Effect of Long-Term Supplementation with Acetic Acid on the Skeletal Muscle of Aging Sprague Dawley Rats
Abstract
:1. Introduction
2. Results
2.1. Effect of Acetic Acid on Age-Related Changes in Energy Metabolism
2.2. Effect of Acetic Acid on the Fiber Types of Muscles
2.3. Effect of Acetic Acid on the Gene Expression of Skeletal Muscles
2.4. Long-Term Supplementation with Acetic Acid Stimulates the Nuclear Localization of MEF2A and PGC-1α in the Soleus Muscle of Rats during Aging
2.5. Mitochondrial DNA (mtDNA) Analysis and SDH Staining
2.6. Effect of Acetic Acid on GPR43 Gene Expression in the Skeletal Muscles of Aging Rats
2.7. Supplementation with Acetic Acid Protects Intramuscular Lipid Accumulation in the Soleus Muscle
2.8. Activation of AMPK and Akt Pathway
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animal Experiments
4.3. Histological Analysis
4.4. Quantitative RT-PCR Analysis
4.5. Nuclear Extraction and Western Blotting
4.6. Mitochondrial DNA Analysis
4.7. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kirkendall, D.T.; Garrett, W.E. The Effects of Aging and Training on Skeletal Muscle. Am. J. Sports Med. 1998, 26, 598–602. [Google Scholar] [CrossRef] [PubMed]
- Marzetti, E.; Lees, H.A.; Wohlgemuth, S.E.; Leeuwenburgh, C. Sarcopenia of Aging: Underlying Cellular Mechanisms and Protection by Calorie Restriction. BioFactors 2009, 35, 28–35. [Google Scholar] [CrossRef] [PubMed]
- Migliavacca, E.; Tay, S.K.H.; Patel, H.P.; Sonntag, T.; Civiletto, G.; McFarlane, C.; Forrester, T.; Barton, S.J.; Leow, M.K.; Antoun, E.; et al. Mitochondrial Oxidative Capacity and NAD+ Biosynthesis Are Reduced in Human Sarcopenia across Ethnicities. Nat. Commun. 2019, 10, 5808. [Google Scholar] [CrossRef] [PubMed]
- Romanello, V.; Sandri, M. Mitochondrial Quality Control and Muscle Mass Maintenance. Front. Physiol. 2016, 6, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Cartee, G.D.; Hepple, R.T.; Bamman, M.M.; Zierath, J.R. Exercise Promotes Healthy Aging of Skeletal Muscle. Cell Metab. 2016, 23, 1034–1047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnson, M.L.; Robinson, M.M.; Nair, K.S. Skeletal Muscle Aging and the Mitochondrion. Trends Endocrinol. Metab. 2013, 24, 247–256. [Google Scholar] [CrossRef] [Green Version]
- Hepple, R.T. Impact of Aging on Mitochondrial Function in Cardiac and Skeletal Muscle. Free Radic. Biol. Med. 2016, 98, 177–186. [Google Scholar] [CrossRef]
- Short, K.R.; Bigelow, M.L.; Kahl, J.; Singh, R.; Coenen-Schimke, J.; Raghavakaimal, S.; Nair, K.S. Decline in Skeletal Muscle Mitochondrial Function with Aging in Humans. Proc. Natl. Acad. Sci. USA 2005, 102, 5618–5623. [Google Scholar] [CrossRef] [Green Version]
- Conley, K.E.; Jubrias, S.A.; Esselman, P.C. Oxidative Capacity and Ageing in Human Muscle. J. Physiol. 2000, 526, 203–210. [Google Scholar] [CrossRef]
- Trounce, I.; Byrne, E.; Marzuki, S. Decline in Skeletal Muscle Mitochondrial Respiratory Chain Function: Possible Factor in Ageing. Lancet 1989, 333, 637–639. [Google Scholar] [CrossRef]
- Zhao, L.; Zou, X.; Feng, Z.; Luo, C.; Liu, J.; Li, H. Evidence for Association of Mitochondrial Metabolism Alteration with Lipid Accumulation in Aging Rats. Exp. Gerontol. 2014, 56, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.H.; Li, J.J. Aging and Dyslipidemia: A Review of Potential Mechanisms. Ageing Res. Rev. 2015, 19, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Peterson, C.M.; Johannsen, D.L.; Ravussin, E. Skeletal Muscle Mitochondria and Aging: A Review. J. Aging Res. 2012, 2012, 20. [Google Scholar] [CrossRef] [Green Version]
- Russell, A.P.; Foletta, V.C.; Snow, R.J.; Wadley, G.D. Skeletal Muscle Mitochondria: A Major Player in Exercise, Health and Disease. Biochim. Biophys. Acta-Gen. Subj. 2014, 1840, 1276–1284. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, H.; Maruta, Y.H.; Jozuka, M.; Kimura, R.; Iwabuchi, H.; Yamato, M.; Saito, T.; Fujisawa, K.; Takahashi, Y.; Kimoto, M.; et al. Effects of Acetate on Lipid Metabolism in Muscles and Adipose Tissues of Type 2 Diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) Rats. Biosci. Biotechnol. Biochem. 2009, 73, 570–576. [Google Scholar] [CrossRef] [Green Version]
- Maruta, H.; Yoshimura, Y.; Araki, A.; Kimoto, M.; Takahashi, Y.; Yamashita, H. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells. PLoS ONE 2016, 11, e0158055. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maruta, H.; Yamashita, H. Acetic Acid Stimulates G-Protein-Coupled Receptor GPR43 and Induces Intracellular Calcium Influx in L6 Myotube Cells. PLoS ONE 2020, 15, e0239428. [Google Scholar] [CrossRef]
- Hardie, D.G.; Sakamoto, K. A Key Sensor of Fuel and Energy Status in Skeletal Muscle. Physiology 2006, 21, 48–60. [Google Scholar] [CrossRef]
- Hardie, D.G. Sensing of Energy and Nutrients by AMP-Activated Protein Kinase. Am. J. Clin. Nutr. 2011, 93, 891S–896S. [Google Scholar] [CrossRef] [Green Version]
- Kahn, B.B.; Alquier, T.; Carling, D.; Hardie, D.G. AMP-Activated Protein Kinase: Ancient Energy Gauge Provides Clues to Modern Understanding of Metabolism. Cell Metab. 2005, 1, 15–25. [Google Scholar] [CrossRef] [Green Version]
- Fediuc, S.; Gaidhu, M.P.; Ceddia, R.B. Regulation of AMP-Activated Protein Kinase and Acetyl-CoA Carboxylase Phosphorylation by Palmitate in Skeletal Muscle Cells. J. Lipid Res. 2006, 47, 412–420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iwabu, M.; Yamauchi, T.; Okada-Iwabu, M.; Sato, K.; Nakagawa, T.; Funata, M.; Yamaguchi, M.; Namiki, S.; Nakayama, R.; Tabata, M.; et al. Adiponectin and AdipoR1 Regulate PGC-1alpha and Mitochondria by Ca2+ and AMPK/SIRT1. Nature 2010, 464, 1313–1319. [Google Scholar] [CrossRef] [PubMed]
- Cantó, C.; Gerhart-Hines, Z.; Feige, J.N.; Lagouge, M.; Noriega, L.; Milne, J.C. AMPK Regulates Energy Expenditure by Modulating NAD + Metabolism and SIRT1 Activity. Nature 2009, 458, 1056–1060. [Google Scholar] [CrossRef] [PubMed]
- Lantier, L.; Fentz, J.; Mounier, R.; Leclerc, J.; Treebak, J.T.; Pehmøller, C. AMPK Controls Exercise Endurance, Mitochondrial Oxidative Capacity, and Skeletal Muscle Integrity. FASEB J. 2014, 28, 3211–3224. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, H.M. AMPK and Exercise: Glucose Uptake and Insulin Sensitivity. Diabetes Metab. J. 2013, 37, 1–21. [Google Scholar] [CrossRef] [Green Version]
- O’Neill, H.M.; Holloway, G.P.; Steinberg, G.R. AMPK Regulation of Fatty Acid Metabolism and Mitochondrial Biogenesis: Implications for Obesity. Mol. Cell. Endocrinol. 2013, 366, 135–151. [Google Scholar] [CrossRef]
- Salminen, A.; Kaarniranta, K. AMP-Activated Protein Kinase (AMPK) Controls the Aging Process via an Integrated Signaling Network. Ageing Res. Rev. 2012, 11, 230–241. [Google Scholar] [CrossRef]
- Kimura, I.; Ozawa, K.; Inoue, D.; Imamura, T.; Kimura, K.; Maeda, T.; Terasawa, K.; Kashihara, D.; Hirano, K.; Tani, T.; et al. The Gut Microbiota Suppresses Insulin-Mediated Fat Accumulation via the Short-Chain Fatty Acid Receptor GPR43. Nat. Commun. 2013, 4, 1829. [Google Scholar] [CrossRef] [Green Version]
- Hong, Y.-H.; Nishimura, Y.; Hishikawa, D.; Tsuzuki, H.; Miyahara, H.; Gotoh, C.; Choi, K.-C.; Feng, D.D.; Chen, C.; Lee, H.-G.; et al. Acetate and Propionate Short Chain Fatty Acids Stimulate Adipogenesis via GPCR43. Endocrinology 2005, 146, 5092–5099. [Google Scholar] [CrossRef] [Green Version]
- Le Poul, E.; Loison, C.; Struyf, S.; Springael, J.Y.; Lannoy, V.; Decobecq, M.E.; Brezillon, S.; Dupriez, V.; Vassart, G.; Van Damme, J.; et al. Functional Characterization of Human Receptors for Short Chain Fatty Acids and Their Role in Polymorphonuclear Cell Activation. J. Biol. Chem. 2003, 278, 25481–25489. [Google Scholar] [CrossRef] [Green Version]
- Stoddart, L.A.; Smith, N.J.; Jenkins, L.; Brown, A.J.; Milligan, G. Conserved Polar Residues in Transmembrane Domains V, VI, and VII of Free Fatty Acid Receptor 2 and Free Fatty Acid Receptor 3 Are Required for the Binding and Function of Short Chain Fatty Acids. J. Biol. Chem. 2008, 283, 32913–32924. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maslowski, K.M.; Vieira, A.T.; Ng, A.; Kranich, J.; Sierro, F.; Yu, D.; Schilter, H.C.; Rolph, M.S.; MacKay, F.; Artis, D.; et al. Regulation of Inflammatory Responses by Gut Microbiota and Chemoattractant Receptor GPR43. Nature 2009, 461, 1282–1286. [Google Scholar] [CrossRef] [PubMed]
- Crabtree, G.R. Generic Signals and Specific Outcomes: Signaling through Ca2+, Calcineurin, and NF-AT. Cell 1999, 96, 611–614. [Google Scholar] [CrossRef] [Green Version]
- McKinsey, T.A.; Zhang, C.L.; Olson, E.N. MEF2: A Calcium-Dependent Regulator of Cell Division, Differentiation and Death. Trends Biochem. Sci. 2002, 27, 40–47. [Google Scholar] [CrossRef]
- Young Kim, J.; Hyun Kim, D.; Choi, J.; Park, J.-K.; Jeong, K.-S.; Leeuwenburgh, C.; Pal Yu, B.; Young Chung, H. Changes in Lipid Distribution during Aging and Its Modulation by Calorie Restriction. Age 2009, 31, 127–142. [Google Scholar] [CrossRef] [Green Version]
- Mrudula Spurthi, K.; Sarikhani, M.; Mishra, S.; Arumugam Desingu, P.; Yadav, S.; Rao, S.; Maity, S.; Kumar Tamta, A.; Kumar, S.; Majumdar, S.; et al. Toll-like Receptor 2 Deficiency Hyperactivates the FoxO1 Transcription Factor and Induces Aging-Associated Cardiac Dysfunction in Mice. J. Biol. Chem. 2018, 293, 13073–13089. [Google Scholar] [CrossRef] [Green Version]
- McLoughlin, T.J.; Smith, S.M.; DeLong, A.D.; Wang, H.; Unterman, T.G.; Esser, K.A. FoxO1 Induces Apoptosis in Skeletal Myotubes in a DNA-Binding-Dependent Manner. Am. J. Physiol. Cell Physiol. 2009, 297, C548–C555. [Google Scholar] [CrossRef]
- Saltiel, A.R. Insulin Signaling in Health and Disease. J. Clin. Investig. 2021, 131, e142241. [Google Scholar] [CrossRef]
- Yoshida, T.; Semprun-Prieto, L.; Sukhanov, S.; Delafontaine, P. IGF-1 Prevents ANG II-Induced Skeletal Muscle Atrophy via Akt- and Foxo-Dependent Inhibition of the Ubiquitin Ligase Atrogin-1 Expression. Am. J. Physiol. Heart Circ. Physiol. 2010, 298, H1565–H1570. [Google Scholar] [CrossRef] [Green Version]
- Ma, Y.; Maruta, H.; Sun, B.; Wang, C.; Isono, C.; Yamashita, H. Effects of Long-Term Taurine Supplementation on Age-Related Changes in Skeletal Muscle Function of Sprague–Dawley Rats. Amino Acids. 2021, 53, 159–170. [Google Scholar] [CrossRef]
- Tieland, M.; Trouwborst, I.; Clark, B.C. Skeletal Muscle Performance and Ageing. J. Cachexia Sarcopenia Muscle 2018, 9, 3–19. [Google Scholar] [CrossRef] [PubMed]
- Lexell, J.; Taylor, C.C.; Sjöström, M. What Is the Cause of the Ageing Atrophy?: Total Number, Size and Proportion of Different Fiber Types Studied in Whole Vastus Lateralis Muscle from 15- to 83-Year-Old Men. J. Neurol. Sci. 1988, 84, 275–294. [Google Scholar] [CrossRef]
- Bodine, S.C.; Latres, E.; Baumhueter, S.; Lai, V.K.M.; Nunez, L.; Clarke, B.A.; Poueymirou, W.T.; Panaro, F.J.; Na, E.; Dharmarajan, K.; et al. Identification of Ubiquitin Ligases Required for Skeletal Muscle Atrophy. Science 2001, 294, 1704–1708. [Google Scholar] [CrossRef] [PubMed]
- Gomes, M.D.; Lecker, S.H.; Jagoe, R.T.; Navon, A.; Goldberg, A.L. Atrogin-1, a Muscle-Specific F-Box Protein Highly Expressed during Muscle Atrophy. Proc. Natl. Acad. Sci. USA 2001, 98, 14440–14445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lecker, S.H.; Jagoe, R.T.; Gilbert, A.; Gomes, M.; Baracos, V.; Bailey, J.; Price, S.R.; Mitch, W.E.; Goldberg, A.L. Multiple Types of Skeletal Muscle Atrophy Involve a Common Program of Changes in Gene Expression. FASEB J. 2004, 18, 39–51. [Google Scholar] [CrossRef]
- De Angelis, L.; Borghi, S.; Melchionna, R.; Berghella, L.; Baccarani-Contri, M.; Parise, F.; Ferrari, S.; Cossu, G. Inhibition of Myogenesis by Transforming Growth Factor β Is Density-Dependent and Related to the Translocation of Transcription Factor MEF2 to the Cytoplasm. Proc. Natl. Acad. Sci. USA 1998, 95, 12358–12363. [Google Scholar] [CrossRef] [Green Version]
- Sandri, M.; Lin, J.; Handschin, C.; Yang, W.; Arany, Z.P.; Lecker, S.H.; Goldberg, A.L.; Spiegelman, B.M. PGC-1α Protects Skeletal Muscle from Atrophy by Suppressing FoxO3 Action and Atrophy-Specific Gene Transcription. Proc. Natl. Acad. Sci. USA 2006, 103, 16260–16265. [Google Scholar] [CrossRef] [Green Version]
- Wenz, T.; Rossi, S.G.; Rotundo, R.L.; Spiegelman, B.M.; Moraes, C.T. Increased Muscle PGC-1α Expression Protects from Sarcopenia and Metabolic Disease during Aging. Proc. Natl. Acad. Sci. USA 2009, 106, 20405–20410. [Google Scholar] [CrossRef] [Green Version]
- Lin, J.; Wu, H.; Tarr, P.T.; Zhang, C.Y.; Wu, Z.; Boss, O.; Michael, L.F.; Puigserver, P.; Isotani, E.; Olson, E.N.; et al. Transcriptional Co-Activator PGC-1 Alpha Drives the Formation of Slow-Twitch Muscle Fibres. Nature 2002, 418, 797–801. [Google Scholar] [CrossRef]
- Ramachandran, B.; Yu, G.; Gulick, T. Nuclear Respiratory Factor 1 Controls Myocyte Enhancer Factor 2A Transcription to Provide a Mechanism for Coordinate Expression of Respiratory Chain Subunits. J. Biol. Chem. 2008, 283, 11935–11946. [Google Scholar] [CrossRef] [Green Version]
- Irrcher, I.; Ljubicic, V.; Kirwan, A.F.; Hood, D.A. AMP-Activated Protein Kinase-Regulated Activation of the PGC-1α Promoter in Skeletal Muscle Cells. PLoS ONE 2008, 3, e3614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mangum, J.E.; Hardee, J.P.; Fix, D.K.; Puppa, M.J.; Elkes, J.; Altomare, D.; Bykhovskaya, Y.; Campagna, D.R.; Schmidt, P.J.; Sendamarai, A.K.; et al. Pseudouridine Synthase 1 Deficient Mice, a Model for Mitochondrial Myopathy with Sideroblastic Anemia, Exhibit Muscle Morphology and Physiology Alterations OPEN. J. Appl. Physiol. 2016, 121, 636–645. [Google Scholar] [CrossRef] [Green Version]
- Van Der Zwaard, X.S.; De Ruiter, C.J.; Noordhof, D.A.; Sterrenburg, R.; Bloemers, F.W.; De Koning, J.J.; Jaspers, R.T.; Van Der Laarse, W.J. Maximal Oxygen Uptake Is Proportional to Muscle Fiber Oxidative Capacity, from Chronic Heart Failure Patients to Professional Cyclists. J. Appl. Physiol. 2016, 121, 636–645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fogarty, M.J.; Marin Mathieu, N.; Mantilla, C.B.; Sieck, G.C. Aging Reduces Succinate Dehydrogenase Activity in Rat Type IIx/IIb Diaphragm Muscle Fibers. J. Appl. Physiol. 2020, 128, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Bratic, A.; Larsson, N.G. The Role of Mitochondria in Aging. J. Clin. Investig. 2013, 123, 951–957. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Deng, J.; Fan, D. Ginsenoside Rk3 Ameliorates High-Fat-Diet/Streptozocin Induced Type 2 Diabetes Mellitus in Mice: Via the AMPK/Akt Signaling Pathway. Food Funct. 2019, 10, 2538–2551. [Google Scholar] [CrossRef] [PubMed]
- Chung, I.H.; Kim, S.A.; Kim, S.; Lee, J.O.; Park, C.Y.; Lee, J.; Kang, J.; Lee, J.Y.; Seo, I.; Lee, H.J.; et al. Biglycan Reduces Body Weight by Regulating Food Intake in Mice and Improves Glucose Metabolism through AMPK/AKT Dual Pathways in Skeletal Muscle. FASEB J. 2021, 35, e21794. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
β-actin (Actb) | GGAGATTACTGCCCTGGCTCCTA | GACTCATCGTACTCCTGCTTGCTG |
Atrogin-1 (Fbxo32) | TCCAGACCCTCTACACATCCTT | CCTCTGCATGATGTTCAGTTGT |
MuRF1 (Trim63) | TGCATCTCCATGCTGGTGGC | CTTCTTCTCGTCCAGGATGG |
TGF-β (Tgfb1) | ATAGCAACAATTCCTGGCGTTACC | CACTGAAGCGAAAGCCCTGTATTT |
MHC1 (Myh7) | AGAGGAAGACAGGAAGAACCTAC | GGCTTCACAGGCATCCTTAG |
MEF2A (Mef2a) | ATGAGAGGAACCGACAGGTG | TATCCGAGTTCGTCCTGCTT |
Myoglobin (Mb) | CTAACAGCCGGCCTACACTC | CGTGCTTCTTCAGGTCCTCT |
Toroponin I (Tnni1) | CGAGCCCTACTGGGTTCCAA | CAGACATGGCCTCCACGTTC |
PGC-1α (Ppargc1a) | GACCCCAGAGTCACCAAATGA | GGCCTGCAGTTCCAGAGAGT |
Succinate dehydrogenase (Sdha) | TGGGGCGACTCGTGGCTTTC | CCCCGCCTGCACCTACAACC |
GLUT4 (Slc2a4) | GGGCGATTTCTCCCACATAC | CTCATGGGCCTAGCCAATG |
GPR43 (Ffar2) | CAGAGGAGAACCAGGTGGAAG | GGCAGGGACCCCAGTAAGAA |
NADH dehydrogenase 1, mitochondrial (mt-Nd1) | CTCCCTATTCGGAGCCCTAC | ATTTGTTTCTGCTAGGGTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maruta, H.; Abe, R.; Yamashita, H. Effect of Long-Term Supplementation with Acetic Acid on the Skeletal Muscle of Aging Sprague Dawley Rats. Int. J. Mol. Sci. 2022, 23, 4691. https://doi.org/10.3390/ijms23094691
Maruta H, Abe R, Yamashita H. Effect of Long-Term Supplementation with Acetic Acid on the Skeletal Muscle of Aging Sprague Dawley Rats. International Journal of Molecular Sciences. 2022; 23(9):4691. https://doi.org/10.3390/ijms23094691
Chicago/Turabian StyleMaruta, Hitomi, Reina Abe, and Hiromi Yamashita. 2022. "Effect of Long-Term Supplementation with Acetic Acid on the Skeletal Muscle of Aging Sprague Dawley Rats" International Journal of Molecular Sciences 23, no. 9: 4691. https://doi.org/10.3390/ijms23094691