Genome-Wide Analysis of the Mads-Box Transcription Factor Family in Solanum melongena
1
State Key Laboratory of Crop Biology, College of Horticulture Science and Engineering, Shandong Agricultural University, Tai’an 271018, China
2
Key Laboratory of Biology and Genetic Improvement of Horticultural Crop (Huang-Huai Region), Ministry of Agriculture and Rural Affairs, Tai’an 271018, China
3
Shandong Collaborative Innovation Center for Fruit and Vegetable Production with High Quality and Efficiency, Tai’an 271018, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(1), 826; https://doi.org/10.3390/ijms24010826
Submission received: 3 November 2022
/
Revised: 17 December 2022
/
Accepted: 29 December 2022
/
Published: 3 January 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Abstract
:The MADS-box transcription factors are known to be involved in several aspects of plant growth and development, especially in floral organ specification. However, little is known in eggplant. Here, 120 eggplant MADS-box genes were identified and categorized into type II (MIKCC and MIKC*) and type I (Mα, Mβ, and Mγ) subfamilies based on phylogenetic relationships. The exon number in type II SmMADS-box genes was greater than that in type I SmMADS-box genes, and the K-box domain was unique to type II MADS-box TFs. Gene duplication analysis revealed that segmental duplications were the sole contributor to the expansion of type II genes. Cis-elements of MYB binding sites related to flavonoid biosynthesis were identified in three SmMADS-box promoters. Flower tissue-specific expression profiles showed that 46, 44, 38, and 40 MADS-box genes were expressed in the stamens, stigmas, petals, and pedicels, respectively. In the flowers of SmMYB113-overexpression transgenic plants, the expression levels of 3 SmMADS-box genes were co-regulated in different tissues with the same pattern. Correlation and protein interaction predictive analysis revealed six SmMADS-box genes that might be involved in the SmMYB113-regulated anthocyanin biosynthesis pathway. This study will aid future studies aimed at functionally characterizing important members of the MADS-box gene family.
1. Introduction
In plants, MADS-box genes are one of the largest transcription factor (TF) families, and they play key roles in nearly every process related to plant growth and development [1,2,3]. The name MADS-box is derived from the initials of four TFs that were first discovered in this family: mini chromosome maintenance 1 (MCM1), agamous (AG), deficient (DEF), and serum response factor (SRF) [4]. MADS-box TFs have a highly conserved DNA-binding domain with approximately 60 amino acids at the N-terminus [5]. MADS-box TFs are divided into two distinct types according to their conserved protein domains and phylogenetic relationships: SRF-like (type I) and MEF2-like (type II) [6]. Type I proteins are composed of SRF-like domains and variable domains. Type I MADS-box genes can be further divided into three subgroups according to differences in their SRF-like domains: Mα, Mβ, and Mγ. Type II proteins are composed of a MEF2-like domain (M), intermediate domain (I), keratin-like domain (K), and a C-terminal domain. Type II proteins can be further subdivided into two subgroups, MIKCC and MIKC*, based on structural differences between the I and K domains [7].
The type I MADS-box genes are also known as M-type genes. According to previous studies, only a few of the type I MADS-box genes have biological characteristics [8]. In Arabidopsis, PHE1 controls endosperm gene imprinting and seed development [9]. In rice, OSMADS78 and OSMADS79 regulate rice seed development [9]. Type II MADS-box genes, also known as MIKC-type genes, play more roles in plant growth and development than type I MADS-box genes. The first MADS-box gene found in plants was a type-II MADS-box gene involved in flower development [4]. The MADS-box genes involved in regulating the ABCDE model are mostly type II MADS-box genes [10]. Type II MADS-box genes regulate floral organ development as well as flowering time. For example, FLC TFs play key roles in regulating flowering time in Arabidopsis, and genetic variation in FLC activity can alter or eliminate the requirement of vernalization in different Arabidopsis ecotypes [11]. In addition, type II MADS-box genes can regulate seed and fruit development. In grapes, VvAGL11 regulates seed development, and the length of an extended single sequence repeat in the VvAGL11 promoter region is inversely proportional to the degree of seed development [12,13]. In oil palm, SHELL regulates fruit morphology [14]. Recent studies have reported that MADS-box genes are involved in plant root development. In Arabidopsis, AGL12 regulates root meristem cell division and promotes the formation of root vascular tissue, which in turn regulates root structure and development [15].
MADS-box gene family members have been identified in many species. In Arabidopsis, 107 MADS-box gene family members have been identified, including 61 type I genes and 45 type II genes [16]. In rice, 76 MADS-box gene family members have been identified, including 32 type I genes and 44 type II genes [17]. In tomato, 107 MADS-box gene family members have been identified, including 53 type I genes and 54 type II genes [18]. In potatoes, 153 MADS-box gene family members have been identified, including 114 type I genes and 39 type II genes [19]. In cucumber, 44 MADS-box gene family members have been identified, including 10 type I genes and 33 type II genes [20].
Eggplant (Solanum melongena L.) is an economically important crop in the genus Solanum (family Solanaceae) [21]. Eggplant has a long history of cultivation in Asia, Africa, Europe, and other regions [22]. Eggplant is enriched in nutrients, especially anthocyanins [23,24], which can enhance eyesight and prevent cardiovascular disease. Both biotic and abiotic stresses can inhibit the development of floral organs, and anthocyanins play an important role in protecting plants from various stresses. So, increasing anthocyanin content is an important goal in eggplant breeding. Previous studies have shown that the MADS-box TF transparent testa 16 and 15 can regulate the accumulation of proanthocyanidins in the seed coat of Arabidopsis [25]. The MADS-box TF MdJa2 regulates the biosynthesis of anthocyanins and proanthocyanidins in red-fleshed apples through its role in the brassinosteroid signaling pathway [26]. No studies have examined the roles of MADS-box TFs in eggplant anthocyanin biosynthesis. Here, we studied eggplant MADS-box genes by conducting phylogenetic analysis, as well as analyses of the chromosomal locations of genes, gene structure, conserved motifs, and expression profiles. We also highlight the potential role of the MADS-box gene in flower development and anthocyanin biosynthesis in eggplant. Our findings provide new insights that will aid future studies aimed at clarifying the functions of the MADS-box gene in plants.
2. Results
2.1. Identification and Phylogenetic Analysis of SmMADS-Box Genes in Eggplant
Two bioinformatic approaches were used to identify MADS-box TFs in eggplant. A local BLASTP search with an e-value of 1 × 10−3 was performed using Arabidopsis MADS-box proteins as queries, which yielded 144 SmMADS-box candidate genes. A total of 151 coding sequences were identified based on recently published functional annotations (Pfam domain) in the SGN eggplant genome. These candidate genes were submitted to the NCBI CDD and Pfam databases to confirm the presence of the MADS-box domain. After removing redundant sequences, a total of 120 SmMADS-box genes were identified in eggplant. These genes were named SmMADS1 to 120 according to their chromosomal location and subfamily affiliation (Figure 1). The SGN site/gene name, amino acid sequence length, molecular weight, and pI of the 120 MADS-box genes are listed in Table A1. The predicted amino acid sequence lengths of the 120 SmMADS-box proteins ranged from 53 (SmMADS45) to 591 (SmMADS58), and the relative molecular weights ranged from 6018.15 Da (SmMADS45) to 65,950.08 Da (SmMADS58). pI ranged from 4.54 (SmMADS58) to 11.39 (SmMADS29). Most of the type II genes contained multiple exons, whereas the type I genes generally contained only one exon.
The protein sequences of 120 SmMADS-box TFs, 100 SlMADS-box TFs, and 102 AtMADS-box TFs were pre-matched using ClustalX (1.83), and the results were used to construct NJ trees with MAGE 11 with 1000 bootstrap replicates. According to the phylogenetic relationships of SmMADS-box proteins in Arabidopsis, tomato, and eggplant, the 120 SmMADS-box TFs were classified into 62 type I and 58 type II subfamilies (Figure 1). The 62 type I SmMADS-box TFs were divided into 40 Mα, 6 Mβ, and 14 Mγ genes. The 58 type II MADS-box TFs were further divided into 44 MIKCC and 14 MIKC* type genes.
2.2. Gene Structure and Conserved Motif Analysis of the 120 SmMADS-Box Tfs
To further analyze the composition of the 120 SmMADS-box TFs, the conserved motifs were analyzed using MEME online software. A total of 10 conserved motifs were identified, and these were referred to as motifs 110 (Figure 2b and Figure A1). The SmMADS-box domain consists of Motifs 1, 2, 3, and 6. Motif 7 contains the K domains, which play an important role in protein-protein interactions between SmMADS-box proteins; this domain is only present in type II SmMADS-box proteins (Figure 2b). Most of the type II genes contain multiple exons, and type I genes generally contain only one exon (Figure 2c).
2.3. Chromosomal Location, Gene Duplication, and Homology Analysis of the 120 SmMADS-Box Genes
TBtools software was used to map the physical position of the 120 SmMADS-box genes on the 12 chromosomes of eggplant; this information could aid future studies of the functions of SmMADS-box genes in eggplant. Based on the chromosomal locations of the 120 SmMADS-box genes, the three chromosomes with the most SmMADS-box genes are Chr01 (22 genes), Chr03 (15 genes), and Chr11 (12 genes) (Figure 3).
Gene duplication events in the SmMADS-box gene family were analyzed. A total of 31.6% (38 of 120) of SmMADS-box genes were derived from gene duplications (Figure 3 and Figure 4). Tandemly duplicated genes were mainly located on chromosome 1 and chromosome 11 and accounted for approximately 42.9% of tandemly duplicated genes. Among them, 17 tandemly duplicated genes were type II genes; 11 of these tandemly duplicated genes were type I genes (Figure 3). Among the 120 SmMADS-box genes, fragment repeats accounted for only 11.7% of all genes, and 100% of these genes were type II genes; two fragment repeats were observed in SmMADS12 and SmMADS23 (Figure 4). These findings indicate that fragment repeats and tandem repeats have played an important role in the expansion of type II genes, and tandem duplication has played a key role in the expansion of type I genes.
To further identify the homologs of the 120 SmMADS-box genes between eggplant and other plant species, the synteny of Arabidopsis and Solanum lycopersicum (tomato) plants with eggplant was analyzed by MCScanX. The results showed that 20 SmMADS-box genes were collinear with Arabidopsis genes and that 42 SmMADS-box genes were collinear with tomato genes (Figure 5). SmMADS13, SmMADS17, SmMADS36, and SmMADS44 were related to at least three pairs of homologs. We speculate that these genes might play important roles in the evolution of the MADS-box gene family. These findings indicate that MADS-box genes in Arabidopsis, eggplant, and tomato exhibit strong synteny.
2.4. Cis-Regulatory Elements in the Promoters of the 120 SmMADS-Box Genes
To clarify the biological pathways in which the 120 SmMADS-box genes participate in eggplant, cis-regulatory elements in the promoter sequences were analyzed. Four types of cis-elements were detected, including light-responsive, stress-responsive, hormone-responsive, and binding sites (Figure 6). The light-responsive elements were found in the promoters of 103 SmMADS-box genes, the hormone-responsive elements were found in the promoters of 116 SmMADS-box genes, and MYB binding sites were found in the promoters of 66 MADS-box genes. MYB-binding sites involved in flavonoid biosynthesis were found in SmMADS6, SmMADS58, and SmMADS107 (Figure 5).
2.5. Flower Tissue-Specific Expression Patterns of SmMADS-Box Genes
To explore the functions of SmMADS-box genes in flower development, the expression levels of SmMADS-box genes were characterized using the Log2 FKPM (fragments per kilobase transcript per million mapped fragments) method, and the data were normalized using the zero-to-one method according to RNA-seq data from stamens, stigmas, petals, and pedicels. The number of SmMADS-box genes expressed in different organs differed; specifically, 46, 44, 38, and 40 SmMADS-box genes were detected in stamens, stigmas, petals, and pedicels, respectively. The eggplant petals of the sequenced varieties were lavender, and no anthocyanin accumulation was detected in other floral organs; thus, SmMADS-box genes with higher expression levels in petals might be involved in anthocyanin biosynthesis. SmMADS3, SmMADS9, SmMADS12, SmMADS14, SmMADS15, SmMADS18, SmMADS24, SmMADS30, SmMADS33, and SmMADS35 were highly expressed in petals, suggesting that these SmMADS-box genes might be involved in anthocyanin biosynthesis (Figure 7).
2.6. Correlation Analysis of Eggplant SmMADS-Box Genes and SMMYB113
MYB binding sites involved in regulating flavonoid biosynthesis genes were identified in the promoter sequences of SmMADS6, SmMADS58, and SmMADS107 (Figure 6). SmMYB113 is an important regulator of anthocyanin biosynthesis [27,28]. The anthocyanin content was significantly higher in whole SmMYB113-overexpressing plants than in wild-type (WT) plants; the same difference was also observed in the stamens, petals, and pedicels. However, the flower abscission rate of SmMYB113-overexpression plants was significantly higher than that of WT plants. Therefore, we speculated that SmMYB113 might play a role in floral development.
To explore the relationship between SmMADS-box genes and SmMYB113, as well as their effects on floral development and anthocyanin biosynthesis, the expression level of SmMADS-box genes in SmMYB113-overexpressed flowers and the relationships between SmMADS-box genes and anthocyanin biosynthesis were analyzed. According to RNA-seq data from stamens, stigmas, petals, and pedicels, the expression levels of 33 SmMADS-box genes varied among floral organs; these included 29 genes in stamens, 31 genes in stigmas, 30 genes in petals, and 27 genes in pedicels. Further analysis revealed that the expression of 14 genes was up-regulated and the expression of 15 genes was down-regulated in the stamens. In the stigma, the expression of 18 genes and 13 genes was up-regulated and down-regulated, respectively. In the petals, the expression of 14 genes and 16 genes was up-regulated and down-regulated, respectively. In the pedicel, the expression of 15 genes and 12 genes was up-regulated and down-regulated, respectively (Figure 8). Further analysis revealed that the expression of three SmMADS-box genes might be regulated by SmMYB113, suggesting that SmMYB113 may be involved in flower organ formation by regulating the expression of SmMADS-box genes (Figure A2).
Given that the anthocyanin content was higher in the stamens, petals, and pedicels of SmMYB113-overexpression plants than in WT plants, and no significant differences in the anthocyanin content were observed in the stigmas of SmMYB113-overexpression plants and WT plants, we examined SmMADS-box genes that were differentially expressed in the stamens, petals, and pedicels. The expression of four SmMADS-box genes was co-upregulated by SmMYB113, and the expression of six SmMADS-box genes was co-downregulated by SmMYB113 (Figure 9). Correlations between the 10 SmMADS-box genes and 11 anthocyanin biosynthesis-related genes were analyzed using SPSS. The expression of SmMADS3 was significantly associated with the expression of SmF3H and SmTT8, the expression of SmMADS30 and SmMADS41 was significantly associated with the expression of SmDFR, and the expression of SmMADS28 and SmMADS103 was significantly associated with the expression of SmWRKY44. The above findings indicate that SmMADS3, SmMADS28, SmMADS30, SmMADS41, and SmMADS103 might be involved in the SmMYB113-regulated anthocyanin biosynthesis pathway (Figure 9).
2.7. Protein Interaction Predictive Analysis of SmMADS-Box Tfs and Anthocyanin Biosynthesis-Related Genes
To further analyze the role of these SmMADS-box TFs and determine whether they are involved in anthocyanin biosynthesis according to their expression patterns, STRING software was used to predict interaction networks between 10 SmMADS-box genes regulated by SmMYB113 and anthocyanin biosynthesis-related genes in the transcriptomes of different floral organs in eggplant. Anthocyanin biosynthesis-related genes were closely linked internally; anthocyanin biosynthesis-related genes and SmMADS-box genes were also linked. SmMADS75 was linked to SmWRKY44 (Figure 10), suggesting that this SmMADS-box gene might play a role in anthocyanin biosynthesis by affecting the expression of genes encoding TFs. In addition, SmMADS-box genes are also closely linked to each other, and it is speculated that SmMADS-box genes may participate in anthocyanin biosynthesis and play other roles through the same pathway. The relationships and functions within SmMADS-box genes, within anthocyanin biosynthesis-related genes, and between SmMADS-box and anthocyanin biosynthesis-related genes deserve our in-depth study and attention.
2.8. Effect of SMMYB113 Overexpression on the Expression Level of Six Selected Smmadx-Box Genes
Six SmMADS-box genes were identified as potentially involved in anthocyanin biosynthesis according to the expression profiles of SmMADS-box genes and protein interaction network analysis. qRT-PCR was conducted to validate the RNA-seq data (Figure 11). The expression patterns of the six SmMADS-box genes were basically consistent with the RNA-seq data, suggesting that the RNA-seq data were reliable.
3. Discussion
MADS-box genes regulate a variety of biological processes in plants, including vegetative and reproductive growth; they also play key roles in inflorescence, flower, and fruit development [29,30,31,32]. The publication of a greater number of high-quality genomes has aided genome-wide analyses. Several MADS-box gene family members have been identified in various plants, including Arabidopsis (107) [16], rice (75) [17], tomato (131) [18], potato (153) [19], bread wheat (300) [33], cucumber (43) [20], Brassica rapa (167) [34], radish (144) [35], apple (146) [36], sesame (57) [37], chrysanthemum (108) [38], and watermelon (39) [39]. In this study, 120 SmMADS-box genes were identified in eggplant. They were divided into type II (MIKCC and MIKC*) and type I (Mα, Mβ, and Mγ) subfamilies according to their phylogenetic relationships. The number of type II members is generally greater than the number of type I members [16,17,33,34,35,36,37,38]; in this study, the number of type I members was greater than the number of type II members in eggplant. In addition, the structure of type II SmMADS-box genes was more complex than that of type I genes because type II genes contained more exons than type I genes. Protein motif analysis showed that MADS-box genes all contained a conserved MADS domain, and the K-box domain was unique to type II MADS-box genes, suggesting that type II genes may have more diverse functions. These results are similar to the findings of previous studies in species such as Arabidopsis, rice, tomato, and potato. [16,17,18,19]. Gene duplication analysis revealed that tandem duplications have contributed to expansions of type I and type II genes in eggplant and segmental duplications have contributed to the expansion of type II genes. However, in Arabidopsis and potato, tandem and segmental duplications have both contributed to expansions of type I and type II genes [16,19]. In cucumber, only tandem duplications have been documented [20]. This suggests that gene duplication plays different roles in different species. 20 pairs of collinear MADS-box genes between eggplant and Arabidopsis and 42 pairs of collinear MADS-box genes between eggplant and tomato were further identified. The number of homologous events between eggplant and tomato was much larger than that between eggplant and Arabidopsis, which is consistent with the small evolutionary distance between eggplant and tomato.
The effects of MADS-box family members on floral organ development have been thoroughly investigated by previous authors in various species. In Arabidopsis, SOC1-like genes AGL42, AGL71, and AGL72 promote flowering in the shoot apical and axillary meristems [40]. Another study has shown that AGL42 regulates flower senescence in Arabidopsis [41]. The AGL62 MADS domain protein regulates cellularization during endosperm development in Arabidopsis [42]. In tomato, the MADS-box family members jointless (J), macrocaylyx (MC), and SLMBP21 form a complex that regulates the development of pedicel-free cells and thus flower abscission [43]. In bananas, MuMADS1 is involved in ethylene-induced fruit ripening [44]. In Japanese gentian, SEP proteins in control STK, AG, SHP1, and SHP2 form a multimeric complex to control normal ovule development [45]. Here, 46, 44, 38, and 40 MADS-box genes were highly expressed in stamens, stigmas, petals, and pedicels, respectively. SmMADS21 and SmMADS32 were highly expressed in the stigma, SmMADS86 was expressed in the stamen, SmMADS17 was highly expressed in the pedicel, and SmMADS24 was highly expressed in the petal, indicating that these genes might have specific functions in the structures in which they were most highly expressed. These findings will help to study the function of SmMADS-box genes in flower development. SmMYB113 is an important regulator of anthocyanin biosynthesis [27,28]. However, the flower abscission rate of SmMYB113-overexpression plants was significantly higher than that of WT plants. According to the RNA-seq data, the expression of SmMADS31, SmMADS75, and SmMADS103 was regulated by SmMYB113, and these genes are homologs of AGL42, AGL62, and AGL103 in Arabidopsis, respectively. Therefore, we speculated that SmMYB113 might be involved in regulating flower and leaf senescence, endosperm development, and the polar transport of growth hormone [46].
In some plants, MADS-box family genes are closely related to the differentiation of anthocyanins or proanthocyanidins, and these MADS-box genes that affect anthocyanin synthesis and accumulation are all type II genes. In orchids, OAP3, OAGL2, and OPI form a complex to regulate anthocyanin accumulation [47,48]. In kiwifruit, SVP3 regulates the transcription of the R2R3-MYB regulator MYB110a and the anthocyanin biosynthesis structural gene F3GT1, which affects petal pigmentation [49]. In Cineraria (Senecio cruentus), ScAG directly represses the transcription of ScF3H1, and ScAGL11 directly represses the expression of ScDFR3, respectively, affecting the biosynthesis of anthocyanins [50]. In this study, a total of six MADS-box genes that might be involved in anthocyanin biosynthesis were identified, including the type II MADS-box genes SmMADS3, SmMADS28, SmMADS30, and SmMADS41, and the type I MADS-box genes SmMADS75 and SmMADS103. These findings provide information that will aid future studies of the role of the SmMADS-box genes in anthocyanin biosynthesis. In addition, SmMADS-box genes were found to be associated with SmWRKY44 in the expression pattern, correlation, and interaction network analysis; SmWRKY44 might play an important role in regulating anthocyanin biosynthesis by modulating the expression of SmMADS-box genes.
4. Materials and Methods
4.1. Identification of MADS-Box Genes in Eggplant
First, Arabidopsis protein sequences were used as queries in local BLASTP searches [16] with an e-value of 1 × 10−3 to identify predicted eggplant MADS-box proteins [51]. Functional annotations were filtered using the Protein family database (Pfam) identifiers of the MADS and K domains (PF00319 and PF01486, respectively) [52]. All putative MADS-box sequences were collected, and redundant sequences were manually removed; the remaining candidate MADS-box sequences were subjected to NCBI Conserved Domain (CD) searches (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 30 September 2022) and Pfam Batch searches (https://pfam.xfam.org/, accessed on 30 September 2022) to confirm the existence of MADS-box domains. Next, we obtained DNA sequences based on their amino acid sequences from the SGN database. The physical and chemical parameters of SmMADS-box proteins, including the number of amino acids, molecular weight, and theoretical pI, were predicted using Expasy ProtParam (https://web.expasy.org/protparam/, accessed on 30 September 2022).
4.2. Phylogenetic, Conserved Motifs, and Gene Structure Analyses of MADS-Box Genes in Eggplant
Eggplant, tomato [18], and Arabidopsis [16] MADS-box protein sequences were aligned using ClustalX with default parameters, and the result was pruned using the Trimmer function in TBtools. Phylogenetic trees were generated using the neighbor-joining (NJ) method in MEGA11 with 1000 bootstrap replicates to evaluate node support [53]. The Interactive Tree of Life (iTOL) was used to visualize the phylogenetic tree (https://itol.embl.de/, accessed on 30 September 2022) [54,55].
The MEME Suite v5.4.1 online tool (http://meme-suite.org/meme/tools/meme, accessed on 21 October 2022) was used to predict the SmMADS-box conserved motifs [56]. The maximum number of motifs was set to 10, and other parameters were set to their default values. The structure of SmMADS-box genes and figures of gene structure were generated using Gene Structure View in TBtools.
4.3. Chromosomal Location, Gene Duplication, and Homology Analysiss
Using the GFF function in TBtools software, the GFF3 file downloaded from SGN (http://solgenomics.net/, accessed on 16 September 2022) was used to identify the position of MADS-box genes in the physical map of the eggplant genome [57]. Eggplant MADS-box genes were named based on the position information obtained from SGN. According to the nomenclature method used in rice, the eggplant MADS-box genes were named SmMADS1 to SmMADS120 following the order of MIKCC, MIKC*, Mα, Mβ, and Mγ. Using the genome file and GFF3 file downloaded from SGN and Ensembl Plants, the one-step MCScanX function in TBtools was used to analyze the collinearity of MADS-box genes, and the advanced Circos function in TBtools was used to draw the collinearity circle diagram [57,58]. The syntenic relationship between orthologous SmMADS-box genes of eggplant and other selected species was determined using the Dual Synteny Plotter tool in TBtools software. Tandemly duplicated genes were determined in SGN with the criterion that no more than one gene be shared between two genes with high homology (>50%).
4.4. Cis-Element Analysis
Cis-element analysis was conducted using 2.0-kb sequences upstream of the translational start site of SmMADS-box genes with the online PlantCARE tool (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 3 October 2022).
4.5. Expression Pattern and Correlation Analysis
The expression patterns of MADS-box genes in eggplant were analyzed using the RNA-seq data. SPSS statistics was used to conduct correlation analysis, and TBtools was used to make expression heatmaps and correlation heatmaps [57].
4.6. Interaction Network
The interaction network was built using STRING (functional protein association networks, Available online: https://string-db.org/, accessed on 15 December 2022) software through searches of multiple protein sequences [59].
4.7. Total RNA Extraction and qPCR Analysis
Total RNA was extracted from sepals, petals, stamens, and stigmas using the Trizol method for each tissue; there were three biological replicates for each sample. First-strand cDNA was synthesized using TransScript@ One-Step gDNA Removal and cDNA Synthesis SuperMix (TRANS) reagents. qRT-PCR was performed in a 7500 Real-Time PCR System using TB Green® Premix Ex TaqTM (Tli RNaseH Plus) (Takara) reagents. The 2−(ΔΔCT) method was used to calculate the relative expression levels of SmMADS-box genes [60]. The SmActin gene was used to normalize the qRT-PCR data. The primers are listed in Table A2.
5. Conclusions
In this study, a total of 120 SmMADS-box genes were identified, and these were classified into two types: type I (Mα, Mβ, Mγ) and type II (MIKCC, MIKC*) genes. Both types of MADS-box genes contain a conserved MADS structural domain, and the K-box structural domain is unique to type II MADS-box genes. Fragment duplication and tandem duplication have played an important role in the expansion of type II genes, and tandem duplication has played an important role in the expansion of type I genes. According to RNA-seq data, a total of 62 SmMADS-box genes were found to potentially be involved in floral organ development, and six SmMADS-box genes were potentially involved in the SmMYB113-regulated anthocyanin biosynthesis pathway. These findings indicate that MADS-box genes have many potential functions that merit further study. The large amounts of information on eggplant MADS-box gene family members obtained in this study enhance our understanding of the structure-function relationships among eggplant MADS-box gene family members. Our results will aid future studies aimed at clarifying the functions of eggplant MADS-box gene family members.
Author Contributions
Data curation, Q.C. and J.L.; Investigation, Q.C. and J.L.; Methodology, Q.C.; Project administration, Q.C.; Writing—original draft, Q.C.; Writing—review and editing, F.Y. and J.L. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the National Natural Sciences Foundations of China (grant number: 32172556), the Youth Project of Shandong Provincial Natural Science Foundation (grant number: ZR2020QC155), the Key Project of Shandong Provincial Natural Science Foundation (ZR2020KC039), and the Shandong Provincial Key Research and Development Program (2021LZGC017).
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki. This study did not include human samples, and it did not require the approval of the Institutional Review Board.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Appendix A
Table A1.
The detailed information of eggplant MADS-box gene family.
| Gene Name | Gene Locus | Protein | Exon | Type | Subfamily | ||
|---|---|---|---|---|---|---|---|
| Length (aa) | MW (Da) | pI | |||||
| SmMADS1 | SMEL4.1_01g007770.1 | 89 | 10,077.78 | 10.14 | 3 | Type II | MIKCC |
| SmMADS2 | SMEL4.1_01g008380.1 | 161 | 18,252.78 | 7.84 | 5 | Type II | MIKCC |
| SmMADS3 | SMEL4.1_01g016420.1 | 191 | 21,929.28 | 9.13 | 6 | Type II | MIKCC |
| SmMADS4 | SMEL4.1_01g016430.1 | 61 | 6963.16 | 11.29 | 1 | Type II | MIKCC |
| SmMADS5 | SMEL4.1_01g016450.1 | 254 | 28,691.55 | 8.73 | 8 | Type II | MIKCC |
| SmMADS6 | SMEL4.1_01g022190.1 | 273 | 30,804.84 | 5.88 | 7 | Type II | MIKCC |
| SmMADS7 | SMEL4.1_02g006940.1 | 223 | 25,119.47 | 9.00 | 9 | Type II | MIKCC |
| SmMADS8 | SMEL4.1_02g011710.1 | 235 | 27,308.08 | 9.43 | 6 | Type II | MIKCC |
| SmMADS9 | SMEL4.1_02g021760.1 | 223 | 25,814.66 | 9.70 | 6 | Type II | MIKCC |
| SmMADS10 | SMEL4.1_02g024180.1 | 121 | 13,446.38 | 10.30 | 3 | Type II | MIKCC |
| SmMADS11 | SMEL4.1_02g024190.1 | 61 | 6888.07 | 10.65 | 1 | Type II | MIKCC |
| SmMADS12 | SMEL4.1_02g026490.1 | 125 | 28,475.31 | 8.25 | 8 | Type II | MIKCC |
| SmMADS13 | SMEL4.1_02g026500.1 | 158 | 18,427.18 | 8.83 | 4 | Type II | MIKCC |
| SmMADS14 | SMEL4.1_03g008110.1 | 224 | 25,730.65 | 9.80 | 7 | Type II | MIKCC |
| SmMADS15 | SMEL4.1_03g010360.1 | 77 | 8983.52 | 10.69 | 1 | Type II | MIKCC |
| SmMADS16 | SMEL4.1_03g015990.1 | 82 | 9441.02 | 10.02 | 2 | Type II | MIKCC |
| SmMADS17 | SMEL4.1_03g022770.1 | 141 | 16,105.54 | 9.98 | 3 | Type II | MIKCC |
| SmMADS18 | SMEL4.1_03g027790.1 | 246 | 28,209.90 | 8.94 | 8 | Type II | MIKCC |
| SmMADS19 | SMEL4.1_03g027800.1 | 248 | 28,728.36 | 9.10 | 8 | Type II | MIKCC |
| SmMADS20 | SMEL4.1_04g005970.1 | 61 | 7065.29 | 10.65 | 1 | Type II | MIKCC |
| SmMADS21 | SMEL4.1_04g011260.1 | 186 | 21,740.04 | 8.81 | 6 | Type II | MIKCC |
| SmMADS22 | SMEL4.1_04g017530.1 | 205 | 23,042.58 | 8.43 | 6 | Type II | MIKCC |
| SmMADS23 | SMEL4.1_04g017760.1 | 61 | 6892.02 | 10.43 | 1 | Type II | MIKCC |
| SmMADS24 | SMEL4.1_04g021980.1 | 207 | 23,958.04 | 8.91 | 5 | Type II | MIKCC |
| SmMADS25 | SMEL4.1_05g017100.1 | 66 | 7668.98 | 10.62 | 2 | Type II | MIKCC |
| SmMADS26 | SMEL4.1_05g017110.1 | 248 | 28,275.08 | 8.45 | 6 | Type II | MIKCC |
| SmMADS27 | SMEL4.1_05g017480.1 | 228 | 26,042.78 | 7.13 | 8 | Type II | MIKCC |
| SmMADS28 | SMEL4.1_05g017490.1 | 148 | 16,831.34 | 6.91 | 5 | Type II | MIKCC |
| SmMADS29 | SMEL4.1_05g017760.1 | 86 | 9562.26 | 11.39 | 2 | Type II | MIKCC |
| SmMADS30 | SMEL4.1_05g022920.1 | 68 | 7793.10 | 10.28 | 2 | Type II | MIKCC |
| SmMADS31 | SMEL4.1_06g010960.1 | 64 | 7347.62 | 10.01 | 2 | Type II | MIKCC |
| SmMADS32 | SMEL4.1_06g018550.1 | 233 | 27,010.92 | 9.31 | 7 | Type II | MIKCC |
| SmMADS33 | SMEL4.1_06g022050.1 | 218 | 25,088.34 | 8.88 | 7 | Type II | MIKCC |
| SmMADS34 | SMEL4.1_07g020500.1 | 219 | 24,525.82 | 8.70 | 5 | Type II | MIKCC |
| SmMADS35 | SMEL4.1_08g015360.1 | 185 | 21,477.57 | 9.21 | 5 | Type II | MIKCC |
| SmMADS36 | SMEL4.1_08g022290.1 | 272 | 31,277.04 | 9.36 | 9 | Type II | MIKCC |
| SmMADS37 | SMEL4.1_10g015470.1 | 234 | 26,809.40 | 7.76 | 7 | Type II | MIKCC |
| SmMADS38 | SMEL4.1_10g025220.1 | 201 | 22,745.80 | 6.55 | 6 | Type II | MIKCC |
| SmMADS39 | SMEL4.1_11g000980.1 | 292 | 33,368.72 | 8.72 | 8 | Type II | MIKCC |
| SmMADS40 | SMEL4.1_11g015290.1 | 185 | 21,873.14 | 9.37 | 7 | Type II | MIKCC |
| SmMADS41 | SMEL4.1_11g015300.1 | 214 | 24,679.20 | 8.84 | 8 | Type II | MIKCC |
| SmMADS42 | SMEL4.1_12g007250.1 | 229 | 26,734.45 | 9.25 | 7 | Type II | MIKCC |
| SmMADS43 | SMEL4.1_12g007390.1 | 111 | 12,556.75 | 9.25 | 3 | Type II | MIKCC |
| SmMADS44 | SMEL4.1_03g026850.1 | 255 | 29,039.15 | 8.96 | 7 | Type II | MIKC* |
| SmMADS45 | SMEL4.1_04g015770.1 | 53 | 6018.15 | 10.10 | 2 | Type II | MIKC* |
| SmMADS46 | SMEL4.1_04g019230.1 | 312 | 35,774.12 | 5.30 | 8 | Type II | MIKC* |
| SmMADS47 | SMEL4.1_05g001970.1 | 359 | 41,450.34 | 6.77 | 10 | Type II | MIKC* |
| SmMADS48 | SMEL4.1_06g013880.1 | 138 | 15,508.61 | 5.41 | 5 | Type II | MIKC* |
| SmMADS49 | SMEL4.1_06g013910.1 | 220 | 24,584.16 | 8.57 | 7 | Type II | MIKC* |
| SmMADS50 | SMEL4.1_07g017280.1 | 197 | 21,873.74 | 5.82 | 8 | Type II | MIKC* |
| SmMADS51 | SMEL4.1_07g017290.1 | 197 | 21,755.52 | 5.09 | 8 | Type II | MIKC* |
| SmMADS52 | SMEL4.1_09g016090.1 | 77 | 8866.39 | 9.00 | 2 | Type II | MIKC* |
| SmMADS53 | SMEL4.1_09g016160.1 | 121 | 13,988.34 | 9.42 | 3 | Type II | MIKC* |
| SmMADS54 | SMEL4.1_09g016200.1 | 82 | 9597.44 | 9.47 | 2 | Type II | MIKC* |
| SmMADS55 | SMEL4.1_11g007660.1 | 58 | 6872.10 | 9.78 | 1 | Type II | MIKC* |
| SmMADS56 | SMEL4.1_11g007670.1 | 103 | 11,804.79 | 9.51 | 2 | Type II | MIKC* |
| SmMADS57 | SMEL4.1_11g007680.1 | 82 | 9657.53 | 9.89 | 2 | Type II | MIKC* |
| SmMADS58 | SMEL4.1_12g008860.1 | 591 | 65,950.08 | 4.54 | 11 | Type II | MIKC* |
| SmMADS59 | SMEL4.1_01g007470.1 | 208 | 23,518.86 | 9.94 | 1 | Type I | Mα |
| SmMADS60 | SMEL4.1_01g007480.1 | 333 | 37,709.97 | 9.10 | 5 | Type I | Mα |
| SmMADS61 | SMEL4.1_01g007490.1 | 208 | 23,394.70 | 10.00 | 1 | Type I | Mα |
| SmMADS62 | SMEL4.1_01g007510.1 | 221 | 25,061.62 | 9.37 | 1 | Type I | Mα |
| SmMADS63 | SMEL4.1_01g007520.1 | 234 | 26,183.44 | 6.76 | 1 | Type I | Mα |
| SmMADS64 | SMEL4.1_01g011870.1 | 199 | 21,962.69 | 7.69 | 1 | Type I | Mα |
| SmMADS65 | SMEL4.1_01g011880.1 | 157 | 17,748.33 | 9.87 | 1 | Type I | Mα |
| SmMADS66 | SMEL4.1_01g011890.1 | 107 | 11,605.35 | 9.94 | 2 | Type I | Mα |
| SmMADS67 | SMEL4.1_01g015320.1 | 197 | 22,125.41 | 8.88 | 2 | Type I | Mα |
| SmMADS68 | SMEL4.1_02g004220.1 | 82 | 9327.69 | 9.81 | 1 | Type I | Mα |
| SmMADS69 | SMEL4.1_02g004750.1 | 88 | 9891.25 | 8.74 | 1 | Type I | Mα |
| SmMADS70 | SMEL4.1_02g009330.1 | 163 | 18,034.52 | 6.74 | 1 | Type I | Mα |
| SmMADS71 | SMEL4.1_03g000810.1 | 177 | 20,440.99 | 6.76 | 1 | Type I | Mα |
| SmMADS72 | SMEL4.1_03g030700.1 | 176 | 20,252.33 | 8.78 | 1 | Type I | Mα |
| SmMADS73 | SMEL4.1_03g030950.1 | 177 | 20,399.58 | 8.45 | 1 | Type I | Mα |
| SmMADS74 | SMEL4.1_04g009890.1 | 131 | 15,092.25 | 8.57 | 2 | Type I | Mα |
| SmMADS75 | SMEL4.1_04g013110.1 | 213 | 24,212.58 | 7.53 | 1 | Type I | Mα |
| SmMADS76 | SMEL4.1_05g006350.1 | 196 | 21,900.60 | 5.10 | 1 | Type I | Mα |
| SmMADS77 | SMEL4.1_06g017190.1 | 160 | 18,834.31 | 9.25 | 1 | Type I | Mα |
| SmMADS78 | SMEL4.1_06g017740.1 | 195 | 21,797.04 | 9.34 | 1 | Type I | Mα |
| SmMADS79 | SMEL4.1_06g017750.1 | 221 | 24,990.43 | 9.06 | 1 | Type I | Mα |
| SmMADS80 | SMEL4.1_07g002870.1 | 154 | 17,280.80 | 9.60 | 1 | Type I | Mα |
| SmMADS81 | SMEL4.1_07g004050.1 | 177 | 20,399.58 | 8.45 | 1 | Type I | Mα |
| SmMADS82 | SMEL4.1_07g005030.1 | 82 | 9232.37 | 6.13 | 1 | Type I | Mα |
| SmMADS83 | SMEL4.1_07g005100.1 | 98 | 11,440.09 | 9.19 | 1 | Type I | Mα |
| SmMADS84 | SMEL4.1_07g005320.1 | 136 | 15,978.29 | 7.75 | 1 | Type I | Mα |
| SmMADS85 | SMEL4.1_08g005230.1 | 194 | 22,151.55 | 9.26 | 1 | Type I | Mα |
| SmMADS86 | SMEL4.1_08g014240.1 | 183 | 21,181.86 | 5.90 | 1 | Type I | Mα |
| SmMADS87 | SMEL4.1_09g003500.1 | 158 | 18,165.39 | 5.77 | 1 | Type I | Mα |
| SmMADS88 | SMEL4.1_09g006790.1 | 485 | 53,474.31 | 9.86 | 11 | Type I | Mα |
| SmMADS89 | SMEL4.1_09g019190.1 | 135 | 15,697.91 | 9.42 | 2 | Type I | Mα |
| SmMADS90 | SMEL4.1_10g002530.1 | 166 | 18,817.01 | 4.69 | 1 | Type I | Mα |
| SmMADS91 | SMEL4.1_10g002560.1 | 157 | 18,298.85 | 5.81 | 1 | Type I | Mα |
| SmMADS92 | SMEL4.1_10g002570.1 | 172 | 19,826.53 | 8.92 | 1 | Type I | Mα |
| SmMADS93 | SMEL4.1_10g018710.1 | 154 | 17,739.07 | 5.37 | 2 | Type I | Mα |
| SmMADS94 | SMEL4.1_10g018900.1 | 144 | 16,898.56 | 9.62 | 1 | Type I | Mα |
| SmMADS95 | SMEL4.1_11g020700.1 | 162 | 18,672.25 | 6.32 | 1 | Type I | Mα |
| SmMADS96 | SMEL4.1_11g022720.1 | 159 | 18,373.66 | 5.71 | 1 | Type I | Mα |
| SmMADS97 | SMEL4.1_12g006270.1 | 88 | 10,060.66 | 9.95 | 1 | Type I | Mα |
| SmMADS98 | SMEL4.1_12g017590.1 | 216 | 23,832.56 | 5.33 | 1 | Type I | Mα |
| SmMADS99 | SMEL4.1_12g017640.1 | 176 | 19,816.48 | 5.57 | 1 | Type I | Mα |
| SmMADS100 | SMEL4.1_01g000700.1 | 320 | 37,011.97 | 6.85 | 1 | Type I | Mβ |
| SmMADS101 | SMEL4.1_01g000740.1 | 312 | 35,650.71 | 6.16 | 1 | Type I | Mβ |
| SmMADS102 | SMEL4.1_01g000760.1 | 308 | 35,469.51 | 7.60 | 1 | Type I | Mβ |
| SmMADS103 | SMEL4.1_01g001040.1 | 129 | 14,916.10 | 8.96 | 1 | Type I | Mβ |
| SmMADS104 | SMEL4.1_03g020940.1 | 329 | 37,220.89 | 5.01 | 1 | Type I | Mβ |
| SmMADS105 | SMEL4.1_12g006420.1 | 296 | 33,732.90 | 4.72 | 1 | Type I | Mβ |
| SmMADS106 | SMEL4.1_12g006460.1 | 315 | 35,613.13 | 5.00 | 1 | Type I | Mβ |
| SmMADS107 | SMEL4.1_01g002320.1 | 239 | 27,173.99 | 9.18 | 1 | Type I | Mγ |
| SmMADS108 | SMEL4.1_01g006240.1 | 397 | 44,217.68 | 5.66 | 1 | Type I | Mγ |
| SmMADS109 | SMEL4.1_01g020650.1 | 318 | 35,923.03 | 7.92 | 1 | Type I | Mγ |
| SmMADS110 | SMEL4.1_03g004740.1 | 331 | 36,957.31 | 5.93 | 1 | Type I | Mγ |
| SmMADS111 | SMEL4.1_03g004770.1 | 243 | 28,181.97 | 6.24 | 1 | Type I | Mγ |
| SmMADS112 | SMEL4.1_03g004780.1 | 231 | 26,834.53 | 6.35 | 1 | Type I | Mγ |
| SmMADS113 | SMEL4.1_03g010570.1 | 180 | 20,547.28 | 6.75 | 1 | Type I | Mγ |
| SmMADS114 | SMEL4.1_04g005570.1 | 174 | 19,849.64 | 8.56 | 1 | Type I | Mγ |
| SmMADS115 | SMEL4.1_10g005130.1 | 164 | 19,207.47 | 9.28 | 1 | Type I | Mγ |
| SmMADS116 | SMEL4.1_10g006300.1 | 232 | 26,200.63 | 6.37 | 1 | Type I | Mγ |
| SmMADS117 | SMEL4.1_11g015800.1 | 397 | 44,978.00 | 5.89 | 1 | Type I | Mγ |
| SmMADS118 | SMEL4.1_11g016930.1 | 399 | 45,259.92 | 5.60 | 1 | Type I | Mγ |
| SmMADS119 | SMEL4.1_11g017020.1 | 245 | 28,156.78 | 9.01 | 1 | Type I | Mγ |
| SmMADS120 | SMEL4.1_11g017890.1 | 137 | 15,902.54 | 9.23 | 1 | Type I | Mγ |
Table A2.
List of primers used for qRT-PCR in this study.
| Primers | Sequence(5′—3′) |
|---|---|
| qPCR_SmMADS3_F | GACACCGTCTGACCAGGC |
| qPCR_SmMADS3_R | TAGCGGCGCTATCTCCGT |
| qPCR_SmMADS28_F | TCGTCCTCACGCTCAACG |
| qPCR_SmMADS28_R | AGGAAATCCGGTGTGGCG |
| qPCR_SmMADS30_F | CCCACCCAACTTTTTACCCG |
| qPCR_SmMADS30_R | AGACGGACTGAGAGAGCACT |
| qPCR_SmMADS41_F | AGACCTCGAACCCGTCCA |
| qPCR_SmMADS41_R | CCGATCGATGTTCGCCGA |
| qPCR_SmMADS75_F | ACGGGTGCTGAAATCGCT |
| qPCR_SmMADS75_R | ACTGCGTCAGGGCTAGGA |
| qPCR_SmMADS103_F | GCCATGGCGGAACAAGATC |
| qPCR_SmMADS103_R | TTCCCCATGAGGACCGGT |
Figure A1.
Multilevel consensus sequence among MADS-box genes in eggplant was identified by MEME.
Figure A2.
Veen diagram analysis of DEGs.
References
- Ng, M.; Yanofsky, M.F. Function and evolution of the plant MADS-box gene family. Nat. Rev. Genet. 2001, 2, 186–195. [Google Scholar] [CrossRef] [PubMed]
- Schilling, S.; Pan, S.; Kennedy, A.; Melzer, R. MADS-box genes and crop domestication: The jack of all traits. J. Exp. Bot. 2018, 69, 1447–1469. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Buylla, E.R.; García-Ponce, B.; Sánchez, M.P.; Espinosa-Soto, C.; García-Gómez, M.L.; Piñeyro-Nelson, A.; Garay-Arroyo, A. MADS-box genes underground becoming mainstream: Plant root developmental mechanisms. New Phytol. 2019, 223, 1143–1158. [Google Scholar] [CrossRef] [Green Version]
- Schwarz-Sommer, Z.; Huijser, P.; Nacken, W.; Saedler, H.; Sommer, H. Genetic Control of Flower Development by Homeotic Genes in Antirrhinum majus. Science 1990, 250, 931–936. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shore, P.; Sharrocks, A.D. The MADS-box family of transcription factors. Eur. J. Biochem. 1995, 229, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Gramzow, L.; Theissen, G. A hitchhiker’s guide to the MADS world of plants. Genome Biol. 2010, 11, 214. [Google Scholar] [CrossRef] [Green Version]
- Henschel, K.; Kofuji, R.; Hasebe, M.; Saedler, H.; Münster, T.; Theissen, G. Two ancient classes of MIKC-type MADS-box genes are present in the moss Physcomitrella patens. Mol. Biol. Evol. 2002, 19, 801–814. [Google Scholar] [CrossRef]
- Nam, J.; Kim, J.; Lee, S.; An, G.; Ma, H.; Nei, M. Type I MADS-box genes have experienced faster birth-and-death evolution than type II MADS-box genes in angiosperms. Proc. Natl. Acad. Sci. USA 2004, 101, 1910–1915. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Jiang, H.; Wang, G. PHERES1 Controls Endosperm Gene Imprinting and Seed Development. Trends Plant Sci. 2020, 25, 517–519. [Google Scholar] [CrossRef]
- Coito, J.L.; Silva, H.; Ramos, M.; Montez, M.; Cunha, J.; Amâncio, S.; Costa, M.; Rocheta, M. Vitis Flower Sex Specification Acts Downstream and Independently of the ABCDE Model Genes. Front. Plant Sci. 2018, 9, 1029. [Google Scholar] [CrossRef]
- Amasino, R.M.; Michaels, S.D. The timing of flowering. Plant Physiol. 2010, 154, 516–520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergamini, C.; Cardone, M.F.; Anaclerio, A.; Perniola, R.; Pichierri, A.; Genghi, R.; Alba, V.; Forleo, L.R.; Caputo, A.R.; Montemurro, C.; et al. Validation assay of p3_VvAGL11 marker in a wide range of genetic background for early selection of stenospermocarpy in Vitis vinifera L. Mol. Biotechnol. 2013, 54, 1021–1030. [Google Scholar] [CrossRef]
- Ocarez, N.; Mejia, N. Suppression of the D-class MADS-box AGL11 gene triggers seedlessness in fleshy fruits. Plant Cell Rep. 2016, 35, 239–254. [Google Scholar] [CrossRef]
- Singh, R.; Low, E.T.; Ooi, L.C.; Ong-Abdullah, M.; Ting, N.C.; Nagappan, J.; Nookiah, R.; Amiruddin, M.D.; Rosli, R.; Manaf, M.A.; et al. The oil palm SHELL gene controls oil yield and encodes a homologue of SEEDSTICK. Nature 2013, 500, 340–344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Montiel, G.; Gaudet, M.; Laurans, F.; Rozenberg, P.; Simon, M.; Gantet, P.; Jay-Allemand, C.; Breton, C. Overexpression of MADS-box Gene AGAMOUS-LIKE 12 Activates Root Development in Juglans sp. and Arabidopsis thaliana. Plants 2020, 9, 444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parenicová, L.; de Folter, S.; Kieffer, M.; Horner, D.S.; Favalli, C.; Busscher, J.; Cook, H.E.; Ingram, R.M.; Kater, M.M.; Davies, B.; et al. Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: New openings to the MADS world. Plant Cell 2003, 15, 1538–1551. [Google Scholar] [CrossRef] [Green Version]
- Arora, R.; Garwal, P.; Ray, S.; Singh, A.K.; Singh, V.P.; Tyagi, A.K.; Kapoor, S. MADS-box gene family in rice: Genome-wide identification, organization and expression profiling during reproductive development and stress. BMC Genom. 2007, 8, 242. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Zhang, J.; Hu, Z.; Guo, X.; Tian, S.; Chen, G. Genome-Wide Analysis of the MADS-Box Transcription Factor Family in Solanum lycopersicum. Int. J. Mol. Sci. 2019, 20, 2961. [Google Scholar] [CrossRef] [Green Version]
- Gao, H.; Wang, Z.; Li, S.; Hou, M.; Zhou, Y.; Zhao, Y.; Li, G.; Zhao, H.; Ma, H. Genome-wide survey of potato MADS-box genes reveals that StMADS1 and StMADS13 are putative downstream targets of tuberigen StSP6A. BMC Genom. 2018, 19, 726. [Google Scholar] [CrossRef] [Green Version]
- Hu, L.; Liu, S. Genome-wide analysis of the MADS-box gene family in cucumber. Genome 2012, 55, 245–256. [Google Scholar] [CrossRef]
- Añibarro-Ortega, M.; Pinela, J.; Alexopoulos, A.; Petropoulos, S.A.; Ferreira, I.; Barros, L. The powerful Solanaceae: Food and nutraceutical applications in a sustainable world. Adv. Food Nutr. Res. 2022, 100, 131–172. [Google Scholar] [PubMed]
- Weese, T.L.; Bohs, L. Eggplant origins: Out of Africa, into the Orient. Taxon 2010, 59, 49–56. [Google Scholar] [CrossRef]
- Gajewski, M.; Katarzyna, K.; Bajer, M. The Influence of Postharvest Storage on Quality Characteristics of Fruit of Eggplant Cultivars. Not. Bot. Horti Agrobot. Cluj-Napoca 2009, 37, 200–205. [Google Scholar]
- Hanson, P.M.; Yang, R.Y.; Tsou, S.C.S.; Ledesma, D.; Engle, L.; Lee, T.C. Diversity in eggplant (Solanum melongena) for superoxide scavenging activity, total phenolics, and ascorbic acid. J. Food Compos. Anal. 2006, 19, 594–600. [Google Scholar] [CrossRef]
- Xu, W.; Bobet, S.; Le Gourrierec, J.; Grain, D.; De Vos, D.; Berger, A.; Salsac, F.; Kelemen, Z.; Boucherez, J.; Rolland, A.; et al. TRANSPARENT TESTA 16 and 15 act through different mechanisms to control proanthocyanidin accumulation in Arabidopsis testa. J. Exp. Bot. 2017, 68, 2859–2870. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, M.; Wang, S.; Liu, W.; Yang, M.; Zhang, Z.; Wang, N.; Chen, X. MdJa2 Participates in the Brassinosteroid Signaling Pathway to Regulate the Synthesis of Anthocyanin and Proanthocyanidin in Red-Fleshed Apple. Front. Plant Sci. 2022, 13, 830349. [Google Scholar] [CrossRef]
- Cheng, L.; Li, R.; Wang, X.; Ge, S.; Wang, S.; Liu, X.; He, J.; Jiang, C.Z.; Qi, M.; Xu, T.; et al. A SlCLV3-SlWUS module regulates auxin and ethylene homeostasis in low light-induced tomato flower abscission. Plant Cell 2022, 34, 4388–4408. [Google Scholar] [CrossRef]
- Gonzalez, A.; Zhao, M.; Leavitt, J.M.; Lloyd, A. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J. 2008, 53, 814–827. [Google Scholar] [CrossRef]
- Yanofsky, M.F.; Ma, H.; Bowman, J.L.; Drews, G.N.; Feldmann, K.A.; Meyerowitz, E.M. The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 1990, 346, 35–39. [Google Scholar] [CrossRef]
- Krizek, B.A.; Meyerowitz, E.M. The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function. Development 1996, 122, 11–22. [Google Scholar] [CrossRef]
- Pelaz, S.; Ditta, G.S.; Baumann, E.; Wisman, E.; Yanofsky, M.F. B and C floral organ identity functions require SEPALLATA MADS-box genes. Nature 2000, 405, 200–203. [Google Scholar] [CrossRef] [PubMed]
- Mizzotti, C.; Ezquer, I.; Paolo, D.; Rueda-Romero, P.; Guerra, R.F.; Battaglia, R.; Rogachev, I.; Aharoni, A.; Kater, M.M.; Caporali, E.; et al. SEEDSTICK is a master regulator of development and metabolism in the Arabidopsis seed coat. PLoS Genet. 2014, 10, e1004856. [Google Scholar] [CrossRef] [PubMed]
- Raza, Q.; Riaz, A.; Atif, R.M.; Hussain, B.; Rana, I.A.; Ali, Z.; Budak, H.; Alaraidh, I.A. Genome-Wide Diversity of MADS-Box Genes in Bread Wheat is Associated with its Rapid Global Adaptability. Front. Genet. 2022, 12, 818880. [Google Scholar] [CrossRef] [PubMed]
- Saha, G.; Park, J.I.; Jung, H.J.; Ahmed, N.U.; Kayum, M.A.; Chung, M.Y.; Hur, Y.; Cho, Y.G.; Watanabe, M.; Nou, I.S. Genome-wide identification and characterization of MADS-box family genes related to organ development and stress resistance in Brassica rapa. BMC Genom. 2015, 16, 178. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Wang, Y.; Xu, L.; Nie, S.; Chen, Y.; Liang, D.; Sun, X.; Karanja, B.K.; Luo, X.; Liu, L. Genome-Wide Characterization of the MADS-Box Gene Family in Radish (Raphanus sativus L.) and Assessment of Its Roles in Flowering and Floral Organogenesis. Front. Plant Sci. 2016, 7, 1390. [Google Scholar] [CrossRef] [Green Version]
- Tian, Y.; Dong, Q.; Ji, Z.; Chi, F.; Cong, P.; Zhou, Z. Genome-wide identification and analysis of the MADS-box gene family in apple. Gene 2015, 555, 277–290. [Google Scholar] [CrossRef]
- Wei, X.; Wang, L.; Yu, J.; Zhang, Y.; Li, D.; Zhang, X. Genome-wide identification and analysis of the MADS-box gene family in sesame. Gene 2015, 569, 66–76. [Google Scholar] [CrossRef]
- Won, S.Y.; Jung, J.A.; Kim, J.S. Genome-wide analysis of the MADS-Box gene family in Chrysanthemum. Comput. Biol. Chem. 2021, 90, 107424. [Google Scholar] [CrossRef]
- Wang, P.; Wang, S.; Chen, Y.; Xu, X.; Guang, X.; Zhang, Y. Genome-wide Analysis of the MADS-Box Gene Family in Watermelon. Comput. Biol. Chem. 2019, 80, 341–350. [Google Scholar] [CrossRef]
- Dorca-Fornell, C.; Gregis, V.; Grandi, V.; Coupland, G.; Colombo, L.; Kater, M.M. The Arabidopsis SOC1-like genes AGL42, AGL71 and AGL72 promote flowering in the shoot apical and axillary meristems. Plant J. 2011, 67, 1006–1017. [Google Scholar] [CrossRef]
- Chen, M.K.; Hsu, W.H.; Lee, P.F.; Thiruvengadam, M.; Chen, H.-I.; Yang, C.-H. The MADS box gene, FOREVER YOUNG FLOWER, acts as a repressor controlling floral organ senescence and abscission in Arabidopsis. Plant J. 2011, 68, 168–185. [Google Scholar] [CrossRef] [PubMed]
- Kang, I.H.; Steffen, J.G.; Portereiko, M.F.; Lloyd, A.; Drews, G.N. The AGL62 MADS domain protein regulates cellularization during endosperm development in Arabidopsis. Plant Cell 2008, 20, 635–647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, D.; Wang, D.; Qin, Z.; Zhang, D.; Yin, L.; Wu, L.; Colasanti, J.; Li, A.; Mao, L. The SEPALLATA MADS-box protein SLMBP21 forms protein complexes with JOINTLESS and MACROCALYX as a transcription activator for development of the tomato flower abscission zone. Plant J. 2014, 77, 284–296. [Google Scholar] [CrossRef]
- Liu, J.; Xu, B.; Hu, L.; Li, M.; Su, W.; Wu, J.; Yang, J.; Jin, Z. Involvement of a banana MADS-box transcription factor gene in ethylene-induced fruit ripening. Plant Cell Rep. 2009, 28, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Nakatsuka, T.; Saito, M.; Yamada, E.; Fujita, K.; Yamagishi, N.; Yoshikawa, N.; Nishihara, M. Isolation and characterization of the C-class MADS-box gene involved in the formation of double flowers in Japanese gentian. BMC Plant Biol. 2015, 15, 182. [Google Scholar] [CrossRef] [Green Version]
- Figueiredo, D.D.; Batista, R.A.; Roszak, P.J.; Hennig, L.; Köhler, C. Auxin production in the endosperm drives seed coat development in Arabidopsis. eLife 2016, 5, e20542. [Google Scholar] [CrossRef]
- Hsu, H.F.; Chen, W.H.; Shen, Y.H.; Hsu, W.H.; Mao, W.T.; Yang, C.H. Multifunctional evolution of B and AGL6 MADS box genes in orchids. Nat. Commun. 2021, 12, 902. [Google Scholar] [CrossRef]
- Mao, W.T.; Hsu, H.F.; Hsu, W.H.; Li, J.Y.; Lee, Y.I.; Yang, C.H. The C-Terminal Sequence and PI motif of the Orchid (Oncidium Gower Ramsey) PISTILLATA (PI) Ortholog Determine its Ability to Bind AP3 Orthologs and Enter the Nucleus to Regulate Downstream Genes Controlling Petal and Stamen Formation. Plant Cell Physiol. 2015, 56, 2079–2099. [Google Scholar]
- Wu, R.; Wang, T.; McGie, T.; Voogd, C.; Allan, A.C.; Hellens, R.P.; Varkonyi-Gasic, E. Overexpression of the kiwifruit SVP3 gene affects reproductive development and suppresses anthocyanin biosynthesis in petals, but has no effect on vegetative growth, dormancy, or flowering time. J. Exp. Bot. 2014, 65, 4985–4995. [Google Scholar] [CrossRef] [Green Version]
- Qi, F.; Liu, Y.; Luo, Y.; Cui, Y.; Lu, C.; Li, H.; Huang, H.; Dai, S. Functional analysis of the ScAG and ScAGL11 MADS-box transcription factors for anthocyanin biosynthesis and bicolour pattern formation in Senecio cruentus ray florets. Hortic. Res. 2022, 9, uhac071. [Google Scholar] [CrossRef]
- Altschul, S.F.; Wootton, J.C.; Gertz, E.M.; Agarwala, R.; Morgulis, A.; Schäffer, A.A.; Yu, Y.K. Protein database searches using compositionally adjusted substitution matrices. FEBS J. 2005, 272, 5101–5109. [Google Scholar] [CrossRef] [PubMed]
- Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.; Tosatto, S.; Paladin, L.; Raj, S.; Richardson, L.J.; et al. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Ayaz, A.; Huang, H.; Zheng, M.; Zaman, W.; Li, D.; Saqib, S.; Zhao, H.; Lü, S. Molecular Cloning and Functional Analysis of GmLACS2-3 Reveals Its Involvement in Cutin and Suberin Biosynthesis along with Abiotic Stress Tolerance. Int. J. Mol. Sci. 2021, 22, 9175. [Google Scholar] [CrossRef]
- Ayaz, A.; Saqib, S.; Huang, H.; Zaman, W.; Lü, S.; Zhao, H. Genome-wide comparative analysis of long-chain acyl-CoA synthetases (LACSs) gene family: A focus on identification, evolution and expression profiling related to lipid synthesis. Plant Physiol. Biochem. 2021, 161, 1–11. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol Plant. 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [Green Version]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING v10: Protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015, 43, D447–D452. [Google Scholar] [CrossRef]
- Arocho, A.; Chen, B.; Ladanyi, M.; Pan, Q. Validation of the 2-DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of BCR-ABL P210 transcripts. Diagn. Mol. Pathol. 2006, 15, 56–61. [Google Scholar] [CrossRef]
Figure 1.
Phylogenetic analysis of MADS-box TFs from Arabidopsis, tomato, and eggplant. The MADS-box TFs from Arabidopsis and tomato are black. SmMADS-box genes are colored: red genes are MIKCC type, blue genes are MIKC* type, purple genes are Mα type, green genes are Mβ type, and yellow genes are Mγ type.
Figure 1.
Phylogenetic analysis of MADS-box TFs from Arabidopsis, tomato, and eggplant. The MADS-box TFs from Arabidopsis and tomato are black. SmMADS-box genes are colored: red genes are MIKCC type, blue genes are MIKC* type, purple genes are Mα type, green genes are Mβ type, and yellow genes are Mγ type.
Figure 2.
Phylogenetic relationships, conserved motifs, and gene structures of SmMADS-box genes. (a) The phylogenetic relationships of the 120 SmMADS-box TFs; 1000 bootstrap replicates were used to evaluate node support. (b) Conserved motifs from 120 SmMADS-box genes were analyzed using MEME. Rounded rectangles with different colors indicate different motifs. (c) The gene structures of the SmMADS-box genes were analyzed using TBtools. Exons and UTRs are colored in green and yellow boxes, respectively, and black lines represent introns.
Figure 2.
Phylogenetic relationships, conserved motifs, and gene structures of SmMADS-box genes. (a) The phylogenetic relationships of the 120 SmMADS-box TFs; 1000 bootstrap replicates were used to evaluate node support. (b) Conserved motifs from 120 SmMADS-box genes were analyzed using MEME. Rounded rectangles with different colors indicate different motifs. (c) The gene structures of the SmMADS-box genes were analyzed using TBtools. Exons and UTRs are colored in green and yellow boxes, respectively, and black lines represent introns.
Figure 3.
Physical map of 120 SmMADS-box genes in 12 chromosomes. The blue arcs in the graph correspond to genes that have undergone tandem duplications.
Figure 3.
Physical map of 120 SmMADS-box genes in 12 chromosomes. The blue arcs in the graph correspond to genes that have undergone tandem duplications.
Figure 4.
Segmental duplication of 120 SmMADS-box genes in 12 chromosomes. Genes linked with a line are pairs of segmentally duplicated genes.
Figure 4.
Segmental duplication of 120 SmMADS-box genes in 12 chromosomes. Genes linked with a line are pairs of segmentally duplicated genes.
Figure 5.
Syntenic relationships between homologous SmMADS-box genes of tomato and other species. The MADS-box gene pairs between different species are highlighted with different colored lines.
Figure 5.
Syntenic relationships between homologous SmMADS-box genes of tomato and other species. The MADS-box gene pairs between different species are highlighted with different colored lines.
Figure 6.
Cis-regulatory elements in the 2-kb upstream region of 120 SmMADS-box coding sequences. Rounded rectangles with different colors indicate different cis-acting elements.
Figure 6.
Cis-regulatory elements in the 2-kb upstream region of 120 SmMADS-box coding sequences. Rounded rectangles with different colors indicate different cis-acting elements.
Figure 7.
The expression levels of SmMADS-box genes in different floral organs. Redder colors indicate higher expression levels, and bluer colors indicate lower expression levels.
Figure 7.
The expression levels of SmMADS-box genes in different floral organs. Redder colors indicate higher expression levels, and bluer colors indicate lower expression levels.
Figure 8.
The differential expression of SmMADS-box genes in SmMYB113-overexpressed plants compared with WT plants. Redder colors indicate higher expression levels, and bluer colors indicate lower expression levels.
Figure 8.
The differential expression of SmMADS-box genes in SmMYB113-overexpressed plants compared with WT plants. Redder colors indicate higher expression levels, and bluer colors indicate lower expression levels.
Figure 9.
The expression correlation profiles of SmMADS-box genes in different floral tissues of SmMYB113-overexpressing plants and WT plants. Different colors indicate different correlations, with the highest in red and the lowest in blue. * indicates a significant level (p < 0.05) and ** indicates highly significant correlations (p < 0.01).
Figure 9.
The expression correlation profiles of SmMADS-box genes in different floral tissues of SmMYB113-overexpressing plants and WT plants. Different colors indicate different correlations, with the highest in red and the lowest in blue. * indicates a significant level (p < 0.05) and ** indicates highly significant correlations (p < 0.01).
Figure 10.
Protein-protein interaction network of SmMADS TFs. Edges indicate protein-protein associations.
Figure 10.
Protein-protein interaction network of SmMADS TFs. Edges indicate protein-protein associations.
Figure 11.
The expression analysis of SmMADS3, SmMADS28, SmMADS30, SmMADS41, SmMADS75, and SmMADS103 in wild-type and SmMYB113 overexpression eggplant. The expression of each gene in the petal of WT was set to 1. The qRT-PCR was calculated using 2−(ΔΔCT) method. The data are shown as ± SE (n = 3).
Figure 11.
The expression analysis of SmMADS3, SmMADS28, SmMADS30, SmMADS41, SmMADS75, and SmMADS103 in wild-type and SmMYB113 overexpression eggplant. The expression of each gene in the petal of WT was set to 1. The qRT-PCR was calculated using 2−(ΔΔCT) method. The data are shown as ± SE (n = 3).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Chen, Q.; Li, J.; Yang, F. Genome-Wide Analysis of the Mads-Box Transcription Factor Family in Solanum melongena. Int. J. Mol. Sci. 2023, 24, 826. https://doi.org/10.3390/ijms24010826
AMA Style
Chen Q, Li J, Yang F. Genome-Wide Analysis of the Mads-Box Transcription Factor Family in Solanum melongena. International Journal of Molecular Sciences. 2023; 24(1):826. https://doi.org/10.3390/ijms24010826
Chicago/Turabian StyleChen, Qi, Jing Li, and Fengjuan Yang. 2023. "Genome-Wide Analysis of the Mads-Box Transcription Factor Family in Solanum melongena" International Journal of Molecular Sciences 24, no. 1: 826. https://doi.org/10.3390/ijms24010826
APA StyleChen, Q., Li, J., & Yang, F. (2023). Genome-Wide Analysis of the Mads-Box Transcription Factor Family in Solanum melongena. International Journal of Molecular Sciences, 24(1), 826. https://doi.org/10.3390/ijms24010826
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
