Activity of FAAH-Inhibitor JZP327A in an Experimental Rat Model of Migraine
Abstract
:1. Introduction
2. Results
2.1. Open Field
2.2. Orofacial Formalin Test
2.3. Gene Expression
2.4. Lipid Levels
2.5. CGRP Serum Level
3. Discussion
Limitations of the Study
4. Materials and Methods
4.1. Animals
4.2. Drugs
4.3. Open Field Test
4.4. Orofacial Formalin Test
4.5. Gene Expression
4.6. AEA, 2-AG, PEA and OEA Assay
4.7. CGRP Serum Level
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Greco, R.; Gasperi, V.; Maccarrone, M.; Tassorelli, C. The Endocannabinoid System and Migraine. Exp. Neurol. 2010, 224, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Malhotra, R. Understanding Migraine: Potential Role of Neurogenic Inflammation. Ann. Indian Acad. Neurol. 2016, 19, 175–182. [Google Scholar] [CrossRef] [PubMed]
- Katona, I.; Freund, T.F. Endocannabinoid Signaling as a Synaptic Circuit Breaker in Neurological Disease. Nat. Med. 2008, 14, 923–930. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.C.; Mackie, K. Review of the Endocannabinoid System. Biol. Psychiatry Cogn. Neurosci. Neuroimaging 2021, 6, 607–615. [Google Scholar] [CrossRef]
- Lichtman, A.H.; Martin, B.R. Cannabinoid-Induced Antinociception Is Mediated by a Spinal A2-Noradrenergic Mechanism. Brain Res. 1991, 559, 309–314. [Google Scholar] [CrossRef]
- Cristino, L.; Bisogno, T.; Di Marzo, V. Cannabinoids and the Expanded Endocannabinoid System in Neurological Disorders. Nat. Rev. Neurol. 2020, 16, 9–29. [Google Scholar] [CrossRef]
- Nozaki, C.; Markert, A.; Zimmer, A. Inhibition of FAAH Reduces Nitroglycerin-Induced Migraine-like Pain and Trigeminal Neuronal Hyperactivity in Mice. Eur. Neuropsychopharmacol. 2015, 25, 1388–1396. [Google Scholar] [CrossRef]
- Greco, R.; Demartini, C.; Zanaboni, A.M.; Tumelero, E.; Reggiani, A.; Misto, A.; Piomelli, D.; Tassorelli, C. FAAH Inhibition as a Preventive Treatment for Migraine: A Pre-Clinical Study. Neurobiol. Dis. 2020, 134, 104624. [Google Scholar] [CrossRef]
- Greco, R.; Demartini, C.; Zanaboni, A.; Casini, I.; de Icco, R.; Reggiani, A.; Misto, A.; Piomelli, D.; Tassorelli, C. Characterization of the Peripheral FAAH Inhibitor, URB937, in Animal Models of Acute and Chronic Migraine. Neurobiol. Dis. 2021, 147, 105157. [Google Scholar] [CrossRef]
- Greco, R.; Demartini, C.; Zanaboni, A.M.; Francavilla, M.; Reggiani, A.; Realini, N.; Scarpelli, R.; Piomelli, D.; Tassorelli, C. Potentiation of Endocannabinoids and Other Lipid Amides Prevents Hyperalgesia and Inflammation in a Pre-Clinical Model of Migraine. J. Headache Pain 2022, 23, 79. [Google Scholar] [CrossRef]
- Kakkar, S.; Narasimhan, B. A Comprehensive Review on Biological Activities of Oxazole Derivatives. BMC Chem. 2019, 13, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tripathi, R.K.P. A Perspective Review on Fatty Acid Amide Hydrolase (FAAH) Inhibitors as Potential Therapeutic Agents. Eur. J. Med. Chem. 2020, 188, 111953. [Google Scholar] [CrossRef] [PubMed]
- Greco, R.; Bandiera, T.; Mangione, A.S.; Demartini, C.; Siani, F.; Nappi, G.; Sandrini, G.; Guijarro, A.; Armirotti, A.; Piomelli, D.; et al. Effects of Peripheral FAAH Blockade on NTG-Induced Hyperalgesia—Evaluation of URB937 in an Animal Model of Migraine. Cephalalgia 2015, 35, 1065–1076. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Compton, D.R.; Martin, B.R. The Effect of the Enzyme Inhibitor Phenylmethylsulfonyl Fluoride on the Pharmacological Effect of Anandamide in the Mouse Model of Cannabimimetic Activity. J. Pharmacol. Exp. Ther. 1997, 283, 1138–1143. [Google Scholar] [PubMed]
- Greco, R.; Demartini, C.; Francavilla, M.; Zanaboni, A.M.; Tassorelli, C. Dual Inhibition of Faah and Magl Counteracts Migraine-like Pain and Behavior in an Animal Model of Migraine. Cells 2021, 10, 2543. [Google Scholar] [CrossRef] [PubMed]
- Tarzia, G.; Duranti, A.; Tontini, A.; Piersanti, G.; Mor, M.; Rivara, S.; Plazzi, P.V.; Park, C.; Kathuria, S.; Piomelli, D. Design, Synthesis, and Structure−Activity Relationships of Alkylcarbamic Acid Aryl Esters, a New Class of Fatty Acid Amide Hydrolase Inhibitors. J. Med. Chem. 2003, 46, 2352–2360. [Google Scholar] [CrossRef] [Green Version]
- Mor, M.; Lodola, A.; Rivara, S.; Vacondio, F.; Duranti, A.; Tontini, A.; Sanchini, S.; Piersanti, G.; Clapper, J.R.; King, A.R.; et al. Synthesis and Quantitative Structure−Activity Relationship of Fatty Acid Amide Hydrolase Inhibitors: Modulation at the N-Portion of Biphenyl-3-Yl Alkylcarbamates. J. Med. Chem. 2008, 51, 3487–3498. [Google Scholar] [CrossRef] [Green Version]
- Ahn, K.; Johnson, D.S.; Fitzgerald, L.R.; Liimatta, M.; Arendse, A.; Stevenson, T.; Lund, E.T.; Nugent, R.A.; Nomanbhoy, T.K.; Alexander, J.P.; et al. Novel Mechanistic Class of Fatty Acid Amide Hydrolase Inhibitors with Remarkable Selectivity. Biochemistry 2007, 46, 13019–13030. [Google Scholar] [CrossRef] [Green Version]
- Kathuria, S.; Gaetani, S.; Fegley, D.; Valiño, F.; Duranti, A.; Tontini, A.; Mor, M.; Tarzia, G.; la Rana, G.; Calignano, A.; et al. Modulation of Anxiety through Blockade of Anandamide Hydrolysis. Nat. Med. 2003, 9, 76–81. [Google Scholar] [CrossRef]
- Patel, J.Z.; Parkkari, T.; Laitinen, T.; Kaczor, A.A.; Saario, S.M.; Savinainen, J.R.; Navia-Paldanius, D.; Cipriano, M.; Leppänen, J.; Koshevoy, I.O.; et al. Chiral 1,3,4-Oxadiazol-2-Ones as Highly Selective FAAH Inhibitors. J. Med. Chem. 2013, 56, 8484–8496. [Google Scholar] [CrossRef]
- Käsnänen, H.; Minkkilä, A.; Taupila, S.; Patel, J.Z.; Parkkari, T.; Lahtela-Kakkonen, M.; Saario, S.M.; Nevalainen, T.; Poso, A. 1,3,4-Oxadiazol-2-Ones as Fatty-Acid Amide Hydrolase and Monoacylglycerol Lipase Inhibitors: Synthesis, in Vitro Evaluation and Insight into Potency and Selectivity Determinants by Molecular Modelling. Eur. J. Pharm. Sci. 2013, 49, 423–433. [Google Scholar] [CrossRef] [PubMed]
- della Pietra, A.; Giniatullin, R.; Savinainen, J.R. Distinct Activity of Endocannabinoid-Hydrolyzing Enzymes MAGL and FAAH in Key Regions of Peripheral and Central Nervous System Implicated in Migraine. Int. J. Mol. Sci. 2021, 22, 1204. [Google Scholar] [CrossRef] [PubMed]
- Demartini, C.; Greco, R.; Francavilla, M.; Zanaboni, A.M.; Tassorelli, C. Modelling Migraine-Related Features in the Nitroglycerin Animal Model: Trigeminal Hyperalgesia Is Associated with Affective Status and Motor Behavior. Physiol. Behav. 2022, 256, 113956. [Google Scholar] [CrossRef] [PubMed]
- Chang, L.; Luo, L.; Palmer, J.A.; Sutton, S.; Wilson, S.J.; Barbier, A.J.; Breitenbucher, J.G.; Chaplan, S.R.; Webb, M. Inhibition of Fatty Acid Amide Hydrolase Produces Analgesia by Multiple Mechanisms. Br. J. Pharmacol. 2006, 148, 102–113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strecker, T.; Messlinger, K. Neuropeptide Release in the Dura Mater Encephali in Response to Nitric Oxide—Relevance for the Development of Vascular Headaches? Schmerz 2003, 17, 179–184. [Google Scholar] [CrossRef]
- Reuter, U.; Bolay, H.; Jansen-Olesen, I.; Chiarugi, A.; Del Rio, M.S.; Letourneau, R.; Theoharides, T.C.; Waeber, C.; Moskowitz, M.A. Delayed Inflammation in Rat Meninges: Implications for Migraine Pathophysiology. Brain 2001, 124 Pt 12, 2490–2502. [Google Scholar] [CrossRef]
- Ebersberger, A.; Averbeck, B.; Messlinger, K.; Reeh, P.W. Release of Substance P, Calcitonin Gene-Related Peptide and Prostaglandin E2 from Rat Dura Mater Encephali Following Electrical and Chemical Stimulation in Vitro. Neuroscience 1999, 89, 901–907. [Google Scholar] [CrossRef]
- Kresse, A.; Jacobowitz, D.M.; Skofitsch, G. Detailed Mapping of CGRP MRNA Expression in the Rat Central Nervous System: Comparison with Previous Immunocytochemical Findings. Brain Res. Bull. 1995, 36, 261–274. [Google Scholar] [CrossRef]
- Ma, W.; Chabot, J.G.; Powell, K.J.; Jhamandas, K.; Dickerson, I.M.; Quirion, R. Localization and Modulation of Calcitonin Gene-Related Peptide-Receptor Component Protein-Immunoreactive Cells in the Rat Central and Peripheral Nervous Systems. Neuroscience 2003, 120, 677–694. [Google Scholar] [CrossRef]
- Durham, P.L.; Masterson, C.G. Two Mechanisms Involved in Trigeminal CGRP Release: Implications for Migraine Treatment. Headache 2013, 53, 67–80. [Google Scholar] [CrossRef] [Green Version]
- Murataeva, N.; Straiker, A.; MacKie, K. Parsing the Players: 2-Arachidonoylglycerol Synthesis and Degradation in the CNS. Br. J. Pharmacol. 2014, 171, 1379–1391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Starowicz, K.; Makuch, W.; Korostynski, M.; Malek, N.; Slezak, M.; Zychowska, M.; Petrosino, S.; De Petrocellis, L.; Cristino, L.; Przewlocka, B.; et al. Full Inhibition of Spinal FAAH Leads to TRPV1-Mediated Analgesic Effects in Neuropathic Rats and Possible Lipoxygenase-Mediated Remodeling of Anandamide Metabolism. PLoS ONE 2013, 8, e60040. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holt, S.; Comelli, F.; Costa, B.; Fowler, C.J. Inhibitors of Fatty Acid Amide Hydrolase Reduce Carrageenan-Induced Hind Paw Inflammation in Pentobarbital-Treated Mice: Comparison with Indomethacin and Possible Involvement of Cannabinoid Receptors. Br. J. Pharmacol. 2005, 146, 467–476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Panlilio, L.V.; Justinova, Z.; Goldberg, S.R. Inhibition of FAAH and Activation of PPAR: New Approaches to the Treatment of Cognitive Dysfunction and Drug Addiction. Pharmacol. Ther. 2013, 138, 84–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jayamanne, A.; Greenwood, R.; Mitchell, V.A.; Aslan, S.; Piomelli, D.; Vaughan, C.W. Actions of the FAAH Inhibitor URB597 in Neuropathic and Inflammatory Chronic Pain Models. Br. J. Pharmacol. 2006, 147, 281–288. [Google Scholar] [CrossRef] [Green Version]
- Rouzer, C.A.; Marnett, L.J. Endocannabinoid Oxygenation by Cyclooxygenases, Lipoxygenases, and Cytochromes P450: Cross-Talk between the Eicosanoid and Endocannabinoid Signaling Pathways. Chem. Rev. 2011, 111, 5899–5921. [Google Scholar] [CrossRef]
- Zelasko, S.; Arnold, W.R.; Das, A. Endocannabinoid Metabolism by Cytochrome P450 Monooxygenases. Prostaglandins Other Lipid Mediat. 2015, 117, 112–123. [Google Scholar] [CrossRef]
- Fanelli, F.; di Lallo, V.D.; Belluomo, I.; de Iasio, R.; Baccini, M.; Casadio, E.; Gasparini, D.I.; Colavita, M.; Gambineri, A.; Grossi, G.; et al. Estimation of Reference Intervals of Five Endocannabinoids and Endocannabinoid Related Compounds in Human Plasma by Two Dimensional-LC/MS/MS. J. Lipid Res. 2012, 53, 481–493. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer |
---|---|---|
GAPDH | AACCTGCCAAGTATGATGAC | GGAGTTGCTGTTGAAGTCA |
CGRP alpha (CGRP) | CAGTCTCAGCTCCAAGTCATC | TTCCAAGGTTGACCTCAAAG |
IL-6 | TTCTCTCCGCAAGAGACTTC | GGTCTGTTGTGGGTGGTATC |
TNF-alpha | CCTCACACTCAGATCATCTTCTC | CGCTTGGTGGTTTGCTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Greco, R.; Francavilla, M.; Demartini, C.; Zanaboni, A.M.; Facchetti, S.; Palmisani, M.; Franco, V.; Tassorelli, C. Activity of FAAH-Inhibitor JZP327A in an Experimental Rat Model of Migraine. Int. J. Mol. Sci. 2023, 24, 10102. https://doi.org/10.3390/ijms241210102
Greco R, Francavilla M, Demartini C, Zanaboni AM, Facchetti S, Palmisani M, Franco V, Tassorelli C. Activity of FAAH-Inhibitor JZP327A in an Experimental Rat Model of Migraine. International Journal of Molecular Sciences. 2023; 24(12):10102. https://doi.org/10.3390/ijms241210102
Chicago/Turabian StyleGreco, Rosaria, Miriam Francavilla, Chiara Demartini, Anna Maria Zanaboni, Sara Facchetti, Michela Palmisani, Valentina Franco, and Cristina Tassorelli. 2023. "Activity of FAAH-Inhibitor JZP327A in an Experimental Rat Model of Migraine" International Journal of Molecular Sciences 24, no. 12: 10102. https://doi.org/10.3390/ijms241210102