A Large Intergenic Spacer Leads to the Increase in Genome Size and Sequential Gene Movement around IR/SC Boundaries in the Chloroplast Genome of Adiantum malesianum (Pteridaceae)
Abstract
:1. Introduction
2. Results
2.1. Genome Assembly and Annotation
2.2. Chloroplast Genome Comparison among Adiantum
2.3. Inverted Repeat/Single-Copy Boundary Analysis of Adiantum
2.4. Description of rpoB-trnD-GUC Intergenic Spacer
2.5. Characterization of Repeated Sequences in the Six Adiantum Chloroplast Genomes
3. Discussion
4. Materials and Methods
4.1. Sample Collection, DNA Extraction and Sequencing
4.2. Genome Assembly and Annotation
4.3. Comparative Genomic Analysis of Adiantum Chloroplasts
4.4. Statistical Analysis of Repeated Sequences
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dobrogojski, J.; Adamiec, M.; Luciński, R. The chloroplast genome: A review. Acta Physiol. Plant. 2020, 42, 98. [Google Scholar] [CrossRef]
- Abdullah; Henriquez, C.L.; Mehmood, F.; Hayat, A.; Sammad, A.; Waseem, S.; Waheed, M.T.; Matthews, P.J.; Croat, T.B.; Poczai, P.; et al. Chloroplast genome evolution in the Dracunculus clade (Aroideae, Araceae). Genomics 2021, 113, 183–192. [Google Scholar] [CrossRef] [PubMed]
- Bock, R. Structure, Function, and Inheritance of Plastid Genomes; Springer: Berlin, Heidelberg, 2007; pp. 29–63. [Google Scholar]
- Amiryousefi, A.; Hyvonen, J.; Poczai, P. The chloroplast genome sequence of bittersweet (Solanum dulcamara): Plastid genome structure evolution in Solanaceae. PLoS ONE 2018, 13, e196069. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menezes, A.; Resende-Moreira, L.C.; Buzatti, R.; Nazareno, A.G.; Carlsen, M.; Lobo, F.P.; Kalapothakis, E.; Lovato, M.B. Chloroplast genomes of Byrsonima species (Malpighiaceae): Comparative analysis and screening of high divergence sequences. Sci. Rep. 2018, 8, 2210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, C.; Dong, W.; Li, W.; Lu, Y.; Xie, X.; Jin, X.; Shi, J.; He, K.; Suo, Z. Comparative analysis of six Lagerstroemia complete chloroplast genomes. Front. Plant. Sci. 2017, 8, 15. [Google Scholar] [CrossRef] [Green Version]
- Abdullah; Henriquez, C.L.; Mehmood, F.; Carlsen, M.M.; Islam, M.; Waheed, M.T.; Poczai, P.; Croat, T.B.; Ahmed, I. Complete chloroplast genomes of Anthurium huixtlense and Pothos scandens (Pothoideae, Araceae): Unique inverted repeat expansion and contraction affect rate of evolution. J. Mol. Evol. 2020, 88, 562–574. [Google Scholar] [CrossRef]
- Downie, S.R.; Jansen, R.K. A Comparative analysis of whole plastid genomes from the Apiales: Expansion and contraction of the inverted repeat, mitochondrial to plastid transfer of DNA, and identification of highly divergent noncoding regions. Syst. Bot. 2015, 40, 336–351. [Google Scholar] [CrossRef]
- Goulding, S.E.; Olmstead, R.G.; Morden, C.W.; Wolfe, K.H. Ebb and flow of the chloroplast inverted repeat. Mol. Gen. Genet. 1996, 252, 195–206. [Google Scholar] [CrossRef]
- Wei, N.; Perez-Escobar, O.A.; Musili, P.M.; Huang, W.C.; Yang, J.B.; Hu, A.Q.; Hu, G.W.; Grace, O.M.; Wang, Q.F. Plastome evolution in the hyperdiverse genus Euphorbia (Euphorbiaceae) using phylogenomic and comparative analyses: Large-scale expansion and contraction of the inverted repeat region. Front. Plant. Sci. 2021, 12, 712064. [Google Scholar] [CrossRef]
- Palmer, J.D.; Nugent, J.M.; Herbon, L.A. Unusual structure of geranium chloroplast DNA: A triple-sized inverted repeat, extensive gene duplications, multiple inversions, and two repeat families. Proc. Natl. Acad. Sci. USA 1987, 84, 769–773. [Google Scholar] [CrossRef]
- Kwon, E.C.; Kim, J.H.; Kim, N.S. Comprehensive genomic analyses with 115 plastomes from algae to seed plants: Structure, gene contents, GC contents, and introns. Genes Genom. 2020, 42, 553–570. [Google Scholar] [CrossRef]
- Frailey, D.C.; Chaluvadi, S.R.; Vaughn, J.N.; Coatney, C.G.; Bennetzen, J.L. Gene loss and genome rearrangement in the plastids of five Hemiparasites in the family Orobanchaceae. BMC Plant. Biol. 2018, 18, 30. [Google Scholar] [CrossRef] [Green Version]
- Wolf, P.G.; Roper, J.M.; Duffy, A.M. The evolution of chloroplast genome structure in ferns. Genome 2010, 53, 731–738. [Google Scholar] [CrossRef] [Green Version]
- Chumley, T.W.; Palmer, J.D.; Mower, J.P.; Fourcade, H.M.; Calie, P.J.; Boore, J.L.; Jansen, R.K. The complete chloroplast genome sequence of Pelargonium x hortorum: Organization and evolution of the largest and most highly rearranged chloroplast genome of land plants. Mol. Biol. Evol. 2006, 23, 2175–2190. [Google Scholar] [CrossRef]
- Guisinger, M.M.; Kuehl, J.V.; Boore, J.L.; Jansen, R.K. Extreme reconfiguration of plastid genomes in the angiosperm family Geraniaceae: Rearrangements, repeats, and codon usage. Mol. Biol. Evol. 2011, 28, 583–600. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.S.; Lin, C.P.; Hsu, C.Y.; Wang, R.J.; Chaw, S.M. Comparative chloroplast genomes of Pinaceae: Insights into the mechanism of diversified genomic organizations. Genome Biol. Evol. 2011, 3, 309–319. [Google Scholar] [CrossRef]
- Li, J.; Gao, L.; Chen, S.; Tao, K.; Su, Y.; Wang, T. Evolution of short inverted repeat in cupressophytes, transfer of accD to nucleus in Sciadopitys verticillata and phylogenetic position of Sciadopityaceae. Sci. Rep. 2016, 6, 20934. [Google Scholar] [CrossRef] [Green Version]
- Xia, M.Q.; Liao, R.Y.; Zhou, J.T.; Lin, H.Y.; Li, J.H.; Li, P.; Fu, C.X.; Qiu, Y.X. Phylogenomics and biogeography of Wisteria: Implications on plastome evolution among inverted repeat-lacking clade (IRLC) legumes. J. Syst. Evol. 2022, 60, 253–265. [Google Scholar] [CrossRef]
- Wu, C.S.; Wang, Y.N.; Hsu, C.Y.; Lin, C.P.; Chaw, S.M. Loss of different inverted repeat copies from the chloroplast genomes of Pinaceae and cupressophytes and influence of heterotachy on the evaluation of gymnosperm phylogeny. Genome Biol. Evol. 2011, 3, 1284–1295. [Google Scholar] [CrossRef] [Green Version]
- Szczecińska, M.; Gomolińska, A.; Szkudlarz, P.; Sawicki, J. Plastid and nuclear genomic resources of a relict and endangered plant species: Chamaedaphne calyculata (L.) Moench (Ericaceae). Turk. J. Bot. 2014, 38, 1229–1238. [Google Scholar] [CrossRef]
- Fajardo, D.; Senalik, D.; Ames, M.; Zhu, H.; Steffan, S.A.; Harbut, R.; Polashock, J.; Vorsa, N.; Gillespie, E.; Kron, K.; et al. Complete plastid genome sequence of Vaccinium macrocarpon: Structure, gene content, and rearrangements revealed by next generation sequencing. Tree Genet. Genomes 2013, 9, 489–498. [Google Scholar] [CrossRef]
- Park, S.; An, B.; Park, S. Reconfiguration of the plastid genome in Lamprocapnos spectabilis: IR boundary shifting, inversion, and intraspecific variation. Sci. Rep. UK 2018, 8, 1–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Guo, Q.; Li, Q.; Yang, L. Long-reads reveal that Rhododendron delavayi plastid genome contains extensive repeat sequences, and recombination exists among plastid genomes of photosynthetic Ericaceae. PeerJ 2020, 8, e9048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sinn, B.T.; Sedmak, D.D.; Kelly, L.M.; Freudenstein, J.V. Total duplication of the small single copy region in the angiosperm plastome: Rearrangement and inverted repeat instability in Asarum. Am. J. Bot. 2018, 105, 71–84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, R.J.; Cheng, C.L.; Chang, C.C.; Wu, C.L.; Su, T.M.; Chaw, S.M. Dynamics and evolution of the inverted repeat-large single copy junctions in the chloroplast genomes of monocots. BMC Evol. Biol. 2008, 8, 36. [Google Scholar] [CrossRef] [Green Version]
- Sawicki, J.; Bączkiewicz, A.; Buczkowska, K.; Górski, P.; Krawczyk, K.; Mizia, P.; Myszczyński, K.; Ślipiko, M.; Szczecińska, M. The Increase of simple sequence repeats during diversification of Marchantiidae, an early land plant lineage, leads to the first known expansion of inverted repeats in the evolutionarily-stable structure of liverwort plastomes. Genes 2020, 11, 299. [Google Scholar] [CrossRef] [Green Version]
- Yi, X.; Gao, L.; Wang, B.; Su, Y.J.; Wang, T. The complete chloroplast genome sequence of Cephalotaxus oliveri (Cephalotaxaceae): Evolutionary comparison of Cephalotaxus chloroplast DNAs and insights into the loss of inverted repeat copies in gymnosperms. Genome Biol. Evol. 2013, 5, 688–698. [Google Scholar] [CrossRef] [Green Version]
- Robison, T.A.; Grusz, A.L.; Wolf, P.G.; Mower, J.P.; Fauskee, B.D.; Sosa, K.; Schuettpelz, E. Mobile elements shape plastome evolution in ferns. Genome Biol. Evol. 2018, 10, 2558–2571. [Google Scholar] [CrossRef] [Green Version]
- Palmer, J.D.; Stein, D.B. Conservation of chloroplast genome structure among vascular plants. Curr. Genet. 1986, 10, 823–833. [Google Scholar] [CrossRef]
- Chang, H.; Zhang, L.; Xie, H.; Liu, J.; Xi, Z.; Xu, X. The Conservation of chloroplast genome structure and improved resolution of infrafamilial relationships of Crassulaceae. Front. Plant. Sci. 2021, 12, 631884. [Google Scholar] [CrossRef]
- Logacheva, M.D.; Krinitsina, A.A.; Belenikin, M.S.; Khafizov, K.; Konorov, E.A.; Kuptsov, S.V.; Speranskaya, A.S. Comparative analysis of inverted repeats of polypod fern (Polypodiales) plastomes reveals two hypervariable regions. BMC Plant. Biol. 2017, 17, 255. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Wang, Z.; Su, Y.; Wang, T. Comparative genomic analysis of Polypodiaceae chloroplasts reveals fine structural features and dynamic insertion sequences. BMC Plant. Biol. 2021, 21, 31. [Google Scholar] [CrossRef]
- Kim, H.T.; Kim, J.S. The dynamic evolution of mobile open reading frames in plastomes of Hymenophyllum Sm. and new insight on Hymenophyllum coreanum Nakai. Sci. Rep. 2020, 10, 11059. [Google Scholar] [CrossRef]
- Wang, W.; Messing, J. High-throughput sequencing of three Lemnoideae (duckweeds) chloroplast genomes from total DNA. PLoS ONE 2011, 6, e24670. [Google Scholar] [CrossRef] [Green Version]
- Kim, K.J.; Lee, H.L. Complete chloroplast genome sequences from Korean ginseng (Panax schinseng Nees) and comparative analysis of sequence evolution among 17 vascular plants. DNA Res. 2004, 11, 247–261. [Google Scholar] [CrossRef]
- Guo, Y.Y.; Yang, J.X.; Li, H.K.; Zhao, H.S. Chloroplast genomes of two species of Cypripedium: Expanded genome size and proliferation of AT-Biased repeat sequences. Front. Plant. Sci. 2021, 12, 609729. [Google Scholar] [CrossRef]
- Dugas, D.V.; Hernandez, D.; Koenen, E.J.; Schwarz, E.; Straub, S.; Hughes, C.E.; Jansen, R.K.; Nageswara-Rao, M.; Staats, M.; Trujillo, J.T.; et al. Mimosoid legume plastome evolution: IR expansion, tandem repeat expansions, and accelerated rate of evolution in clpP. Sci. Rep. 2015, 5, 16958. [Google Scholar] [CrossRef] [Green Version]
- Guo, Y.Y.; Yang, J.X.; Bai, M.Z.; Zhang, G.Q.; Liu, Z.J. The chloroplast genome evolution of Venus slipper (Paphiopedilum): IR expansion, SSC contraction, and highly rearranged SSC regions. BMC Plant. Biol. 2021, 21, 248. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Jin, J.J.; Yu, W.B.; Yang, J.B.; Song, Y.; DePamphilis, C.W.; Yi, T.S.; Li, D.Z. GetOrganelle: A fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biol. 2020, 21, 241. [Google Scholar] [CrossRef]
- Delcher, A.L.; Phillippy, A.; Carlton, J.; Salzberg, S.L. Fast algorithms for large-scale genome alignment and comparison. Nucleic Acids Res. 2002, 30, 2478–2483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq-versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [Green Version]
- Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef] [Green Version]
- Beier, S.; Thiel, T.; Munch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [Green Version]
- Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [Green Version]
- Kurtz, S.; Choudhuri, J.V.; Ohlebusch, E.; Schleiermacher, C.; Stoye, J.; Giegerich, R. REPuter: The manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001, 29, 4633–4642. [Google Scholar] [CrossRef]
Species | LSC | SSC | IR | Size | GC% (Total) | |||
---|---|---|---|---|---|---|---|---|
Length (bp) | GC% | Length (bp) | GC% | Length (bp) | GC% | |||
A. flabellulatum | 83,384 | 42.5 | 21,449 | 39.2 | 23,615 | 46.7 | 152,063 | 43.3 |
A. malesianum | 89,030 | 41.8 | 21,487 | 37.7 | 22,077 | 46.6 | 154,671 | 42.6 |
A. capillus-veneris | 82,282 | 40.8 | 21,390 | 37.1 | 23,448 | 46.3 | 150,568 | 42.0 |
A. shastense | 82,113 | 43.7 | 21,539 | 41.6 | 23,381 | 46.7 | 150,414 | 44.3 |
A. reniforme var. sinense | 83,267 | 41.9 | 21,459 | 38.1 | 22,688 | 46.9 | 150,102 | 42.8 |
A. nelumboides | 83,281 | 41.9 | 21,483 | 38.1 | 22,596 | 46.8 | 149,956 | 42.8 |
Name | Location in the cp Genome | Forward Primer | Reverse Primer | Length | Identity |
---|---|---|---|---|---|
IRa/LSC | 153,708–154,676; 1–436 | CGGGTTCTTTCCGTTTTCTATTG | TTATACATGAAGGATCCTGTTCTAACATT | 1.4 kb | 95.0% |
LSC/IRb | 88,721–89,920 | ATCGTTTGAGGAAGTAATTTTTTAATTTTGAC | TTTGTTCCGGACGCCTC | 1.2 kb | 92.9% |
IRb/SSC | 110,548–111,947 | TACGAATCTCCCCGGATAGG | TTTATTTTCTTACTTTCGAGGGAGATTTTT | 1.4 kb | 94.9% |
SSC/IRa | 131,727–133,148 | TTACTCTCCTTGCTGTTGGATAATT | TCTCCCCGGATAGGATTCG | 1.4 kb | 94.8% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, X.; Zhu, M.; Su, Y.; Wang, T. A Large Intergenic Spacer Leads to the Increase in Genome Size and Sequential Gene Movement around IR/SC Boundaries in the Chloroplast Genome of Adiantum malesianum (Pteridaceae). Int. J. Mol. Sci. 2022, 23, 15616. https://doi.org/10.3390/ijms232415616
Gu X, Zhu M, Su Y, Wang T. A Large Intergenic Spacer Leads to the Increase in Genome Size and Sequential Gene Movement around IR/SC Boundaries in the Chloroplast Genome of Adiantum malesianum (Pteridaceae). International Journal of Molecular Sciences. 2022; 23(24):15616. https://doi.org/10.3390/ijms232415616
Chicago/Turabian StyleGu, Xiaolin, Ming Zhu, Yingjuan Su, and Ting Wang. 2022. "A Large Intergenic Spacer Leads to the Increase in Genome Size and Sequential Gene Movement around IR/SC Boundaries in the Chloroplast Genome of Adiantum malesianum (Pteridaceae)" International Journal of Molecular Sciences 23, no. 24: 15616. https://doi.org/10.3390/ijms232415616