measurement of 59Fe-Labeled Fe2+ Influx in Roots of Pea Using a Chelator Buffer System to Control Free Fe2+ in Solution. Plant Physiol. 1996, 111, 93–100. [Google Scholar] [CrossRef] [Green Version]
  52. Moog, P.R.; Brüggemann, W. Iron reductase systems on the plant plasma membrane—A review. Plant Soil 1994, 165, 241–260. [Google Scholar] [CrossRef]
  53. Romera, F.J.; Alcántara, E.; De La Guardia, M.D. The induction of the “turbo reductase” is inhibited by cycloheximide, cordycepin and ethylene inhibitors in Fe-deficient cucumber (Cucumis sativus L.) plants. Protoplasma 1998, 205, 156–162. [Google Scholar] [CrossRef]
  54. Gogorcena, Y.; Abadía, J.; Abadía, A. Induction of in vivo root ferric chelate reductase activity in fruit tree rootstock. J. Plant Nutr. 2000, 23, 9–21. [Google Scholar] [CrossRef] [Green Version]
  55. Lindsay, W. Chemical reactions in soils that affect iron availability to plants. A quantative approach. In Iron Nutrition in Soils and Plants; Abadia, J., Ed.; Springer: Dordrecht, The Netherlands, 1995; pp. 7–14. [Google Scholar] [CrossRef]
  56. Crichton, R.R.; Wilmet, S.; Legssyer, R.; Ward, R.J. Molecular and cellular mechanisms of iron homeostasis and toxicity in mammalian cells. J. Inorg. Biochem. 2002, 91, 9–18. [Google Scholar] [CrossRef]
  57. Lee, S.-R.; Oh, M.-M.; Park, S.-A. Ferric-chelate reductase activity is a limiting factor in iron uptake in spinach and kale roots. Hortic. Environ. Biotechnol. 2016, 57, 462–469. [Google Scholar] [CrossRef]
  58. Sunda, W.; Huntsman, S. Effect of pH, light, and temperature on Fe-EDTA chelation and Fe hydrolysis in seawater. Mar. Chem. 2003, 84, 35–47. [Google Scholar] [CrossRef]
  59. Abbaszadeh-Dahaji, P.; Masalehi, F.; Akhgar, A. Improved Growth and Nutrition of Sorghum (Sorghum bicolor) Plants in a Low-Fertility Calcareous Soil Treated with Plant Growth—Promoting Rhizobacteria and Fe-EDTA. J. Soil Sci. Plant Nutr. 2020, 20, 31–42. [Google Scholar] [CrossRef]
  60. Curie, C.; Alonso, J.M.; Jean, M.L.; Ecker, J.R.; Briat, J.F. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem. J. 2000, 347, 749–755. [Google Scholar] [CrossRef]
  61. Vert, G.; Briat, J.-F.; Curie, C. Arabidopsis IRT2 gene encodes a root-periphery iron transporter. Plant J. 2001, 26, 181–189. [Google Scholar] [CrossRef]
  62. Rogers, E.E.; Eide, D.J.; Guerinot, M.L. Altered selectivity in an Arabidopsis metal transporter. Proc. Natl. Acad. Sci. USA 2000, 97, 12356–12360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Korshunova, Y.O.; Eide, D.; Clark, W.G.; Guerinot, M.L.; Pakrasi, H.B. The IRT1 protein from Arabidopsis thaliana is a metal transporter with a broad substrate range. Plant Mol. Biol. 1999, 40, 37–44. [Google Scholar] [CrossRef] [PubMed]
  64. Vert, G.; Grotz, N.; Dédaldéchamp, F.; Gaymard, F.; Guerinot, M.L.; Briat, J.F.; Curie, C. IRT1, an Arabidopsis transporter essential for iron uptake from the soil and for plant growth. Plant Cell 2002, 14, 1223–1233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Bennett, S.A.; Hansman, R.; Sessions, A.; Nakamura, K.-I.; Edwards, K.J. Tracing iron-fueled microbial carbon production within the hydrothermal plume at the Loihi seamount. Geochim. Cosmochim. Acta 2011, 75, 5526–5539. [Google Scholar] [CrossRef]
  66. Ferrandon, M.; Chamel, A.R. Cuticular retention, foliar absorption and translocation of Fe, Mn and Zn supplied in organic and inorganic form. J. Plant Nutr. 1988, 11, 247–263. [Google Scholar] [CrossRef]
  67. Waters, B.M.; Blevins, D.G.; Eide, D.J. Characterization of FRO1, a pea ferric-chelate reductase involved in root iron acquisi-tion. Plant Physiol. 2002, 129, 85–94. [Google Scholar] [CrossRef] [Green Version]
  68. Li, L.; Ye, L.; Kong, Q.; Shou, H. A Vacuolar Membrane Ferric-Chelate Reductase, OsFRO1, Alleviates Fe Toxicity in Rice (Oryza sativa L.). Front. Plant Sci. 2019, 10, 700. [Google Scholar] [CrossRef] [Green Version]
  69. Bughio, N.; Takahashi, M.; Yoshimura, E.; Nishizawa, N.; Mori, S. Characteristics of light-regulated iron transport system in barley chloroplasts. In Plant Nutrition for Sustainable Food Production and Environment; Ando, T., Fujita, K., Mae, T., Matsumoto, H., Mori, S., Sekiya, J., Eds.; Springer: Dordrecht, The Netherlands, 1997; pp. 157–161. [Google Scholar]
  70. Jeong, J.; Connolly, E.L. Iron uptake mechanisms in plants: Functions of the FRO family of ferric reductases. Plant Sci. 2009, 176, 709–714. [Google Scholar] [CrossRef]
  71. Terry, N.; Abadia, J. Function of iron in chloroplasts. J. Plant Nutr. 1986, 9, 609–646. [Google Scholar] [CrossRef] [Green Version]
  72. Briat, J.-F.; Curie, C.; Gaymard, F. Iron utilization and metabolism in plants. Curr. Opin. Plant Biol. 2007, 10, 276–282. [Google Scholar] [CrossRef]
  73. Brzezowski, P.; Richter, A.S.; Grimm, B. Regulation and function of tetrapyrrole biosynthesis in plants and algae. Biochim. Biophys. Acta-Bioenerg. 2015, 1847, 968–985. [Google Scholar] [CrossRef] [Green Version]
  74. Næsted, H.; Holm, A.; Jenkins, T.; Nielsen, H.B.; Harris, C.A.; Beale, M.H.; Andersen, M.; Mant, A.; Scheller, H.; Camara, B. Arabidopsis variegated 3 encodes a chloroplast-targeted, zinc-finger protein required for chloroplast and palisade cell development. J. Cell Sci. 2004, 117, 4807–4818. [Google Scholar] [CrossRef] [Green Version]
  75. Lv, X.-G.; Shi, Y.-F.; Xu, X.; Wei, Y.-L.; Wang, H.-M.; Zhang, X.-B.; Wu, J.-L. Oryza sativa Chloroplast Signal Recognition Particle 43 (OscpSRP43) Is Required for Chloroplast Development and Photosynthesis. PLoS ONE 2015, 10, e0143249. [Google Scholar] [CrossRef] [Green Version]
  76. Wang, T.W.; Lu, L.; Wang, D.; Thompson, J.E. Isolation and characterization of senescence-induced cDNAs encoding deoxyhypusine synthase and eucaryotic translation initiation factor 5A from tomato. J. Biol. Chem. 2001, 276, 17541–17549. [Google Scholar] [CrossRef] [Green Version]
  77. Rout, G.R.; Sahoo, S. Role of iron in plant growth and metabolism. Rev. Agric. Sci. 2015, 3, 1–24. [Google Scholar] [CrossRef] [Green Version]
  78. Kannan, S. Correlative influence of pH reduction on recovery from iron chlorosis in sorghum varieties. J. Plant Nutr. 1980, 2, 507–516. [Google Scholar] [CrossRef]
  79. Romero-Puertas, M.C.; Corpas, F.J.; Sandalio, L.M.; Leterrier, M.; Rodríguez-Serrano, M.; Del Río, L.A.; Palma, J.M. Glutathione reductase from pea leaves: Response to abiotic stress and characterization of the peroxisomal isozyme. New Phytol. 2006, 170, 43–52. [Google Scholar] [CrossRef]
  80. Gamon, J.A.; Surfus, J.S. Assessing leaf pigment content and activity with a reflectometer. New Phytol. 1999, 143, 105–117. [Google Scholar] [CrossRef]
  81. Koo, Y.; Poethig, R.S. Expression pattern analysis of three R2R3-MYB transcription factors for the production of anthocyanin in different vegetative stages of Arabidopsis leaves. Appl. Biol. Chem. 2021, 64, 5. [Google Scholar] [CrossRef]
  82. Stracke, R.; Werber, M.; Weisshaar, B. The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 2001, 4, 447–456. [Google Scholar] [CrossRef]
  83. Steyn, W.J.; Wand, S.; Holcroft, D.; Jacobs, G. Anthocyanins in vegetative tissues: A proposed unified function in photopro-tection. New Phytol. 2002, 155, 349–361. [Google Scholar] [CrossRef] [PubMed]
  84. Gould, K.S. Nature’s Swiss army knife: The diverse protective roles of anthocyanins in leaves. J. Biomed. Biotechnol. 2004, 2004, 314–320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  85. Albert, N.W.; Lewis, D.H.; Zhang, H.; Schwinn, K.E.; Jameson, P.E.; Davies, K.M. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning. Plant J. 2011, 65, 771–784. [Google Scholar] [CrossRef] [PubMed]
  86. Khan, A.; Jalil, S.; Cao, H.; Tsago, Y.; Sunusi, M.; Chen, Z.; Shi, C.; Jin, X. The Purple Leaf (pl6) Mutation Regulates Leaf Color by Altering the Anthocyanin and Chlorophyll Contents in Rice. Plants 2020, 9, 1477. [Google Scholar] [CrossRef] [PubMed]
  87. Maruta, T.; Noshi, M.; Tanouchi, A.; Tamoi, M.; Yabuta, Y.; Yoshimura, K.; Ishikawa, T.; Shigeoka, S. H2O2-triggered retrograde signaling from chloroplasts to nucleus plays specific role in response to stress. J. Biol. Chem. 2012, 287, 11717–11729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  88. Bishko, A.J.; Fisher, P.R.; Argo, W.R. The pH-response of a peat-based medium to application of acid-reaction chemicals. HortScience 2003, 38, 26–31. [Google Scholar] [CrossRef] [Green Version]
  89. Pestana, M.; De Varennes, A.; Faria, E.A. Diagnosis and correction of iron chlorosis in fruit trees: A review. J. Food Agric. Environ. 2003, 1, 46–51. [Google Scholar]
  90. Belkhodja, R.; Morales, F.; Sanz, M.; Abadía, A.; Abadia, J. Iron deficiency in peach trees: Effects on leaf chlorophyll and nutrient concentrations in flowers and leaves. Plant Soil 1998, 203, 257–268. [Google Scholar] [CrossRef] [Green Version]
  91. Ghasemi-Fasaei, R.; Ronaghi, A.; Maftoun, M.; Karimian, N.; Soltanpour, P.N. Influence of FeEDDHA on Iron-Manganese Interaction in Soybean Genotypes in a Calcareous Soil. J. Plant Nutr. 2002, 26, 1815–1823. [Google Scholar] [CrossRef]
  92. Abadía, J.; Nishio, J.; Monge, E.; Montañés, L.; Heras, L. Mineral composition of peach leaves affected by iron chlorosis. J. Plant Nutr. 1985, 8, 965–975. [Google Scholar] [CrossRef]
  93. Iqbal, A.; Dong, Q.; Madeeha, A.; Wang, X.; Gui, H.; Zhang, H.; Pang, N.; Zhang, X.; Song, M. Untangling the molecular mechanisms and functions of nitrate to improve nitrogen use efficiency. J. Sci. Food Agric. 2020, 100, 904–914. [Google Scholar] [CrossRef]
  94. Xu, G.; Fan, X.; Miller, A.J. Plant Nitrogen Assimilation and Use Efficiency. Annu. Rev. Plant Biol. 2012, 63, 153–182. [Google Scholar] [CrossRef] [Green Version]
  95. Huang, L.; Li, M.; Shao, Y.; Sun, T.; Li, C.; Ma, F. Ammonium uptake increases in response to PEG-induced drought stress in Malus hupehensis Rehd. Environ. Exp. Bot. 2018, 151, 32–42. [Google Scholar] [CrossRef]
  96. Zou, C.; Shen, J.; Zhang, F.; Guo, S.; Rengel, Z.; Tang, C. Impact of nitrogen form on iron uptake and distribution in maize seedlings in solution culture. Plant Soil 2001, 235, 143–149. [Google Scholar] [CrossRef]
  97. Kosegarten, H.; Schwed, U.; Wilson, G.; Mengel, K. Comparative investigation on the susceptibility of faba bean (Vicia faba L.) and sunflower (Helianthus annuus L.) to iron chlorosis. J. Plant Nutr. 1998, 21, 1511–1528. [Google Scholar] [CrossRef]
  98. Kosegarten, H.U.; Hoffmann, B.; Mengel, K. Apoplastic pH and Fe3+ Reduction in Intact Sunflower Leaves. Plant Physiol. 1999, 121, 1069–1079. [Google Scholar] [CrossRef] [Green Version]
  99. Wang, Y.-Y.; Hsu, P.-K.; Tsay, Y.-F. Uptake, allocation and signaling of nitrate. Trends Plant Sci. 2012, 17, 458–467. [Google Scholar] [CrossRef]
  100. Feng, H.; Yan, M.; Fan, X.; Li, B.; Shen, Q.; Miller, A.J.; Xu, G. Spatial expression and regulation of rice high-affinity nitrate transporters by nitrogen and carbon status. J. Exp. Bot. 2011, 62, 2319–2332. [Google Scholar] [CrossRef] [Green Version]
  101. Krouk, G.; Lacombe, B.; Bielach, A.; Perrine-Walker, F.; Malinska, K.; Mounier, E.; Hoyerova, K.; Tillard, P.; Leon, S.; Ljung, K.; et al. Nitrate-Regulated Auxin Transport by NRT1.1 Defines a Mechanism for Nutrient Sensing in Plants. Dev. Cell 2010, 18, 927–937. [Google Scholar] [CrossRef]
  102. Zhu, X.F.; Dong, X.Y.; Wu, Q.; Shen, R.F. Ammonium regulates Fe deficiency responses by enhancing nitric oxide signaling in Arabidopsis thaliana. Planta 2019, 250, 1089–1102. [Google Scholar] [CrossRef]
  103. Wei, H.; Manivannan, A.; Chen, Y.; Jeong, B.R. Effect of Different Cultivation Systems on the Accumulation of Nutrients and Phytochemicals in Ligularia fischeri. Hortic. Plant J. 2018, 4, 24–29. [Google Scholar] [CrossRef]
  104. Dere, Ş.; Güneş, T.; Sivaci, R. Spectrophotometric determination of chlorophyll-A, B and total carotenoid contents of some algae species using different solvents. Turk. J. Bot. 1998, 22, 13–18. [Google Scholar]
  105. Pirie, A.; Mullins, M.G. Changes in anthocyanin and phenolics content of grapevine leaf and fruit tissues treated with sucrose, nitrate, and abscisic acid. Plant Physiol. 1976, 58, 468–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  106. Bienfait, H.F.; Van den Briel, W.; Mesland-Mul, N.T. Free space iron pools in roots: Generation and mobilization. Plant Physiol. 1985, 78, 596–600. [Google Scholar] [CrossRef] [Green Version]
  107. Chaney, R.L.; Brown, J.C.; Tiffin, L.O. Obligatory Reduction of Ferric Chelates in Iron Uptake by Soybeans. Plant Physiol. 1972, 50, 208–213. [Google Scholar] [CrossRef] [Green Version]
  108. Manivannan, A.; Soundararajan, P.; Halimah, N.; Ko, C.H.; Jeong, B.R. Blue LED light enhances growth, phytochemical contents, and antioxidant enzyme activities of Rehmannia glutinosa cultured in vitro. Hortic. Environ. Biotechnol. 2015, 56, 105–113. [Google Scholar] [CrossRef]
  109. Bräutigam, A.; Gagneul, D.; Weber, A.P. High-throughput colorimetric method for the parallel assay of glyoxylic acid and ammonium in a single extract. Anal. Biochem. 2007, 362, 151–153. [Google Scholar] [CrossRef]
  110. Huang, L.; Li, M.; Zhou, K.; Sun, T.; Hu, L.; Li, C.; Ma, F. Uptake and metabolism of ammonium and nitrate in response to drought stress in Malus prunifolia. Plant Physiol. Biochem. 2018, 127, 185–193. [Google Scholar] [CrossRef]
  111. Zhang, H.; Dotson, P. The use of microwave muffle furnace for dry ashing plant tissue samples. Commun. Soil Sci. Plant Anal. 1994, 25, 1321–1327. [Google Scholar] [CrossRef]
Ijms 23 08943 g001 550
Figure 1. Photographs showing the growth and morphology of P. hybrida leaves as affected by the Fe source and medium pH after 10 days of culture in vitro. Bars indicate 3 cm.
Figure 1. Photographs showing the growth and morphology of P. hybrida leaves as affected by the Fe source and medium pH after 10 days of culture in vitro. Bars indicate 3 cm.
Ijms 23 08943 g001
Ijms 23 08943 g002 550
Figure 2. Effects of the Fe source and pH on the contents of total chlorophyll (A), carotenoid (B), and anthocyanin (C) in P. hybrida leaves after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Figure 2. Effects of the Fe source and pH on the contents of total chlorophyll (A), carotenoid (B), and anthocyanin (C) in P. hybrida leaves after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Ijms 23 08943 g002
Ijms 23 08943 g003 550
Figure 3. Effects of the Fe source and pH on FCR activity of P. hybrida after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Figure 3. Effects of the Fe source and pH on FCR activity of P. hybrida after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Ijms 23 08943 g003
Ijms 23 08943 g004 550
Figure 4. Effects of the Fe source and pH on the soluble protein content (A), activities of guaiacol peroxidase (GPX) (B), ascorbate peroxidase (APX) (C), catalase (CAT) (D), and superoxide dismutase (SOD) (E) in leaves of P. hybrida after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Figure 4. Effects of the Fe source and pH on the soluble protein content (A), activities of guaiacol peroxidase (GPX) (B), ascorbate peroxidase (APX) (C), catalase (CAT) (D), and superoxide dismutase (SOD) (E) in leaves of P. hybrida after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Ijms 23 08943 g004
Ijms 23 08943 g005 550
Figure 5. Effects of the Fe source and pH on the contents of NH4+ (A) and NO3− (B) and in leaves of P. hybrida after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Figure 5. Effects of the Fe source and pH on the contents of NH4+ (A) and NO3− (B) and in leaves of P. hybrida after 10 days of culture in vitro. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Ijms 23 08943 g005
Ijms 23 08943 g006 550
Figure 6. The gene expression levels in P. hybrida as affected by the Fe source and medium pH after 10 days of cultivation in vitro. Fe-regulated transporter, PhIRT1 (A); ferric reduction oxidase, PhFRO1 (B) and PhFRO8 (C); ammonium transporter, PhNRT2.5 (D); nitrate transporter, PhAMT1;1 (E); myb domain protein, PhMYB113 (F); and deoxyhypusine synthase, PhDHS (G). The relative transcription level of each gene was analyzed by quantitative real-time PCR (qRT-PCR). The expression of genes was normalized to that of PhActin. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Figure 6. The gene expression levels in P. hybrida as affected by the Fe source and medium pH after 10 days of cultivation in vitro. Fe-regulated transporter, PhIRT1 (A); ferric reduction oxidase, PhFRO1 (B) and PhFRO8 (C); ammonium transporter, PhNRT2.5 (D); nitrate transporter, PhAMT1;1 (E); myb domain protein, PhMYB113 (F); and deoxyhypusine synthase, PhDHS (G). The relative transcription level of each gene was analyzed by quantitative real-time PCR (qRT-PCR). The expression of genes was normalized to that of PhActin. Different letters above the bars indicate significant differences according to the Duncan’s multiple range test at p ≤ 0.05. The standard errors (n = 3) are indicated by the vertical bars.
Ijms 23 08943 g006
Table
Table 1. Growth of P. hybrida after 10 days of culture in vitro.
Table 1. Growth of P. hybrida after 10 days of culture in vitro.
Fe Source (A)pH (B)LeafShootRoot
NumberLength (mm)Width
(mm)		Length (mm)Fresh Weight (mg)Dry Weight (mg)Length (mm)Fresh Weight (mg)Dry Weight (mg)
Control4.709.3 z a y30.0 ab6.0 c4.0 bc141.0 cd13.7 f49.0 b57.5 c2.3 c
5.708.7 ab21.3 c7.8 a6.3 a236.7 a17.1 de49.5 b70.0 b3.0 c
6.705.7 de26.0 bc7.7 ab3.8 cd128.5 d17.3 de21.5 e18.3 e2.6 c
FeSO44.709.0 ab25.7 bc5.7 c4.7 bc255.0 a18.3 cd42.7 c55.3 c4.2 b
5.707.7 c25.0 bc8.7 a3.7 cd165.5 cd20.5 bc29.0 d65.5 b2.3 c
6.706.3 cd25.3 bc7.8 a3.5 cde232.0 a34.1 a32.0 d21.8 e1.3 d
Fe-EDTA4.708.7 ab25.5 bc7.3 abc3.3 cde253.0 a21.4 bc44.0 c69.5 b3.8 b
5.708.7 ab32.0 a5.7 c3.2 de200.5 b14.8 ef55.0 a118.6 a6.1 a
6.704.3 e25.0 bc8.5 a2.8 e130.0 d17.2 de32.5 d41.0 d2.5 c
F-test xANSNSNS******************
B***NS********************
A × BNS*********************
z Values represent the mean of three replications. y Mean separation within columns by the Duncan’s multiple range test at 5% level. x NS, *, **, and ***: non-significant or significant at p ≤ 0.05, 0.01, or 0.001, respectively.
Table
Table 2. The correlation analysis between the leaf color and plant pigment contents.
Table 2. The correlation analysis between the leaf color and plant pigment contents.
Fe Source (A)pH (B)Red AttributeGreen AttributeBlue Attribute
Control4.70115.0 z d y126.5 cd79.5 d
5.70153.0 c165.0 b132.5 ab
6.70209.5 a210.7 a136.5 a
FeSO44.70123.5 d178.7 b113.7 bc
5.70172.0 b139.5 c112.5 bc
6.70221.0 a210.3 a130.5 abc
Fe-EDTA4.70115.0 d114.0 d76.5 d
5.70128.0 d126.5 cd85.5 d
6.70159.0 b165.0 b110.5 c
F-test xA*********
B*********
A × B********
z Values represent the mean of three replications. y Mean separation within columns by the Duncan’s multiple range test at 5% level. x ** and ***: significant at p ≤ 0.01 or 0.001, respectively.
Table
Table 3. The correlation analysis between the leaf color and plant pigment contents.
Table 3. The correlation analysis between the leaf color and plant pigment contents.
CorrelationRed AttributeGreen AttributeBlue AttributeTotal ChlorophyllCarotenoid
Green attribute0.944 ** z----
Blue attribute0.735 **0.819 **---
Total chlorophyll−0.717 **−0.689 **−0.405 *--
Carotenoid−0.790 **−0.748 **−0.483 *0.974 **-
Anthocyanin−0.781 **−0.737 **−0.441 *0.957 **0.967 **
z * and **: significant at the p ≤ 0.05 and 0.01 levels, respectively.
Table
Table 4. Contents of macronutrients and micronutrients in leaves of P. hybrida after 10 days of culture in vitro.
Table 4. Contents of macronutrients and micronutrients in leaves of P. hybrida after 10 days of culture in vitro.
Fe Source (A)pH
(B)		Macronutrients (mg·g−1 DW)Micronutrients (mg·g−1 DW)
PKSCaMgCuMnZnFe
Control4.70102.7 z b y2029.2 b103.3 c459.6 b109.0 c5.93 a0.83 b2.01 a7.00 b
5.7086.4 d1500.9 d567.1 a295.7 de88.0 e3.25 cd0.66 c1.34 cd5.93 cd
6.7099.8 bc1000.5 e306.9 b309.8 d118.7 b5.02 ab0.53 d1.81 ab3.56 e
FeSO44.7091.8 cd1834.4 c117.5 c362.8 c92.4 de4.12 bc0.80 b1.27 de6.36 bc
5.70104.3 b1003.0 e98.7 c282.9 de70.3 f3.91 bcd0.64 c0.97 f3.68 e
6.7073.5 e652.8 f62.9 c213.4 f68.7 f2.86 d0.31 e0.66 g3.16 e
Fe-EDTA4.70105.6 b1827.1 c96.0 c389.1 c99.9 cd4.62 b0.80 b1.10 def5.07 d
5.70133.1 a2286.9 a150.2 c686.6 a153.9 a4.41 bc1.47 a1.01 ef9.09 a
6.7069.3 e727.0 f89.3 c265.2 e72.0 f4.23 bc0.36 e1.58 bc5.92 cd
F-test xA**************************
B*******************NS***
A × B**************************
z Values represent the mean of three replications. y Mean separation within columns by the Duncan’s multiple range test at 5% level. x NS, **, and ***: non-significant or significant at p ≤ 0.01, or 0.001, respectively.
Table
Table 5. The correlation analysis between content of pigments and Fe in leaves of P. hybrida after 10 days of culture in vitro.
Table 5. The correlation analysis between content of pigments and Fe in leaves of P. hybrida after 10 days of culture in vitro.
CorrelationChlorophyllCarotenoidAnthocyanin
Carotenoid0.976 ** z--
Anthocyanin0.961 **0.967 **-
Fe0.420 *0.3720.403 *
z * and **: significant at the p ≤ 0.05 and 0.01 levels, respectively.
Table
Table 6. The correlation analysis between growth parameters and nutrient contents in leaves of P. hybrida after 10 days of culture in vitro.
Table 6. The correlation analysis between growth parameters and nutrient contents in leaves of P. hybrida after 10 days of culture in vitro.
CorrelationLeaf NumberShootZnCuFeMnCaMgKPSNH4+
LengthFWDW
Length0.367 z-------------
FW0.458 *0.370------------
DW−0.253−0.1470.416 *-
Zn−0.0400.0830.556 **−0.639 **----------
Cu0.160−0.247−0.424 *−0.523 **0.667 **---------
Fe0.178−0.320−0.271−0.649 **0.3460.516 **--------
Mn0.600 **−0.0300.178−0.533 **−0.0480.2590.731 **-------
Ca0.496 **−0.1710.015−0.553 **0.0580.3540.845 **0.960 **------
Mg0.336−0.102−0.081−0.535 **0.2180.397 *0.803 **0.828 **0.883 **-----
K0.784 **0.1600.286−0.566 **0.1360.398 *0.655 **0.881 **0.848 **0.714 **----
P0.524 **−0.138−0.009−0.461 *−0.0240.3190.634 **0.883 **0.851 **0.813 **0.724 **---
S0.1120.748 **0.115−0.2800.228−0.259−0.2240.012−0.0830.1300.030−0.026--
NH4+0.3170.1570.292−0.0690.1320.1610.2220.0750.034−0.0190.299−0.080−0.272-
NO3−0.004−0.1640.3520.276−0.380−0.1900.1190.2950.3170.485 *0.1570.2960.154−0.398 *
z * and **: significant at the p ≤ 0.05 and 0.01 levels, respectively.
Table
Table 7. The names and locus ID of target genes of Arabidopsis thaliana used in this study.
Table 7. The names and locus ID of target genes of Arabidopsis thaliana used in this study.
Gene NameAbbreviationLocus ID
Ferric reduction oxidase 1FRO1AT1GO1590
Ferric reduction oxidase 8FRO8AT5G50160
Iron-regulated transporter 1IRT1AT4G19690
Nitrate transporter 2.5NRT2.5AT1G12940
Ammonium transporter 1;1AMT1;1AT4G13510
Myb domain protein 113MYB113AT1G66370
Deoxyhypusine synthaseDHSAT5G05920
Table
Table 8. The list of primers used for gene expression quantification in P. hybrida.
Table 8. The list of primers used for gene expression quantification in P. hybrida.
NameGene IdentifierForward (5′–3′)Reverse (5′–3′)
PhFRO1Peaxi162Scf41243CGTCTCACAGGTCAAAACCCTTGCTGGTTGGATTGATATTGTGG
PhFRO8Peaxi162Scf00089TCAGTCTTCTTGCAGGATTGATTGGAAGGAAAGATTCGAACAGA
PhIRT1Peaxi162Scf00623GCTGGGAATCATTGTTCACTCCACCAAGTCCCATTCCTTCAAAC
PhNRT2.5Peaxi162Scf00515GGTGTTGAACTTACTGTGGACAACAAAAGTGAGGCCACAGGCA
PhAMT1;1Peaxi162Scf00043CCATAAACCAGCAATGCCACCTGCAGGATCAGTTAGAGCCAA
PhMYB113Peaxi162Scf00102GGTGTGGAAAGAGTTGTAGGCTGTCAGTTCGACCTGGTAATC
PhDHSPeaxi162Scf00178TGGCACCACCACGTATTTTTCCTGTCCATGCTGGTTCAAGG
PhActin11cn1159TGCACTCCCACATGCTATCCTTCAGCCGAAGTGGTGAAAGAG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Guo, G.; Xiao, J.; Jeong, B.R. Iron Source and Medium pH Affect Nutrient Uptake and Pigment Content in Petunia hybrida ‘Madness Red’ Cultured In Vitro. Int. J. Mol. Sci. 2022, 23, 8943. https://doi.org/10.3390/ijms23168943

AMA Style

Guo G, Xiao J, Jeong BR. Iron Source and Medium pH Affect Nutrient Uptake and Pigment Content in Petunia hybrida ‘Madness Red’ Cultured In Vitro. International Journal of Molecular Sciences. 2022; 23(16):8943. https://doi.org/10.3390/ijms23168943

Chicago/Turabian Style

Guo, Ge, Jie Xiao, and Byoung Ryong Jeong. 2022. "Iron Source and Medium pH Affect Nutrient Uptake and Pigment Content in Petunia hybrida ‘Madness Red’ Cultured In Vitro" International Journal of Molecular Sciences 23, no. 16: 8943. https://doi.org/10.3390/ijms23168943

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop