A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids
Abstract
:1. Introduction
2. Results
2.1. Preparation of the ACD 3D Culture System
2.2. Basal Cell Growth Profile of Cell Lines in 2D Culture
2.3. Fast and Viable Spheroid-Forming Performance in ACD 3D-Culture System
2.4. Cancer Stem Cell Marker Expression in Spheroids Grown Using the ACD 3D Culture System
2.5. Anti-Cancer Drug Effects on Spheroids Grown Using the ACD 3D Culture System
2.6. Primary Cells from Patient-Derived Cancer Tissue Grown Using the ACD 3D Culture System
2.7. Human Liver Organoid Formation with ACD 3D-Culture System
3. Discussion
4. Materials and Methods
4.1. ACD 3D Culture System Procedure
4.2. Spheroid Collection and Cell Viability
4.3. Real-Time PCR
4.4. Immunofluorescence
4.5. Drug Screening
4.6. Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lv, D.; Hu, Z.; Lu, L.; Lu, H.; Xu, X. Three-dimensional cell culture: A powerful tool in tumor research and drug discovery. Oncol. Lett. 2017, 14, 6999–7010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishiguro, T.; Ohata, H.; Sato, A.; Yamawaki, K.; Enomoto, T.; Okamoto, K. Tumor-derived spheroids: Relevance to cancer stem cells and clinical applications. Cancer Sci. 2017, 108, 283–289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nath, S.; Devi, G.R. Three-dimensional culture systems in cancer research: Focus on tumor spheroid model. Pharmacol. Ther. 2016, 163, 94–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, W.M.; Chang, W.C.; Chen, L.; Chang, Y.Y.; Shyr, C.R.; Hung, Y.C.; Ma, W.L. MicroRNA-21 promotes the ovarian teratocarcinoma PA1 cell line by sustaining cancer stem/progenitor populations in vitro. Stem. Cell Res. Ther. 2013, 4, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herheliuk, T.; Perepelytsina, O.; Ugnivenko, A.; Ostapchenko, L.; Sydorenko, M. Investigation of multicellular tumor spheroids enriched for a cancer stem cell phenotype. Stem. Cell Investig. 2019, 6, 21. [Google Scholar] [CrossRef]
- Prud’homme, G.J. Cancer stem cells and novel targets for antitumor strategies. Curr. Pharm. Des. 2012, 18, 2838–2849. [Google Scholar] [CrossRef]
- Chung, W.M.; Chang, W.C.; Chen, L.; Lin, T.Y.; Chen, L.C.; Hung, Y.C.; Ma, W.L. Ligand-independent androgen receptors promote ovarian teratocarcinoma cell growth by stimulating self-renewal of cancer stem/progenitor cells. Stem. Cell Res. 2014, 13, 24–35. [Google Scholar] [CrossRef] [Green Version]
- Krohn, A.; Song, Y.H.; Muehlberg, F.; Droll, L.; Beckmann, C.; Alt, E. CXCR4 receptor positive spheroid forming cells are responsible for tumor invasion in vitro. Cancer Lett. 2009, 280, 65–71. [Google Scholar] [CrossRef]
- Phi, L.T.H.; Sari, I.N.; Yang, Y.G.; Lee, S.H.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem. Cells Int. 2018, 2018, 5416923. [Google Scholar] [CrossRef] [Green Version]
- Langhans, S.A. Three-Dimensional in Vitro Cell Culture Models in Drug Discovery and Drug Repositioning. Front. Pharmacol. 2018, 9, 6. [Google Scholar] [CrossRef]
- Chang, W.C.; Wang, H.C.; Cheng, W.C.; Yang, J.C.; Chung, W.M.; Ho, Y.P.; Chen, L.; Hung, Y.C.; Ma, W.L. LDLR-mediated lipidome-transcriptome reprogramming in cisplatin insensitivity. Endocr. Relat. Cancer 2020, 27, 81–95. [Google Scholar] [CrossRef]
- Yeh, C.C.; Liao, P.Y.; Pandey, S.; Yung, S.Y.; Lai, H.C.; Jeng, L.B.; Chang, W.C.; Ma, W.L. Metronomic Celecoxib Therapy in Clinically Available Dosage Ablates Hepatocellular Carcinoma via Suppressing Cell Invasion, Growth, and Stemness in Pre-Clinical Models. Front. Oncol. 2020, 10, 572861. [Google Scholar] [CrossRef]
- Chaicharoenaudomrung, N.; Kunhorm, P.; Noisa, P. Three-dimensional cell culture systems as an in vitro platform for cancer and stem cell modeling. World J. Stem. Cells 2019, 11, 1065–1083. [Google Scholar] [CrossRef]
- Gupta, N.; Liu, J.R.; Patel, B.; Solomon, D.E.; Vaidya, B.; Gupta, V. Microfluidics-based 3D cell culture models: Utility in novel drug discovery and delivery research. Bioeng. Transl. Med. 2016, 1, 63–81. [Google Scholar] [CrossRef]
- Prestwich, G.D. Simplifying the extracellular matrix for 3-D cell culture and tissue engineering: A pragmatic approach. J. Cell Biochem. 2007, 101, 1370–1383. [Google Scholar] [CrossRef]
- Li, Y.; Kumacheva, E. Hydrogel microenvironments for cancer spheroid growth and drug screening. Sci. Adv. 2018, 4, eaas8998. [Google Scholar] [CrossRef] [Green Version]
- Rao, S.S.; Dejesus, J.; Short, A.R.; Otero, J.J.; Sarkar, A.; Winter, J.O. Glioblastoma behaviors in three-dimensional collagen-hyaluronan composite hydrogels. ACS Appl. Mater. Interfaces 2013, 5, 9276–9284. [Google Scholar] [CrossRef]
- Chen, L.; Xiao, Z.; Meng, Y.; Zhao, Y.; Han, J.; Su, G.; Chen, B.; Dai, J. The enhancement of cancer stem cell properties of MCF-7 cells in 3D collagen scaffolds for modeling of cancer and anti-cancer drugs. Biomaterials 2012, 33, 1437–1444. [Google Scholar] [CrossRef]
- Pedron, S.; Becka, E.; Harley, B.A. Regulation of glioma cell phenotype in 3D matrices by hyaluronic acid. Biomaterials 2013, 34, 7408–7417. [Google Scholar] [CrossRef]
- Fischbach, C.; Kong, H.J.; Hsiong, S.X.; Evangelista, M.B.; Yuen, W.; Mooney, D.J. Cancer cell angiogenic capability is regulated by 3D culture and integrin engagement. Proc. Natl. Acad. Sci. USA 2009, 106, 399–404. [Google Scholar] [CrossRef]
- Labowska, M.B.; Cierluk, K.; Jankowska, A.M.; Kulbacka, J.; Detyna, J.; Michalak, I. A Review on the Adaption of Alginate-Gelatin Hydrogels for 3D Cultures and Bioprinting. Materials 2021, 14, 858. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.X.; Liu, C.; Liu, Y.; Yang, L.; Li, N.; Guo, X.; Sun, G.W.; Ma, X.J. Enrichment of cancer stem cell-like cells by culture in alginate gel beads. J. Biotechnol. 2014, 177, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Kleinman, H.K.; Martin, G.R. Matrigel: Basement membrane matrix with biological activity. Semin. Cancer Biol. 2005, 15, 378–386. [Google Scholar] [CrossRef] [PubMed]
- Lombardo, Y.; Filipovic, A.; Molyneux, G.; Periyasamy, M.; Giamas, G.; Hu, Y.; Trivedi, P.S.; Wang, J.; Yague, E.; Michel, L.; et al. Nicastrin regulates breast cancer stem cell properties and tumor growth in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2012, 109, 16558–16563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hughes, C.S.; Postovit, L.M.; Lajoie, G.A. Matrigel: A complex protein mixture required for optimal growth of cell culture. Proteomics 2010, 10, 1886–1890. [Google Scholar] [CrossRef]
- Sodunke, T.R.; Turner, K.K.; Caldwell, S.A.; McBride, K.W.; Reginato, M.J.; Noh, H.M. Micropatterns of Matrigel for three-dimensional epithelial cultures. Biomaterials 2007, 28, 4006–4016. [Google Scholar] [CrossRef]
- Fang, Y.; Eglen, R.M. Three-Dimensional Cell Cultures in Drug Discovery and Development. SLAS Discov. 2017, 22, 456–472. [Google Scholar] [CrossRef] [Green Version]
- Andersen, T.; Auk-Emblem, P.; Dornish, M. 3D Cell Culture in Alginate Hydrogels. Microarrays 2015, 4, 133–161. [Google Scholar] [CrossRef]
- Takai, A.; Fako, V.; Dang, H.; Forgues, M.; Yu, Z.; Budhu, A.; Wang, X.W. Three-dimensional Organotypic Culture Models of Human Hepatocellular Carcinoma. Sci. Rep. 2016, 6, 21174. [Google Scholar] [CrossRef] [Green Version]
- Hoch, E.; Schuh, C.; Hirth, T.; Tovar, G.E.; Borchers, K. Stiff gelatin hydrogels can be photo-chemically synthesized from low viscous gelatin solutions using molecularly functionalized gelatin with a high degree of methacrylation. J. Mater. Sci. Mater. Med. 2012, 23, 2607–2617. [Google Scholar] [CrossRef]
- Ruoslahti, E. RGD and other recognition sequences for integrins. Annu. Rev. Cell Dev. Biol. 1996, 12, 697–715. [Google Scholar] [CrossRef]
- Prior, N.; Inacio, P.; Huch, M. Liver organoids: From basic research to therapeutic applications. Gut 2019, 68, 2228–2237. [Google Scholar] [CrossRef] [Green Version]
- Louis, S.A.; Rietze, R.L.; Deleyrolle, L.; Wagey, R.E.; Thomas, T.E.; Eaves, A.C.; Reynolds, B.A. Enumeration of neural stem and progenitor cells in the neural colony-forming cell assay. Stem. Cells 2008, 26, 988–996. [Google Scholar] [CrossRef]
- Kelm, J.M.; Timmins, N.E.; Brown, C.J.; Fussenegger, M.; Nielsen, L.K. Method for generation of homogeneous multicellular tumor spheroids applicable to a wide variety of cell types. Biotechnol. Bioeng. 2003, 83, 173–180. [Google Scholar] [CrossRef]
- Lee, B.H.; Kim, M.H.; Lee, J.H.; Seliktar, D.; Cho, N.J.; Tan, L.P. Modulation of Huh7.5 spheroid formation and functionality using modified PEG-based hydrogels of different stiffness. PLoS ONE 2015, 10, e0118123. [Google Scholar] [CrossRef] [Green Version]
- Haug, A.; Smidsrod, O.A.; Larsen, B.; Gronowitz, S.; Hoffman, R.A.; Westerdahl, A. The Effect of Divalent Metals on the Properties of Alginate Solutions. II. Comparison of Different Metal Ions. Acta Chemica Scandinavica 1965, 19, 341–351. [Google Scholar] [CrossRef] [Green Version]
- Morch, Y.A.; Donati, I.; Strand, B.L.; Skjak-Braek, G. Effect of Ca2+, Ba2+, and Sr2+ on alginate microbeads. Biomacromolecules 2006, 7, 1471–1480. [Google Scholar] [CrossRef]
- Montanucci, P.; Terenzi, S.; Santi, C.; Pennoni, I.; Bini, V.; Pescara, T.; Basta, G.; Calafiore, R. Insights in Behavior of Variably Formulated Alginate-Based Microcapsules for Cell Transplantation. Biomed. Res. Int. 2015, 2015, 965804. [Google Scholar] [CrossRef]
- Zhao, W.; Li, Y.; Zhang, X. Stemness-Related Markers in Cancer. Cancer Transl. Med. 2017, 3, 87–95. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Zhang, J.; Zhang, X.; Zhou, H.; Liu, G.; Li, Q. Cancer Stem Cells: A Potential Breakthrough in HCC-Targeted Therapy. Front. Pharmacol. 2020, 11, 198. [Google Scholar] [CrossRef]
- Asai, R.; Tsuchiya, H.; Amisaki, M.; Makimoto, K.; Takenaga, A.; Sakabe, T.; Hoi, S.; Koyama, S.; Shiota, G. CD44 standard isoform is involved in maintenance of cancer stem cells of a hepatocellular carcinoma cell line. Cancer Med. 2019, 8, 773–782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takaishi, S.; Okumura, T.; Tu, S.; Wang, S.S.; Shibata, W.; Vigneshwaran, R.; Gordon, S.A.; Shimada, Y.; Wang, T.C. Identification of gastric cancer stem cells using the cell surface marker CD44. Stem. Cells 2009, 27, 1006–1020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, T.; Wei, H.; Gou, S.; Shi, P.; Yang, Z.; Zhao, G.; Wang, C. Cancer stem-like cells enriched in Panc-1 spheres possess increased migration ability and resistance to gemcitabine. Int. J. Mol. Sci. 2011, 12, 1595–1604. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gzil, A.; Zarebska, I.; Bursiewicz, W.; Antosik, P.; Grzanka, D.; Szylberg, L. Markers of pancreatic cancer stem cells and their clinical and therapeutic implications. Mol. Biol. Rep. 2019, 46, 6629–6645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Connor, E.V.; Saygin, C.; Braley, C.; Wiechert, A.C.; Karunanithi, S.; Crean-Tate, K.; Abdul-Karim, F.W.; Michener, C.M.; Rose, P.G.; Lathia, J.D.; et al. Thy-1 predicts poor prognosis and is associated with self-renewal in ovarian cancer. J. Ovarian Res. 2019, 12, 112. [Google Scholar] [CrossRef] [Green Version]
- Hamilton, G.; Rath, B. Role of circulating tumor cell spheroids in drug resistance. Cancer Drug Resist. 2019, 2, 762–772. [Google Scholar] [CrossRef] [Green Version]
- Combes, E.; Andrade, A.F.; Tosi, D.; Michaud, H.A.; Coquel, F.; Garambois, V.; Desigaud, D.; Jarlier, M.; Coquelle, A.; Pasero, P.; et al. Inhibition of Ataxia-Telangiectasia Mutated and RAD3-Related (ATR) Overcomes Oxaliplatin Resistance and Promotes Antitumor Immunity in Colorectal Cancer. Cancer Res. 2019, 79, 2933–2946. [Google Scholar] [CrossRef] [Green Version]
- Ma, W.L.; Chang, N.; Yu, Y.; Su, Y.T.; Chen, G.Y.; Cheng, W.C.; Wu, Y.C.; Li, C.C.; Chang, W.C.; Yang, J.C. Ursolic acid silences CYP19A1/aromatase to suppress gastric cancer growth. Cancer Med. 2022, 11, 2824–2835. [Google Scholar] [CrossRef]
- Chen, L.; Ma, W.L.; Cheng, W.C.; Yang, J.C.; Wang, H.C.; Su, Y.T.; Ahmad, A.; Hung, Y.C.; Chang, W.C. Targeting lipid droplet lysophosphatidylcholine for cisplatin chemotherapy. J. Cell Mol. Med. 2020, 24, 7187–7200. [Google Scholar] [CrossRef]
- Tri Reagent for RNA Isolation from Tissues Cells; Sigma-Aldrich Co. LLC.: St. Louis, MO, USA, 2021.
- PrimeScriptTM RT reagent Kit (Perfect Real Time); Takara Bio Inc.: Kusatsu, Japan, 2022.
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Cancer Type | Cell Line | Doubling Time (h) |
---|---|---|
Gastric cancer | AGS | 15.9 |
Epithelial ovarian cancer, endometrioid type | MDAH-2774 | 24.7 |
Pancreatic ductal adenocarcinoma | PanC-1 | 29.4 |
Hepatocellular carcinoma | HepG2 | 37.7 |
Epithelial ovarian cancer, serous type | SKOV3 | 39.4 |
Cancer Type | Cell Line | Doubling Time (h) | Time to Spheroid Formation (Days) | Cell Viability (%) |
---|---|---|---|---|
Gastric cancer | AGS | 15.9 | 3 | 90 |
Epithelial ovarian cancer, endometrioid type | MDAH-2774 | 24.7 | 3 | 75 |
Pancreatic ductal adenocarcinoma | PanC-1 | 29.4 | 4 | 84 |
Hepatocellular carcinoma | HepG2 | 37.7 | 4 | 90 |
Epithelial ovarian cancer, serous type | SKOV3 | 39.4 | 4 | 91 |
Primer | Sequence (5′–3′) | |
---|---|---|
β-actin | Forward | TCACCCACACTGTGCCCATCTACGA |
Reverse | CAGCGGAACCGCTCATTGCCAATGG | |
CD24 | Forward | TTTACAACTGCCTCGACACACATAA |
Reverse | CCCATGTAGTTTTCTAAAGATGGAA | |
CD44 | Forward | GACCTCTGCAAGGCTTTCAA |
Reverse | TCCGATGCTCAGAGCTTTCTC | |
CD90 | Forward | CTAGTGGACCAGAGCCTTCG |
Reverse | TGGAGTGCACACGTGTAGGT | |
Oct-4 | Forward | GGCCCGAAAGAGAAAGCGAACC |
Reverse | ACCCAGCAGCCTCAAAATCCTCTC | |
Nanog | Forward | GGGCCTGAAGAAAACTATCCATCC |
Reverse | TGCTATTCTTCGGCCAGTTGTTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.-R.; Liang, C.-T.; Tsai, S.-C.; Wu, Y.-C.; Liu, C.-W.; Yang, H.-H.; Tu, T.-Y.; Lee, Y.-C.; Hsiao, K.-Y.; Chang, W.-C.; et al. A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids. Int. J. Mol. Sci. 2022, 23, 13962. https://doi.org/10.3390/ijms232213962
Yang C-R, Liang C-T, Tsai S-C, Wu Y-C, Liu C-W, Yang H-H, Tu T-Y, Lee Y-C, Hsiao K-Y, Chang W-C, et al. A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids. International Journal of Molecular Sciences. 2022; 23(22):13962. https://doi.org/10.3390/ijms232213962
Chicago/Turabian StyleYang, Cian-Ru, Chu-Ting Liang, Shih-Chieh Tsai, Yu-Chun Wu, Ching-Wen Liu, Hui-Hua Yang, Ting-Yuan Tu, Yueh-Chun Lee, Kuei-Yang Hsiao, Wei-Chun Chang, and et al. 2022. "A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids" International Journal of Molecular Sciences 23, no. 22: 13962. https://doi.org/10.3390/ijms232213962
APA StyleYang, C.-R., Liang, C.-T., Tsai, S.-C., Wu, Y.-C., Liu, C.-W., Yang, H.-H., Tu, T.-Y., Lee, Y.-C., Hsiao, K.-Y., Chang, W.-C., & Ma, W.-L. (2022). A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids. International Journal of Molecular Sciences, 23(22), 13962. https://doi.org/10.3390/ijms232213962