Next Article in Journal
The Effects of 2′-Hydroxy-3,6′-Dimethoxychalcone on Melanogenesis and Inflammation
Next Article in Special Issue
Normoferremia in Patients with Acute Bacterial Infections—A Hitherto Unexplored Field of the Dichotomy between CRP and Ferritin Expression in Patients with Hyper Inflammation and Failure to Increase Ferritin
Previous Article in Journal
Weak, Broken, but Working—Intramolecular Hydrogen Bond in 2,2′-bipyridine
Previous Article in Special Issue
LDL Affects the Immunomodulatory Response of Endothelial Cells by Modulation of the Promyelocytic Leukemia Protein (PML) Expression via PKC
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 12
10.3390/ijms241210397
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Modified Glucosamine on the Chondrogenic Potential of Circulating Stem Cells under Experimental Inflammation

by
Marco Gasparella
1,
Carola Cenzi
2,
Monica Piccione
2,
Valentina Noemi Madia
3,
Roberto Di Santo
3,
Valeria Tudino
3,
Marco Artico
4,
Samanta Taurone
5,
Chiara De Ponte
4,
Roberta Costi
3,*,† and
Rosa Di Liddo
2,*,†
1
Local Health Unit Treviso, Department of Pediatric Surgery, 31100 Treviso, Italy
2
Department of Pharmaceutical and Pharmacological Sciences, University of Padova, 35131 Padova, Italy
3
Department of Drug Chemistry and Technology, University of Rome “La Sapienza”, 00185 Rome, Italy
4
Department of Sensory Organs, University of Rome “La Sapienza”, 00185 Rome, Italy
5
Department of Movement, Human and Health Sciences-Division of Health Sciences, University of Rome “Foro Italico”, 00185 Rome, Italy
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(12), 10397; https://doi.org/10.3390/ijms241210397
Submission received: 24 December 2022 / Revised: 5 June 2023 / Accepted: 16 June 2023 / Published: 20 June 2023
(This article belongs to the Special Issue Regulation of Inflammatory Reactions in Health and Disease 2.0)
Browse Figures
Versions Notes

Abstract

:
Glucosamine (GlcN) is a glycosaminoglycan (GAGs) constituent in connective tissues. It is naturally produced by our body or consumed from diets. In the last decade, in vitro and in vivo trials have demonstrated that the administration of GlcN or its derivates has a protective effect on cartilage when the balance between catabolic and anabolic processes is disrupted and cells are no longer able to fully compensate for the loss of collagen and proteoglycans. To date, these benefits are still controversial because the mechanism of action of GlcN is not yet well clarified. In this study, we have characterized the biological activities of an amino acid (AA) derivate of GlcN, called DCF001, in the growth and chondrogenic induction of circulating multipotent stem cells (CMCs) after priming with tumor necrosis factor-alpha (TNFα), a pleiotropic cytokine commonly expressed in chronic inflammatory joint diseases. In the present work, stem cells were isolated from the human peripheral blood of healthy donors. After priming with TNFα (10 ng/mL) for 3 h, cultures were treated for 24 h with DCF001 (1 μg/mL) dissolved in a proliferative (PM) or chondrogenic (CM) medium. Cell proliferation was analyzed using a Corning® Cell Counter and trypan blue exclusion technique. To evaluate the potentialities of DCF001 in counteracting the inflammatory response to TNFα, we measured the amount of extracellular ATP (eATP) and the expression of adenosine-generating enzymes CD39/CD73, TNFα receptors, and NF-κB inhibitor IκBα using flow cytometry. Finally, total RNA was extracted to perform a gene expression study of some chondrogenic differentiation markers (COL2A1, RUNX2, and MMP13). Our analysis has shed light on the ability of DCF001 to (a) regulate the expression of CD39, CD73, and TNF receptors; (b) modulate eATP under differentiative induction; (c) enhance the inhibitory activity of IκBα, reducing its phosphorylation after TNFα stimulation; and (d) preserve the chondrogenic potentialities of stem cells. Although preliminary, these results suggest that DCF001 could be a valuable supplement for ameliorating the outcome of cartilage repair interventions, enhancing the efficacy of endogenous stem cells under inflammatory stimuli.

1. Introduction

Glucosamine (GlcN) (179.17 g/mol) comprises modified glucose with an amine group replacing the hydroxyl group on carbon two [1]. It is distributed throughout the human body (i.e., skin, tendons, ligaments, and cartilage) as an essential component of glycoproteins, proteoglycans, and glycosaminoglycans [2]. It is synthesized via the hexosamine biosynthetic pathway from fructose 6-phosphate and glutamine [3] and then metabolized into GlcNAc for the synthesis of glycosylated proteins and lipids [4,5]. In addition to biochemical functions and significant contributions to tissue structural scaffolding, cell hydration, and cell signaling [6], GlcN and its acetylated derivatives represent one of the most popular over-the-counter (OTC) dietary supplements to prevent or treat a wide variety of inflammatory diseases of the central nervous system [7] and the connective tissues [8,9]. Indeed, Grigorian et al. [7] demonstrated that N-acetylglucosamine inhibits T-helper 1 (Th1) and T-helper 17 (Th17) responses and attenuates the clinical severity of myelin-oligodendrocyte-glycoprotein-induced experimental autoimmune encephalomyelitis (EAE) when administered after disease onset. Moreover, although the efficacy of GlcN in the treatment of chronic cartilage inflammation is still a controversial issue, glucosamine is included in the class of symptomatic slow-acting drugs for osteoarthritis (OA) and is recommended by most European scholarly societies to provide some pain relief in people with osteoarthritis of the knee [9,10,11,12,13]. To date, the common forms of GlcN supplements comprise glucosamine hydrochloride, glucosamine sulfate, and N-acetyl glucosamine [14]. They are usually prepared from chitin via chemical and enzymatic hydrolysis and microbial production [15,16,17,18,19,20,21,22]. Furthermore, the production of these amino sugars from microbial fermentation processes is also performed using fungi or genetically modified bacteria [23]. Pharmacokinetic studies have shown that very large doses of glucosamine (1500 mg/day, ~23 mg/Kg) could be administered orally without evidence of toxicity, but the required therapeutic concentration to inhibit cartilage inflammation is not always reached in plasma and tissue [9,24,25,26,27]. To resolve the stability issues associated with GlcN and GlcNAc, different formulations of this dietary supplement have been developed [25,28,29] to enhance its gut absorption and bioavailability. When administered as a nutraceutical [25], GlcN uptake in cells occurs upon insulin stimulation [30] and via glucose transporters (GLUT1, 2, and 4) [31]. Thus, GlcN is phosphorylated into GlcN-6-phosphate by hexokinases and converted into uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc) via the hexosamine biosynthetic pathway [31]. Thereafter, UDP-GlcNAc is used as a donor substrate by O-linked-N-acetylglucosamine (O-GlcNAc) transferase (OGT), which catalyzes the transfer of O-GlcNAc to a hydroxy group of serine and threonine residues in the target proteins [32]. It is known that O-GlcNAc modification is one of the principal post-transcriptional modifications, and it is observed in several cellular functions, including gene expression, signal transduction, and the subcellular localization of proteins [33]. Under chronic inflammation, the altered form of amino sugars or the depletion of proteoglycans due to the excessive production of matrix metalloproteinases (MMPs) may cause tissue repair defects and pathologies [34,35]. For instance, the lack of proteoglycan precursors has been correlated with the structural and functional defects of skeletal joints [36]. Notably, in the gut mucosa, the alteration of matrix GAGs is frequently observed in bowel diseases, such as ulcers, colitis, chronic proctitis, and Crohn’s disease [37]. Since it is a component of hyaluronic acid, which is largely expressed in cartilage, connective tissue, and synovial fluid, GlcN is estimated to maintain the structure and function of joints [36,37]. In vitro and in vivo settings have demonstrated that GlcN and its derivates exert both anti-inflammatory and chondroprotective effects [7,22,26,38,39,40,41,42]. In particular, they have been shown to suppress the production of inflammatory mediators in vitro (i.e., nitric oxide, prostaglandin E2, and interleukin (IL)-1β and IL-8) in both chondrocytes [43,44,45,46] and synovial cells [47]. Similarly, under in vivo settings, the oral treatment with GlcN alone [5,9,11,26,48,49,50] or in combination with chondroitin sulfate [51,52] or the treatment with glucosamine sulfate combined with etoricoxib [53] was demonstrated to modulate the inflammatory process, decrease collagen degradation by inhibiting the synthesis of MMPs (i.e., MMP13) [39,40], and contextually stimulate the production of cartilage structural components (i.e., collagen II, aggrecan, and sulfated GAG) [38,54], thus limiting the degradation of tissue extracellular matrix. To date, the detailed mechanism by which GlcN downregulates cartilage inflammation is still under evaluation. Several studies suggest that the antioxidant and anti-inflammatory activities of glucosamine are mostly exerted by (i) the modulation of NF-κB by IKKalpha kinase inhibition [26,43] or (ii) the regulation of TNFα signaling [44]. The regulation of the NF-κB inflammatory pathway is mediated by inhibitors belonging to the IκB family, such as IκBα [55]. IκB is an intrinsically unstable protein [56] that exists as two distinct pools in cells: The larger IκB pool binds and retains NF-κB in the cytoplasm at an inactive state, and the minor pool remains as a “free” protein. In resting cells, basal IKK activity phosphorylates bound IκBα and targets it for ubiquitin-dependent degradation. In addition, free IκBα is continuously synthesized and degraded in an IKK- and ubiquitin-independent mechanism, keeping NF-κB from being activated under resting cell conditions. Upon TNFα stimulation, it is rapidly degraded following the phosphorylation mediated by IKKalpha kinase at serine residues 32 and 36, translocates to the nucleus, and binds to target gene promoters, including IκB [57]. Compared to other IκB proteins, IκBα responds most rapidly to stimuli and mediates a powerful negative feedback loop that terminates NF-κB transcriptional activity [55]. Accumulating evidence implicates a pivotal role of the transcription factor NF-κB in the regulation of cell growth and the differentiation of mesenchymal stem cells (MSCs) [58,59,60]. Pro-inflammatory cytokine TNFα is largely expressed during cartilage inflammation and interferes with the healing process of chondral and osteochondral defects, increasing the expression of aggrecanase and decreasing the expression of proteoglycans [61,62]. Studies investigating the biological effects of anti-TNFα drugs demonstrated that the inhibitors of TNFα have substantial chondroprotective activity [63,64] in mesenchymal stem cells and non-stem cell populations. MSCs are known to contribute to the structural and functional restoration of injured tissues by counteracting the inflammatory activity of TNFα [65]. The site-specific administration of MSCs to patients affected by chronic inflammatory diseases or the mobilization of endogenous stem cells to damaged sites are effective anti-inflammatory strategies at disease onset but could fail to alleviate symptoms during disease progression [64]. It has been demonstrated that MSCs are susceptible to environmental changes, and the exposure to TNFα could cause their conversion from an immunosuppressive to pro-inflammatory status [66]. Sitcheran et al. [67] reported that NF-κB activated by TNFα inhibits mesenchymal stem cells to undergo chondrogenesis. Interestingly, glucosamine stimulated MSCs to acquire the chondrogenic phenotype and inhibited extracellular matrix degradation [39], suggesting a negative interaction with the NF-κB pathway.
It is known that TNFα exerts its biological activities via two receptors: TNFR1 and TNFR2 [68]. Stem cells, including CMCs, express both receptors and exert immunosuppressive and reparative activities via cell–cell contact and paracrine mechanisms [66,69]. TNFR1 is expressed ubiquitously, interacts with the membrane (mTNFα) or soluble TNFα (sTNFα), triggers cell apoptosis, or regulates the adaptive immune system, promoting the generation of regulatory T cells (Tregs) or repressing the functions of T effector and B effector cells. Inversely, TNFR2 is expressed in immune cells, endothelial cells, mesenchymal stem cells, and neural cells [66]. It preferentially binds to mTNF and mediates anti-inflammatory effects, activating pro-survival genes via NF-κB, ERK, JNK, and p38 MAPK pathways. In cardiac models, the ablation of the TNFR1 gene blunts injury and improves survival, whereas the ablation of the TNFR2 gene exacerbates tissue injury and reduces cell survival [70]. This has led to the important appreciation that TNFα may have beneficial or detrimental effects depending on which of its receptors is activated. Thus, targeting TNFα signaling could be of great therapeutic value for the development of stem-cell-based therapies for cartilage repair in osteoarthritis and related orthopedic conditions. Chondrocytes and mesenchymal stem cells secrete numerous bioactive molecules, including adenine nucleotides and nucleosides [71]. Native articular cartilage is challenged by synovial fluid flow during normal joint motion, and ATPs released together with adenosine production are transiently increased in the joint microenvironment. Following shockwave trauma or excessive joint motion, cartilage homeostasis is drastically altered, resulting in excessive ecto-5′-nucleotidase/CD73 production, adenosine accumulation, a disproportionate activation of adenosine A2B receptors, and a significant release of pro-inflammatory mediators.
In this study, we assessed an in vitro model of chondrogenesis based on human circulating multipotent cells to evaluate the potentiality of an amino acid (AA) derivate of GlcN, called DCF001, in counteracting the detrimental effects of TNFα on cell viability, ATP release, TNFα receptors, CD73 expression, and the chondrogenic potentialities of human circulating multipotent stem cells cultured under proliferative (PM) or chondrogenic (CM) conditions. The preparation of DCF001 was performed according to Katritzky and colleagues [19,20], which demonstrated that conjugation with AA increases the bioavailability of GlcN and enhances its pharmaceutical activity.

2. Results

2.1. In Vitro Model

The biological effects of DCF001 were investigated in CMCs expanded up to the fifth passage. As shown in Figure 1, cell populations exhibited a typical fibroblast-like morphology and characteristic stem cell markers, including CD90 (45 ± 1.1%), CD44 (100 ± 1.7%), and CD105 (97 ± 2.5%). Furthermore, the expression of enzymes related to ATPase activity, including CD73 (ecto-5′-nucleotidase) (100 ± 1.8%) and CD39 (ecto-ATPase) (35 ± 0.8%), was also demonstrated. As expected, CD45 and HLA-DR, which are typically expressed in mature hematopoietic cells, were not detected.

2.2. Cell Viability and ATP Release

DCF001 showed its ability to preserve cell growth and the differentiative potential of CMCs under experimental inflammation. As observed in Figure 2A, TNFα decreased cell proliferation in PM cultures (p < 0.05), and this response was not affected by DCF001. In contrast, in CM cultures, the administration of DCF001 upregulated (p ≤ 0.01) the cell growth rate (Figure 2B), and this mitogenic effect (p ≤ 0.01) was stronger in cells pre-treated with TNFα. In parallel, to investigate whether DCF001 alters stem-cell-growth-modulating ATP signaling, we collected the culture medium of all experimental groups and measured the extracellular ATP content (eATP). As shown in Figure 2C, DCF001 and/or TNFα promoted a significant reduction in eATP (p < 0.05) under proliferative conditions. In contrast, the samples cultured with chondrogenic factors (Figure 2D) responded to the stimulation with DCF001 or TNFα by accumulating eATP (p ≤ 0.05). This effect significantly increased when DCF001 was added after TNFα priming (p ≤ 0.05) (Figure 2D).

2.3. Effect of DCF001 on CD39 and CD73 Expression

We tested the hypothesis that DCF001 modulates the expression of CD39 and CD73, two ectoenzymes known to convert extracellular ATP to AMP (CD39) and AMP to adenosine (CD73). As reported in Figure 3, in comparison to unstimulated cells, CMCs pre-treated with TNFα and thus cultured for 24 h in a PM medium showed an upregulated expression (p < 0.05) of both CD39 (Figure 3A) and CD73 (Figure 3B), as expected under inflammatory conditions. In contrast, when TNFα-primed cells were cultured in a CM medium, we only observed the upregulation (p < 0.05) of CD39 (Figure 3C) while CD73 was unchanged or barely increased (Figure 3D). These effects were reversed (p ≤ 0.05) by DCF001 in both PM and CM. When added to the chondrogenic medium, DCF001 caused a significant reduction (p < 0.05) in the expression of both CD39 and CD73.

2.4. Effect of DCF001 on TNFα Receptors

We tested the hypothesis that DCF001 exerts protective effects during the chondrogenesis of mesenchymal stem cells by modulating the expression of TNFR1 and TNFR2, which, under inflammatory conditions, mediates pro-inflammatory and anti-inflammatory activities, respectively. As shown in Figure 4, a higher expression of TNFR1 (40.74 ± 3.78%) and TNFR2 (16.55 ± 1.25%) was observed in PM cultures. Following TNFα priming, a significantly (p ≤ 0.05) increased expression level of TNFR1 (69.09 ± 5.12%) and TNFR2 (23.93 ± 2.08%) was observed. This response was partially inhibited (p ≤ 0.05) by DCF001, as suggested by the reduced expression of both TNFR1 (53.13 ± 4.42%) and TNFR2 (8.45 ± 1.03%). In contrast, under differentiative conditions, the expression of TNFR1 and TNFR2 was not affected by TNFα stimulation. Interestingly, CMCs primed with TNFα and then cultured for 24 h in a CM medium supplemented with DCF001 significantly upregulated (p < 0.05) TNFR2 expression (52.21 ± 2.33%) compared to the control (41.65 ± 2.23%) and TNFα-primed cells (38.75 ± 2.91%).

2.5. Effect of DCF001 on IκBα

In resting cells, NF-κB-bound IκBα is subject to slow degradation by both IKK phosphorylation and ubiquitination. In contrast, free IκBα turnover is caused intrinsically by sequences in its C terminus [56]. In the present study, the anti-inflammatory activity of DCF001 was studied by investigating the percentage expression of phosphorylated (p-IκBα) and unphosphorylated IκBα and the p-IκB/IκB ratio. As observed in Figure 5, unstimulated CMC cells showed a low expression of total IκBα and a high (p ≤ 0.05) p-IκBα/IκBα ratio (0.96 ± 0.01), thus suggesting a high rate of free protein degradation and NF-κB at an active state. Upon chondrogenic induction, an increased amount of total IκBα but with a significantly decreased (p ≤ 0.05) p-IκBα/IκBα ratio (0.76 ± 0.02) was observed and considered indicative of negative regulation of NF-κB. These results were consistent with the literature reporting NF-κB inhibition during the differentiative commitment of MSCs [60]. When CMCs were stimulated with TNFα, p-IκB was upregulated in a chondrogenic medium (p-IκB/IκB ratio: 1.17 ± 0.02, p ≤ 0.05) but not in cells kept in a proliferative medium (p-IκB/IκB ratio: 0.75 ± 0.01, p ≤ 0.05). Showing a potential inhibitory effect on NF-kB under proliferative (p-IκBα/IκBα ratio:0.22 ± 0.01; p ≤ 0.01) and chondrogenic conditions (p-IκBα/IκBα ratio: 0.60 ± 0.01; p ≤ 0.05), DCF001 counteracted (p ≤ 0.05) the biological effects of TNFα independently of culture conditions (p-IκBα/IκBα ratio: 0.53 ± 0.01 in the PM; p-IκBα/IκBα ratio: 1.05 ± 0.01 in CM).

2.6. Gene Expression

As shown in Figure 6, a statistically significant increase in COL2A1 (p < 0.05) was observed in PM and CM cultures stimulated with TNFα. In contrast, RUNX2 expression was downregulated (p < 0.05). After TNFα priming, DCF001 improved the transcription of COL2A1 (p < 0.05) in PM cultures (Figure 6A) while modulating the expression of RUNX2 and MMP13 (p < 0.05). In parallel, the cells maintained in the CM medium and DCF001 (Figure 6B) showed increased transcription of RUNX2 and MMP13 (p ≤ 0.05). The lower expression of the COL2A1 gene (p ≤ 0.05) was observed compared to the references.

3. Discussion

Preclinical studies have demonstrated that TNFα release is impaired with respect to symptomatic cartilage defects [72] or inflammation [73,74,75]. Acting as a catabolic factor, it affects chondrocyte viability, promotes the production of metalloproteinases, and inhibits chondrogenic differentiation [61,76]. These biological activities are dose-dependent and involve the inhibition of transcription factor SOX9 via NF-κB signaling [77]. As MSCs express limited proliferation or differentiation when exposed to inflammatory factors [78,79], TNF inhibitors could potentially be beneficial in clinics and could improve the efficacy of the therapeutical treatment of inflammatory diseases [66,80,81,82]. In the present study, we demonstrated that a derivate of glucosamine coupled to tryptophan (DCF001) counteracted the inflammatory effect of TNFα on circulating mesenchymal stem cells (CMCs) via the regulation of cell viability, the accumulation of eATP, and the expression of TNFα receptors and NF-κB inhibitor IκBα. In accordance with the variable effects that TNFα could exert on the fate of MSCs when used alone or combined with differentiation-inducing factors [78], all biological effects of DCF001 were dependent on cell culture conditions after TNFα priming. Li et al. [83] reported that the exposure of MSCs to TNFα during in vitro expansion could be beneficial for cell proliferation, migration, and osteogenic capacity, but these effects are reported to be reversed upon TNFα withdrawal [84]. In contrast, TNFα could exhibit significant inhibitory activity upon stem cell chondrogenesis [62,79] or stimulate a pro-chondrogenic effect when administered before differentiative induction [84]. Our data point towards the role of DCF001 in stem cell differentiation under inflammation that involves extracellular ATP accumulation and the regulation of purinergic receptors CD39/CD73 and TNF receptors [66]. In our study, TNFα priming promoted a significant reduction in cell viability under regular growth conditions while stimulating proliferation under chondrogenic induction. In the absence of differentiation-inducing factors, DCF001 did not affect cell viability nor reversed the inhibitory effect induced by TNFα. In contrast, when administered with chondrogenic factors, glucosamine stimulated the growth of CMCs, with further increased activity in cells primed with TNFα. These data are consistent with the literature reporting that a proliferogenic effect is induced by GlcN in stem cells [39,85] and chondrocytes [39,86]. Because the entry of glucosamine into cells involves glucose transporter systems and this transport is stimulated by insulin, which is a factor added to the chondrogenic medium of CMCs, we hypothesized that DCF001 is more effective when administered with chondrogenic factors because of its increased uptake [24,31]. In our study, the proliferogenic effect of DCF001 correlated with an increase in extracellular ATP, which is a known purinergic controlling mediator of physiological functions [87,88,89,90] via Ca2+ signaling [91]. Our data are consistent with studies reporting that, during the chondrogenic maturation of mesenchymal stem cells, the release of ATP occurs in order to shift the cell’s fate from a transient growth phase [92] to chondrogenic differentiation [93]. Kwon et al. [94] demonstrated that ATP is released periodically due to oscillatory secretion during prechondrogenic condensation, and these oscillations are mediated by the P2X4 receptor and intracellular cAMP/PKA pathway. Previously, Iwamoto et al. [93] reported that Pannexin 3 (PANX3), which is a member of the gap junction pannexin family, is expressed in cartilage and functions to shift the chondrocyte’s cell fate from proliferation to differentiation, promoting ATP release into the extracellular space and inhibiting parathyroid hormone (PTH)-mediated cell proliferation, the intracellular levels of cAMP, and the phosphorylation of CREB. Upon inflammatory insults, extracellular ATP could exert pro-inflammatory effects, and MSCs expressing CD39, which catabolizes ATP into AMP, and CD73, which hydrolyzes AMP into adenosine, could transform pro-inflammation into anti-inflammation [95,96], preserving cartilage homeostasis [71]. Based on our results, DCF001 could contribute to chondrogenesis, causing the accumulation of eATP by the desensitization of CD39 and CD73 after activation. Instead, the protective effects of DCF001 against TNFα could involve a modulatory activity on the expression of TNF receptors and the activation of NF-κB. It is known that TNFα affects MSC efficacy in a dose-dependent manner. At higher concentrations, the interaction of TNFα with TNFR1 is known to mediate pro-inflammatory effects via NF-κB activation [97] and reduce MSC efficacy by inhibiting the production of immunosuppressive molecules and growth factors. In contrast to the dual effects of TNFR1, the interaction between TNFα and TNFR2 is effective in only evoking anti-inflammatory effects and cell survival via TNFR-associated factor (TRAF) 1 and 2 proteins [98,99]. While transmembrane TNFα activates both TNFR1 and TNFR2 signaling with high efficacy, soluble TNFα interacts only with TNFR1 in strong and general receptor activation [100]. Compared with wild-type controls, murine BM-MSCs with TNFR2 knockout showed less or no myocardial functional recovery in a rat model of acute ischemia accompanied by the increased production of pro-inflammatory factors [66]. When CMCs were treated with TNFα under proliferative conditions, DCF001 affected the expression of both TNFR1 and TNFR2, suggesting that this GlcN derivate could interfere with the TNFα pathway by lowering the synthesis of its cell surface receptors. These data are in accordance with Scotto et al. [44], who reported a preventive activity exerted by glucosamine on TNFα-induced transcriptional activation in human chondrocytes. Beldi et al. [98] also demonstrated that the TNFα–TNFR2 axis is a crucial regulator of MSC immunological and regenerative functions. In the present study, we demonstrated that DCF001 combined with chondrogenic stimuli promoted an increased expression of TNFR2 in TNFα-primed cells, suggesting that it can stimulate immunosuppressive activity in mesenchymal stem cells. Moreover, due to evidence reporting the involvement of TNFR2 in cell differentiation [61], its increased expression, which is promoted by DCF001, the increase in cell viability and eATP, and the reduced expression of CD39 and CD73 could be indicative of promoted chondrogenesis under inflammation, as previously demonstrated for other molecules, i.e., Atsttrin [99]. The anti-inflammatory effect of DCF001 was further confirmed by the inhibited phosphorylation of IκBα, while its differentiative potential was demonstrated by the expression of chondrogenic gene markers COL2A1, RUNX2, and MMP13 [101].
Different chondrocyte phenotypes are identified during maturation based on their collagen gene expression [102,103]. In the literature, it is reported that the supplementation of the differentiation medium with glucosamine has an improved differentiative effect on stem cells [104]. Chondroprogenitor cells are characterized by the expression of type II collagen (COL2A1) [105,106], while mature chondrocytes express the typical cartilage collagen types II (COL2B), IX, and XI as well as aggrecan [107,108,109]. Instead, hypertrophic chondrocytes are characterized by the expression of type X collagen [110]. Among catabolic factors, MMP13 is expressed at a low level in normal and early degenerative cartilage, but it is strongly upregulated during inflammation [111] and contributes to cartilage degeneration via Col2a1 degradation [75,112]. Derfoul et al. [39] demonstrated that GlcN promotes chondrogenesis in mesenchymal stem cells, enhancing the expression of collagen II and reducing cartilage matrix degradation via the inhibition of MMP13 expression. In our study, under proliferative conditions, DCF001 reversed the TNFα-induced expression of MMP13 and boosted the gene expression of COL2A1 and RUNX2, thus suggesting that it is potentially able to contrast the chronic breakdown of the ECM in vivo but is unable to promote terminal chondrogenic differentiation without chondrogenic inducers. In contrast, due to promoted differentiation, DCF001 reversed the cellular response driven by TNFα, increasing the chondrogenic capacity of CMCs, as suggested by the enhanced expression of RUNX2 and MMP13 genes and the modulated transcription of COL2A1.

4. Materials and Methods

4.1. In Vitro Model

As previously published [113], multipotent stem cells were isolated from the human peripheral blood of healthy volunteer donors (n = 20; age: ≤12 years) in accordance with the Italian ethics committee’s authorization and after obtaining informed consent. Briefly, blood samples (5 mL) were diluted (1:1) in an α-Minimum Essential Medium (αMEM; Invitrogen Life Technologies, Carlsbad, CA, USA) and carefully layered onto Ficoll®Paque (Sigma-Aldrich Corp. St. Louis, MO, USA) for density gradient separation. After centrifugation (400× g, for 20 min, at 4 °C), the upper layer was collected and resuspended in a proliferative medium (PM) prepared with αMEM supplemented with 16.5% heat-inactivated fetal bovine serum (FBS; Invitrogen Life Technologies), 50 U/mL penicillin (Invitrogen Life Technologies), 50 μg/mL streptomycin (Invitrogen Life Technologies), and 1% L-glutamine (Sigma-Aldrich). Samples were seeded onto tissue culture plates (BD Falcon, Milan, Italy) and allowed to adhere for 24 h in a humidified atmosphere of 5% CO2 at 37 °C. When fibroblast colony-forming cells were observed, the culture medium was changed, and cell expansion was performed. Upon reaching 80% confluence, CMCs were detached using 0.02% ethylenediaminetetraacetic acid (EDTA)/0.25% trypsin solution (Sigma-Aldrich), and subcultures (104 cells/cm2) were prepared for immunophenotyping and test analysis.

4.2. Immunophenotyping

CMCs were immunophenotypically characterized by flow cytometry (FCM). The expression of stem cell markers CD90, CD44, CD105, and CD73 and purinergic receptor CD39 was determined using the antibodies reported in Table 1. In parallel, the expression of hematopoietic marker CD45 and histocompatibility antigen HLA-DR was also evaluated (Table 1). For the analysis, cells were detached using a trypsin/EDTA solution, centrifuged at 1200 rpm for 5 min, and then resuspended in phosphate-buffered saline (PBS) (Merck, Darmstadt, Germany) and 0.2% bovine serum albumin (BSA) (Merck) (PBS-BSA). All samples were fixed using BD Cytofix™ solution (BD Biosciences, San Josè, CA, USA) following the manufacturer’s instructions. For staining, 1  ×  106 cells were incubated in 100 μL of PBS and 10 μL of fluorochrome-conjugated primary antibodies (Table 1) in the dark for 15 min at room temperature (RT). In parallel, isotype-matched controls (Table 1) and unstained cells were included as negative controls. Data were acquired using a BD FACSCanto™ II System (BD Biosciences) and FACSDiva™ software v6.1.3 (BD Biosciences). Data were processed using FlowJo™ v10.8.1 Software (Tree Star Inc., Ashland, OR, USA).

4.3. DCF001 Compound

Tetra-acetyl GlcN hydrochloride (Sigma-Aldrich) was functionalized with tryptophan according to the previously reported procedure [114]. Briefly, hydrochloride salt, N-Cbz tryptophan (Sigma-Aldrich), diisopropylethylamine, and TBTU were suspended in dry DMF/dichloromethane 1:2 and stirred under an inert atmosphere at room temperature overnight. HCl 1 N was added, and the mixture was extracted using dichloromethane; the organic layers were dried, filtered, and evaporated under a vacuum, obtaining a white solid that underwent a deprotection reaction by adding MeONa to a suspension in methanol. After 30 min, H2SO4 was added, and the crude was evaporated under reduced pressure and washed with boiling methanol, obtaining a yellow solid as a pure compound (DCF001, molecular weight: 499.52). DCF001 was prepared in a culture medium at a final 1 µg/mL concentration.

4.4. Cell Treatments

CMCs were seeded (1 × 105 cells/cm2) on standard tissue culture plates (BD Falcon). After 24 h, cells were pretreated with TNFα (0.1 µg/mL) (ImmunoTools, Friesoythe, Germany) in a PM medium for 3 h. Thus, they were cultured with DCF001 (1 µg/mL) or the vehicle (control) for 24 h in PM or a chondrogenic medium (CM) prepared with DMEM and Ham’s F12 Nutrient Mixture (Sigma Aldrich), 10% fetal calf serum (Biochrom-Seromed, Berlin/Heidelberg, Germany), 0.4 µg/mL of hydrocortisone, 8 ng/mL of cholera toxin, 5 µg/mL of insulin, 20 µg/mL of adenine, 10 µg/mL of transferrin, 10 µg/mL of triiodothyronine, and 1 ng/mL of epidermal growth factor (all purchased from Sigma).

4.5. Cell Viability Analysis

According to the manufacturer’s specifications, viable cells were counted using a Corning® Cell Counter (Corning Inc., New York, NY, USA), and the trypan blue exclusion technique was used. Data were reported as the mean value (%) ± standard deviation (SD) (n = 10 samples/experimental group) from three independent experiments.

4.6. CellTiter-Glo® Assay

CellTiter-Glo® Luminescent Cell Viability Assay (Promega, Madison, WI, USA) was used and adapted to measure the ATPs released by unstimulated or stimulated cells with DCF001 and/or TNFα. Briefly, 50 µL of the culture medium of each sample was incubated with an equal volume of CellTiter-Glo® Reagent in the 96-well opaque-walled plate. Luminescence was recorded 10 min after reagent addition using a VICTOR® Nivo™ Plate Reader (PerkinElmer, Waltham, MA, USA) and reported in relative light units (RLU). Data were expressed as the mean ± SD of four replicates for each sample. In parallel, wells containing medium unconditioned by cells were used to measure background luminescence.

4.7. Flow Cytometry Analysis of CD39, CD73, and TNFα Receptors and IκBα

The analysis was performed by direct or indirect staining using the antibodies reported in Table 1. Cultures stained with isotypic, or secondary antibodies were used as references. Data were acquired using the BD FACSCanto™ II System and are expressed as follows: (1) the relative MFI values (Rel MFI) (target MFI/Isotype IgG MFI) ± standard error of the mean (SEM) for CD39 and CD73; (2) the mean value of the percentage of positive cells ± SEM for TNFR1 and TNFR2. As for the analysis of IκBα, we reported the percentage expression of phosphorylated (p-IκBα) and unphosphorylated (IκBα) proteins and the p-IκB to IκB ratio. Assuming that a ratio equal to 1 is observed in the case of undetectable differences between p-IκBα and IκBα, values greater or less than 1 were considered indicative of an increased or decreased expression of p-IκBα. The analysis was performed by flow cytometry as this technique enables the quantitative analysis of signaling events with greater sensitivity and precision than a Western blot, which is traditionally used for the analysis of protein expression but is limited to performing a multiparameter analysis of subpopulations with specific signaling responses.

4.8. Gene Expression Study

Total RNA was isolated from the experimental groups and evaluated by quantitative real-time PCR for the relative expression of COL2A1, RUNX2, and MMP13 mRNAs. Briefly, RNA was prepared with a TRI Reagent solution (Zymo Research, Irvine, CA, USA) following the phenol–chloroform method. After the quantification of RNA by NANODROP 2000 (Thermo Fisher Scientific, Waltham, MA, USA), the samples were stored at −20 °C until use. For the analysis, each reaction was performed with 10 ng of RNA, a one-step RT-PCR kit (qPCR SyGreen 1-step Go Lo Rox, PCR Biosystems, UK), and Mic qPCR Cycler (Bio Molecular Systems, Australia). Oligonucleotides for target genes and housekeeping hypoxanthine–guanine phosphoribosyltransferase (HPRT) (listed in Table 2) were purchased from Invitrogen Life Technology (Carlsbad, CA, USA). The relative gene expression level was measured using the Livak and Schmittgen method [115], which is also referred to as the 2−ΔΔCt method [116]. Each expression was calculated relative to human HPRT and control samples in the growth medium.

4.9. Statistical Analysis

Each experiment was performed three times. Statistical significance was established using a two-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparison test. In all analyses, a p-value of <0.05 was considered statistically significant.

5. Conclusions

GlcN salts constitute a new class of nutraceutical components with putative chondroprotective activity. In our study, DCF001 demonstrably preserved cell viability and the chondrogenic potentialities of circulating multipotent stem cells, suggesting significant potentialities for in vivo targeting endogenous MSCs that are mobilized to damage sites and participate in cartilage regeneration or repair. Further in vivo studies are necessary to validate the observed chondroprotective effects of DCF001 during inflammation and to provide a rational basis for the development of innovative therapies for degenerative cartilage diseases.

Author Contributions

R.D.L.: Conceptualization, methodology, investigation, and writing—original draft; M.G., C.C., M.P., V.N.M., R.D.S., V.T., M.A., S.T. and C.D.P.: investigation, data curation, and writing (review and editing); R.C.: conceptualization, methodology, investigation, and writing (review and editing). All authors have read and agreed to the published version of the manuscript.

Funding

This work has been carried out with the financial support of the University of Padova “FONDO DOR—Bando 2021—Di Liddo Rosa”.

Informed Consent Statement

Human peripheral blood samples (n = 20; age: ≤12 years) were collected under the Italian ethics committee’s informed authorization (Authorization n.372/AULSS9, Protocol 0059152, 14 May 2012). Written informed consent has been obtained from the patients to publish this paper.

Acknowledgments

The authors would like to thank the Italian Leukemia Lymphoma Myeloma ONLUS Association, Section of Treviso (Italy), and I.R.A. Istituto Ricerche Applicate S.p.A. for the use of the FACSCanto II Flow cytometer and Mic qPCR Cycler.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Persiani, S.; Rotini, R.; Trisolino, G.; Rovati, L.C.; Locatelli, M.; Paganini, D.; Antonioli, D.; Roda, A. Synovial and plasma glucosamine concentrations in osteoarthritic patients following oral crystalline glucosamine sulphate at therapeutic dose. Osteoarthr. Cartil. 2007, 15, 764–772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Lim, Y.Z.; Hussain, S.M.; Cicuttini, F.M.; Wang, Y. Chapter 6—Nutrients and Dietary Supplements for Osteoarthritis. In Bioactive Food as Dietary Interventions for Arthritis and Related Inflammatory Diseases, 2nd ed.; Watson, R.R., Preedy, V.R., Eds.; Academic Press: Cambridge, MA, USA, 2019; pp. 97–137. [Google Scholar]
  3. de Queiroz, R.M.; Oliveira, I.A.; Piva, B.; Bouchuid Catão, F.; da Costa Rodrigues, B.; da Costa Pascoal, A.; Diaz, B.L.; Todeschini, A.R.; Caarls, M.B.; Dias, W.B. Hexosamine Biosynthetic Pathway and Glycosylation Regulate Cell Migration in Melanoma Cells. Front. Oncol. 2019, 9, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Block, J.A.; Oegema, T.R.; Sandy, J.D.; Plaas, A. The effects of oral glucosamine on joint health: Is a change in research approach needed? Osteoarthr. Cartil. 2010, 18, 5–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. D’Ambrosio, E.; Casa, B.; Bompani, R.; Scali, G.; Scali, M. Glucosamine sulphate: A controlled clinical investigation in arthrosis. Pharmatherapeutica 1981, 2, 504–508. [Google Scholar] [PubMed]
  6. Konopka, J.B. N-acetylglucosamine (GlcNAc) functions in cell signaling. Sci. Cairo 2012, 2012, 489208. [Google Scholar] [CrossRef] [Green Version]
  7. Grigorian, A.; Araujo, L.; Naidu, N.N.; Place, D.J.; Choudhury, B.; Demetriou, M. N-acetylglucosamine inhibits T-helper 1 (Th1)/T-helper 17 (Th17) cell responses and treats experimental autoimmune encephalomyelitis. J. Biol. Chem. 2011, 286, 40133–40141. [Google Scholar] [CrossRef] [Green Version]
  8. Simon, R.R.; Marks, V.; Leeds, A.R.; Anderson, J.W. A comprehensive review of oral glucosamine use and effects on glucose metabolism in normal and diabetic individuals. Diabetes Metab. Res. Rev. 2011, 27, 14–27. [Google Scholar] [CrossRef] [Green Version]
  9. Conrozier, T.; Lohse, T. Glucosamine as a Treatment for Osteoarthritis: What If It’s True? Front. Pharm. 2022, 13, 820971. [Google Scholar] [CrossRef]
  10. Noack, W.; Fischer, M.; Förster, K.K.; Rovati, L.C.; Setnikar, I. Glucosamine sulfate in osteoarthritis of the knee. Osteoarthr. Cartil. 1994, 2, 51–59. [Google Scholar] [CrossRef]
  11. Reginster, J.Y.; Deroisy, R.; Rovati, L.C.; Lee, R.L.; Lejeune, E.; Bruyere, O.; Giacovelli, G.; Henrotin, Y.; Dacre, J.E.; Gossett, C. Long-term effects of glucosamine sulphate on osteoarthritis progression: A randomised, placebo-controlled clinical trial. Lancet 2001, 357, 251–256. [Google Scholar] [CrossRef]
  12. McAlindon, T.E.; LaValley, M.P.; Gulin, J.P.; Felson, D.T. Glucosamine and chondroitin for treatment of osteoarthritis: A systematic quality assessment and meta-analysis. JAMA 2000, 283, 1469–1475. [Google Scholar] [CrossRef] [PubMed]
  13. Barclay, T.S.; Tsourounis, C.; McCart, G.M. Glucosamine. Ann. Pharm. 1998, 32, 574–579. [Google Scholar] [CrossRef] [PubMed]
  14. Henrotin, Y.; Chevalier, X.; Herrero-Beaumont, G.; McAlindon, T.; Mobasheri, A.; Pavelka, K.; Schön, C.; Weinans, H.; Biesalski, H.; Participants at the Hohenheim Consensus Conference in August 29th 2011. Physiological effects of oral glucosamine on joint health: Current status and consensus on future research priorities. BMC Res. Notes 2013, 6, 115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Pan, S.K.; Wu, S.J.; Kim, J.M. Preparation of glucosamine by hydrolysis of chitosan with commercial α-amylase and glucoamylase. J. Zhejiang Univ. Sci. B 2011, 12, 931–934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Liu, L.; Liu, Y.; Shin, H.D.; Chen, R.; Li, J.; Du, G.; Chen, J. Microbial production of glucosamine and N-acetylglucosamine: Advances and perspectives. Appl. Microbiol. Biotechnol. 2013, 97, 6149–6158. [Google Scholar] [CrossRef]
  17. Doan, C.T.; Tran, T.N.; Wang, S.L. Production of Thermophilic Chitinase by Paenibacillus sp. TKU052 by Bioprocessing of Chitinous Fishery Wastes and Its Application in N-acetyl-D-glucosamine Production. Polymers 2021, 13, 3048. [Google Scholar] [CrossRef]
  18. Ma, Q.; Gao, X. Categories and biomanufacturing methods of glucosamine. Appl. Microbiol. Biotechnol. 2019, 103, 7883–7889. [Google Scholar] [CrossRef]
  19. Tiwari, A.D.; Panda, S.S.; Girgis, A.S.; Sahu, S.; George, R.F.; Srour, A.M.; La Starza, B.; Asiri, A.M.; Hall, C.D.; Katritzky, A.R. Microwave assisted synthesis and QSAR study of novel NSAID acetaminophen conjugates with amino acid linkers. Org. Biomol. Chem. 2014, 12, 7238–7249. [Google Scholar] [CrossRef]
  20. Jones, R.A.; Thillier, Y.; Panda, S.S.; Rivera Rosario, N.; Hall, C.D.; Katritzky, A.R. Synthesis and characterisation of glucosamine-NSAID bioconjugates. Org. Biomol. Chem. 2014, 12, 8325–8335. [Google Scholar] [CrossRef]
  21. Lin, Y. Whole-process optimization for industrial production of glucosamine sulfate sodium chloride based on QbD concept. Chin. J. Chem. Eng. 2023, 54, 153–161. [Google Scholar] [CrossRef]
  22. Chen, J.K.; Shen, C.R.; Liu, C.L. N-acetylglucosamine: Production and applications. Mar. Drugs 2010, 8, 2493–2516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Deng, M.D.; Severson, D.K.; Grund, A.D.; Wassink, S.L.; Burlingame, R.P.; Berry, A.; Running, J.A.; Kunesh, C.A.; Song, L.; Jerrell, T.A.; et al. Metabolic engineering of Escherichia coli for industrial production of glucosamine and N-acetylglucosamine. Metab. Eng. 2005, 7, 201–214. [Google Scholar] [CrossRef] [PubMed]
  24. Anderson, J.W.; Nicolosi, R.J.; Borzelleca, J.F. Glucosamine effects in humans: A review of effects on glucose metabolism, side effects, safety considerations and efficacy. Food Chem. Toxicol. 2005, 43, 187–201. [Google Scholar] [CrossRef]
  25. Henrotin, Y.; Mobasheri, A.; Marty, M. Is there any scientific evidence for the use of glucosamine in the management of human osteoarthritis? Arthritis Res. Ther. 2012, 14, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Dalirfardouei, R.; Karimi, G.; Jamialahmadi, K. Molecular mechanisms and biomedical applications of glucosamine as a potential multifunctional therapeutic agent. Life Sci. 2016, 152, 21–29. [Google Scholar] [CrossRef] [PubMed]
  27. Herrero-Beaumont, G.; Largo, R. Glucosamine and O-GlcNAcylation: A novel immunometabolic therapeutic target for OA and chronic, low-grade systemic inflammation? Ann. Rheum. Dis. 2020, 79, 1261–1263. [Google Scholar] [CrossRef]
  28. Qian, S.; Zhang, Q.; Wang, Y.; Lee, B.; Betageri, G.V.; Chow, M.S.S.; Huang, M.; Zuo, Z. Bioavailability enhancement of glucosamine hydrochloride by chitosan. Int. J. Pharm. 2013, 455, 365–373. [Google Scholar] [CrossRef]
  29. Gilzad Kohan, H.; Kaur, K.; Jamali, F. Synthesis and characterization of a new Peptide prodrug of glucosamine with enhanced gut permeability. PLoS ONE 2015, 10, e0126786. [Google Scholar] [CrossRef]
  30. Heart, E.; Choi, W.S.; Sung, C.K. Glucosamine-induced insulin resistance in 3T3-L1 adipocytes. Am. J. Physiol. Endocrinol. Metab. 2000, 278, E103–E112. [Google Scholar] [CrossRef] [Green Version]
  31. Uldry, M.; Ibberson, M.; Hosokawa, M.; Thorens, B. GLUT2 is a high affinity glucosamine transporter. FEBS Lett. 2002, 524, 199–203. [Google Scholar] [CrossRef]
  32. Riegger, J.; Baumert, J.; Zaucke, F.; Brenner, R.E. The Hexosamine Biosynthetic Pathway as a Therapeutic Target after Cartilage Trauma: Modification of Chondrocyte Survival and Metabolism by Glucosamine Derivatives and PUGNAc in an Ex Vivo Model. Int. J. Mol. Sci. 2021, 22, 7247. [Google Scholar] [CrossRef] [PubMed]
  33. Brimble, S.; Wollaston-Hayden, E.E.; Teo, C.F.; Morris, A.C.; Wells, L. The Role of the O-GlcNAc Modification in Regulating Eukaryotic Gene Expression. Curr. Signal Transduct. Ther. 2010, 5, 12–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Ghatak, S.; Maytin, E.V.; Mack, J.A.; Hascall, V.C.; Atanelishvili, I.; Moreno Rodriguez, R.; Markwald, R.R.; Misra, S. Roles of Proteoglycans and Glycosaminoglycans in Wound Healing and Fibrosis. Int. J. Cell Biol. 2015, 2015, 834893. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Merrild, N.G.; Holzmann, V.; Ariosa-Morejon, Y.; Faull, P.A.; Coleman, J.; Barrell, W.B.; Young, G.; Fischer, R.; Kelly, D.J.; Addison, O.; et al. Local depletion of proteoglycans mediates cartilage tissue repair in an ex vivo integration model. Acta Biomater. 2022, 149, 179–188. [Google Scholar] [CrossRef] [PubMed]
  36. Mizumoto, S.; Yamada, S. Congenital Disorders of Deficiency in Glycosaminoglycan Biosynthesis. Front. Genet. 2021, 12, 717535. [Google Scholar] [CrossRef]
  37. Derkacz, A.; Olczyk, P.; Jura-Półtorak, A.; Olczyk, K.; Komosinska-Vassev, K. The Diagnostic Usefulness of Circulating Profile of Extracellular Matrix Components: Sulfated Glycosaminoglycans (sGAG), Hyaluronan (HA) and Extracellular Part of Syndecan-1 (sCD138) in Patients with Crohn’s Disease and Ulcerative Colitis. J. Clin. Med. 2021, 10, 1722. [Google Scholar] [CrossRef]
  38. Varghese, S.; Theprungsirikul, P.; Sahani, S.; Hwang, N.; Yarema, K.J.; Elisseeff, J.H. Glucosamine modulates chondrocyte proliferation, matrix synthesis, and gene expression. Osteoarthr. Cartil. 2007, 15, 59–68. [Google Scholar] [CrossRef] [Green Version]
  39. Derfoul, A.; Miyoshi, A.D.; Freeman, D.E.; Tuan, R.S. Glucosamine promotes chondrogenic phenotype in both chondrocytes and mesenchymal stem cells and inhibits MMP-13 expression and matrix degradation. Osteoarthr. Cartil. 2007, 15, 646–655. [Google Scholar] [CrossRef] [Green Version]
  40. Veronesi, F.; Giavaresi, G.; Maglio, M.; Scotto d’Abusco, A.; Politi, L.; Scandurra, R.; Olivotto, E.; Grigolo, B.; Borzì, R.M.; Fini, M. Chondroprotective activity of N-acetyl phenylalanine glucosamine derivative on knee joint structure and inflammation in a murine model of osteoarthritis. Osteoarthr. Cartil. 2017, 25, 589–599. [Google Scholar] [CrossRef] [Green Version]
  41. Naito, K.; Watari, T.; Furuhata, A.; Yomogida, S.; Sakamoto, K.; Kurosawa, H.; Kaneko, K.; Nagaoka, I. Evaluation of the effect of glucosamine on an experimental rat osteoarthritis model. Life Sci. 2010, 86, 538–543. [Google Scholar] [CrossRef]
  42. Leatherwood, J.L.; Gehl, K.L.; Coverdale, J.A.; Arnold, C.E.; Dabareiner, R.A.; Walter, K.N.; Lamprecht, E.D. Influence of oral glucosamine supplementation in young horses challenged with intra-articular lipopolysaccharide. J. Anim. Sci. 2016, 94, 3294–3302. [Google Scholar] [CrossRef] [PubMed]
  43. Scotto d’Abusco, A.; Politi, L.; Giordano, C.; Scandurra, R. A peptidyl-glucosamine derivative affects IKKalpha kinase activity in human chondrocytes. Arthritis Res. Ther. 2010, 12, R18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Scotto d’Abusco, A.; Cicione, C.; Calamia, V.; Negri, R.; Giordano, C.; Grigolo, B.; Politi, L.; Scandurra, R. Glucosamine and its N-acetyl-phenylalanine derivative prevent TNF-alpha-induced transcriptional activation in human chondrocytes. Clin. Exp. Rheumatol. 2007, 25, 847–852. [Google Scholar]
  45. Nakamura, H.; Shibakawa, A.; Tanaka, M.; Kato, T.; Nishioka, K. Effects of glucosamine hydrochloride on the production of prostaglandin E2, nitric oxide and metalloproteases by chondrocytes and synoviocytes in osteoarthritis. Clin. Exp. Rheumatol. 2004, 22, 293–299. [Google Scholar]
  46. Gouze, J.-N.; Gouze, E.; Popp, M.P.; Bush, M.L.; Dacanay, E.A.; Kay, J.D.; Levings, P.P.; Patel, K.R.; Saran, J.-P.S.; Watson, R.S.; et al. Exogenous glucosamine globally protects chondrocytes from the arthritogenic effects of IL-1β. Arthritis Res. Ther. 2006, 8, R173. [Google Scholar] [CrossRef] [Green Version]
  47. Someya, A.; Ikegami, T.; Sakamoto, K.; Nagaoka, I. Glucosamine Downregulates the IL-1β-Induced Expression of Proinflammatory Cytokine Genes in Human Synovial MH7A Cells by O-GlcNAc Modification-Dependent and -Independent Mechanisms. PLoS ONE 2016, 11, e0165158. [Google Scholar] [CrossRef] [Green Version]
  48. Drovanti, A.; Bignamini, A.A.; Rovati, A.L. Therapeutic activity of oral glucosamine sulfate in osteoarthrosis: A placebo-controlled double-blind investigation. Clin. Ther. 1980, 3, 260–272. [Google Scholar]
  49. Müller-Fassbender, H.; Bach, G.L.; Haase, W.; Rovati, L.C.; Setnikar, I. Glucosamine sulfate compared to ibuprofen in osteoarthritis of the knee. Osteoarthr. Cartil. 1994, 2, 61–69. [Google Scholar] [CrossRef]
  50. Veronese, N.; Demurtas, J.; Smith, L.; Reginster, J.Y.; Bruyère, O.; Beaudart, C.; Honvo, G.; Maggi, S. Glucosamine sulphate: An umbrella review of health outcomes. Ther. Adv. Musculoskelet. Dis. 2020, 12, 1759720x20975927. [Google Scholar] [CrossRef] [PubMed]
  51. Clegg, D.O.; Reda, D.J.; Harris, C.L.; Klein, M.A.; O’Dell, J.R.; Hooper, M.M.; Bradley, J.D.; Bingham, C.O., 3rd; Weisman, M.H.; Jackson, C.G.; et al. Glucosamine, chondroitin sulfate, and the two in combination for painful knee osteoarthritis. N. Engl. J. Med. 2006, 354, 795–808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Marczyński, W.; Tłustochowicz, W.; Tomaszewski, W.; Białecki, J. Literature Analysis Regarding the Combination of Substances: Glucosamine + Chondroitin in the Treatment of Osteoarthritis. Ortop. Traumatol. Rehabil. 2022, 24, 407–416. [Google Scholar] [CrossRef]
  53. Sun, Y.; Wang, C.; Gong, C. Repairing effects of glucosamine sulfate in combination with etoricoxib on articular cartilages of patients with knee osteoarthritis. J. Orthop. Surg. Res. 2020, 15, 150. [Google Scholar] [CrossRef] [Green Version]
  54. Bassleer, C.; Rovati, L.; Franchimont, P. Stimulation of proteoglycan production by glucosamine sulfate in chondrocytes isolated from human osteoarthritic articular cartilage in vitro. Osteoarthr. Cartil. 1998, 6, 427–434. [Google Scholar] [CrossRef] [Green Version]
  55. Ando, M.; Magi, S.; Seki, M.; Suzuki, Y.; Kasukawa, T.; Lefaudeux, D.; Hoffmann, A.; Okada, M. IκBα is required for full transcriptional induction of some NFκB-regulated genes in response to TNF in MCF-7 cells. NPJ Syst. Biol. Appl. 2021, 7, 42. [Google Scholar] [CrossRef] [PubMed]
  56. Mathes, E.; O’Dea, E.L.; Hoffmann, A.; Ghosh, G. NF-kappaB dictates the degradation pathway of IkappaBalpha. Embo J. 2008, 27, 1357–1367. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Kaltschmidt, C.; Greiner, J.F.W.; Kaltschmidt, B. The Transcription Factor NF-κB in Stem Cells and Development. Cells 2021, 10, 2042. [Google Scholar] [CrossRef] [PubMed]
  58. Proto, J.D.; Lu, A.; Dorronsoro, A.; Scibetta, A.; Robbins, P.D.; Niedernhofer, L.J.; Huard, J. Inhibition of NF-κB improves the stress resistance and myogenic differentiation of MDSPCs isolated from naturally aged mice. PLoS ONE 2017, 12, e0179270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Liang, Y.; Chen, G.; Yang, Y.; Li, Z.; Chen, T.; Sun, W.; Yu, M.; Pan, K.; Guo, W.; Tian, W. Effect of canonical NF-κB signaling pathway on the differentiation of rat dental epithelial stem cells. Stem Cell Res. Ther. 2019, 10, 139. [Google Scholar] [CrossRef] [Green Version]
  60. Chang, J.; Liu, F.; Lee, M.; Wu, B.; Ting, K.; Zara, J.N.; Soo, C.; Al Hezaimi, K.; Zou, W.; Chen, X.; et al. NF-κB inhibits osteogenic differentiation of mesenchymal stem cells by promoting β-catenin degradation. Proc. Natl. Acad. Sci. USA 2013, 110, 9469–9474. [Google Scholar] [CrossRef] [Green Version]
  61. Chisari, E.; Yaghmour, K.M.; Khan, W.S. The effects of TNF-alpha inhibition on cartilage: A systematic review of preclinical studies. Osteoarthr. Cartil. 2020, 28, 708–718. [Google Scholar] [CrossRef]
  62. Markway, B.D.; Cho, H.; Anderson, D.E.; Holden, P.; Ravi, V.; Little, C.B.; Johnstone, B. Reoxygenation enhances tumour necrosis factor alpha-induced degradation of the extracellular matrix produced by chondrogenic cells. Eur. Cell Mater. 2016, 31, 425–439. [Google Scholar] [CrossRef]
  63. Urech, D.M.; Feige, U.; Ewert, S.; Schlosser, V.; Ottiger, M.; Polzer, K.; Schett, G.; Lichtlen, P. Anti-inflammatory and cartilage-protecting effects of an intra-articularly injected anti-TNF{alpha} single-chain Fv antibody (ESBA105) designed for local therapeutic use. Ann. Rheum. Dis. 2010, 69, 443–449. [Google Scholar] [CrossRef]
  64. Güler-Yüksel, M.; Allaart, C.F.; Watt, I.; Goekoop-Ruiterman, Y.P.; de Vries-Bouwstra, J.K.; van Schaardenburg, D.; van Krugten, M.V.; Dijkmans, B.A.; Huizinga, T.W.; Lems, W.F.; et al. Treatment with TNF-α inhibitor infliximab might reduce hand osteoarthritis in patients with rheumatoid arthritis. Osteoarthr. Cartil. 2010, 18, 1256–1262. [Google Scholar] [CrossRef] [Green Version]
  65. Crisostomo, P.R.; Wang, Y.; Markel, T.A.; Wang, M.; Lahm, T.; Meldrum, D.R. Human mesenchymal stem cells stimulated by TNF-alpha, LPS, or hypoxia produce growth factors by an NF kappa B- but not JNK-dependent mechanism. Am. J. Physiol. Cell Physiol. 2008, 294, C675–C682. [Google Scholar] [CrossRef]
  66. Yan, L.; Zheng, D.; Xu, R.H. Critical Role of Tumor Necrosis Factor Signaling in Mesenchymal Stem Cell-Based Therapy for Autoimmune and Inflammatory Diseases. Front. Immunol. 2018, 9, 1658. [Google Scholar] [CrossRef] [Green Version]
  67. Sitcheran, R.; Cogswell, P.C.; Baldwin, A.S., Jr. NF-kappaB mediates inhibition of mesenchymal cell differentiation through a posttranscriptional gene silencing mechanism. Genes Dev. 2003, 17, 2368–2373. [Google Scholar] [CrossRef] [Green Version]
  68. Catrina, A.I.; Lampa, J.; Ernestam, S.; af Klint, E.; Bratt, J.; Klareskog, L.; Ulfgren, A.K. Anti-tumour necrosis factor (TNF)-alpha therapy (etanercept) down-regulates serum matrix metalloproteinase (MMP)-3 and MMP-1 in rheumatoid arthritis. Rheumatology 2002, 41, 484–489. [Google Scholar] [CrossRef] [Green Version]
  69. Gerstenfeld, L.C.; Cho, T.J.; Kon, T.; Aizawa, T.; Cruceta, J.; Graves, B.D.; Einhorn, T.A. Impaired intramembranous bone formation during bone repair in the absence of tumor necrosis factor-alpha signaling. Cells Tissues Organs 2001, 169, 285–294. [Google Scholar] [CrossRef] [PubMed]
  70. Oral, H.; Dorn, G.W., 2nd; Mann, D.L. Sphingosine mediates the immediate negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian cardiac myocyte. J. Biol. Chem. 1997, 272, 4836–4842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Pinto-Cardoso, R.; Pereira-Costa, F.; Pedro Faria, J.; Bandarrinha, P.; Bessa-Andrês, C.; Correia-de-Sá, P.; Bernardo Noronha-Matos, J. Adenosinergic signalling in chondrogenesis and cartilage homeostasis: Friend or foe? Biochem. Pharm. 2020, 174, 113784. [Google Scholar] [CrossRef] [PubMed]
  72. Tsuchida, A.I.; Beekhuizen, M.; t Hart, M.C.; Radstake, T.R.; Dhert, W.J.; Saris, D.B.; van Osch, G.J.; Creemers, L.B. Cytokine profiles in the joint depend on pathology, but are different between synovial fluid, cartilage tissue and cultured chondrocytes. Arthritis Res. Ther. 2014, 16, 441. [Google Scholar] [CrossRef] [Green Version]
  73. Chu, C.Q.; Field, M.; Feldmann, M.; Maini, R.N. Localization of tumor necrosis factor alpha in synovial tissues and at the cartilage-pannus junction in patients with rheumatoid arthritis. Arthritis Rheum. 1991, 34, 1125–1132. [Google Scholar] [CrossRef] [PubMed]
  74. Zhang, K.S.; Wang, J.F.; Zhang, S.L.; Li, Z.; Pei, Z.; Guan, Z.P. Effects of Tumor Necrosis Factor Alpha on the Expression of Programmed Cell Death Factor 5 in Arthritis. Orthop. Surg. 2019, 11, 698–704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Goldring, M.B.; Otero, M. Inflammation in osteoarthritis. Curr. Opin. Rheumatol. 2011, 23, 471–478. [Google Scholar] [CrossRef] [PubMed]
  76. Liu, Y.; Shah, K.M.; Luo, J. Strategies for Articular Cartilage Repair and Regeneration. Front. Bioeng. Biotechnol. 2021, 9, 770655. [Google Scholar] [CrossRef]
  77. Murakami, S.; Lefebvre, V.; de Crombrugghe, B. Potent Inhibition of the Master Chondrogenic FactorSox9 Gene by Interleukin-1 and Tumor Necrosis Factor-α*. J. Biol. Chem. 2000, 275, 3687–3692. [Google Scholar] [CrossRef] [Green Version]
  78. Liu, X.; Xu, Y.; Chen, S.; Tan, Z.; Xiong, K.; Li, Y.; Ye, Y.; Luo, Z.-P.; He, F.; Gong, Y. Rescue of proinflammatory cytokine-inhibited chondrogenesis by the antiarthritic effect of melatonin in synovium mesenchymal stem cells via suppression of reactive oxygen species and matrix metalloproteinases. Free Radic. Biol. Med. 2014, 68, 234–246. [Google Scholar] [CrossRef]
  79. Wehling, N.; Palmer, G.D.; Pilapil, C.; Liu, F.; Wells, J.W.; Müller, P.E.; Evans, C.H.; Porter, R.M. Interleukin-1β and tumor necrosis factor α inhibit chondrogenesis by human mesenchymal stem cells through NF-κB–dependent pathways. Arthritis Rheum. 2009, 60, 801–812. [Google Scholar] [CrossRef] [Green Version]
  80. Stanish, W.D.; McCormack, R.; Forriol, F.; Mohtadi, N.; Pelet, S.; Desnoyers, J.; Restrepo, A.; Shive, M.S. Novel scaffold-based BST-CarGel treatment results in superior cartilage repair compared with microfracture in a randomized controlled trial. J. Bone Jt. Surg. Am. 2013, 95, 1640–1650. [Google Scholar] [CrossRef] [Green Version]
  81. Chung, J.Y.; Lee, D.H.; Kim, T.H.; Kwack, K.S.; Yoon, K.H.; Min, B.H. Cartilage extra-cellular matrix biomembrane for the enhancement of microfractured defects. Knee Surg. Sport. Traumatol. Arthrosc. 2014, 22, 1249–1259. [Google Scholar] [CrossRef]
  82. Hu, H.; Liu, W.; Sun, C.; Wang, Q.; Yang, W.; Zhang, Z.; Xia, Z.; Shao, Z.; Wang, B. Endogenous Repair and Regeneration of Injured Articular Cartilage: A Challenging but Promising Therapeutic Strategy. Aging Dis. 2021, 12, 886–901. [Google Scholar] [CrossRef] [PubMed]
  83. Li, W.; Liu, Q.; Shi, J.; Xu, X.; Xu, J. The role of TNF-α in the fate regulation and functional reprogramming of mesenchymal stem cells in an inflammatory microenvironment. Front. Immunol. 2023, 14, 1074863. [Google Scholar] [CrossRef]
  84. Voskamp, C.; Koevoet, W.J.L.M.; Somoza, R.A.; Caplan, A.I.; Lefebvre, V.; van Osch, G.J.V.M.; Narcisi, R. Enhanced Chondrogenic Capacity of Mesenchymal Stem Cells after TNFα Pre-treatment. Front. Bioeng. Biotechnol. 2020, 8, 658. [Google Scholar] [CrossRef] [PubMed]
  85. Jeon, J.H.; Suh, H.N.; Kim, M.O.; Han, H.J. Glucosamine-induced reduction of integrin β4 and plectin complex stimulates migration and proliferation in mouse embryonic stem cells. Stem Cells Dev. 2013, 22, 2975–2989. [Google Scholar] [CrossRef]
  86. Ma, Y.; Zheng, W.; Chen, H.; Shao, X.; Lin, P.; Liu, X.; Li, X.; Ye, H. Glucosamine promotes chondrocyte proliferation via the Wnt/β-catenin signaling pathway. Int. J. Mol. Med. 2018, 42, 61–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Gordon, J.L. Extracellular ATP: Effects, sources and fate. Biochem. J. 1986, 233, 309–319. [Google Scholar] [CrossRef] [PubMed]
  88. Dou, L.; Chen, Y.F.; Cowan, P.J.; Chen, X.P. Extracellular ATP signaling and clinical relevance. Clin. Immunol. 2018, 188, 67–73. [Google Scholar] [CrossRef]
  89. Corciulo, C.; Lendhey, M.; Wilder, T.; Schoen, H.; Cornelissen, A.S.; Chang, G.; Kennedy, O.D.; Cronstein, B.N. Endogenous adenosine maintains cartilage homeostasis and exogenous adenosine inhibits osteoarthritis progression. Nat. Commun. 2017, 8, 15019. [Google Scholar] [CrossRef] [Green Version]
  90. Corciulo, C.; Cronstein, B.N. Signaling of the Purinergic System in the Joint. Front. Pharm. 2019, 10, 1591. [Google Scholar] [CrossRef] [Green Version]
  91. Hanley, P.J.; Musset, B.; Renigunta, V.; Limberg, S.H.; Dalpke, A.H.; Sus, R.; Heeg, K.M.; Preisig-Müller, R.; Daut, J. Extracellular ATP induces oscillations of intracellular Ca2+ and membrane potential and promotes transcription of IL-6 in macrophages. Proc. Natl. Acad. Sci. USA 2004, 101, 9479–9484. [Google Scholar] [CrossRef] [Green Version]
  92. Dexheimer, V.; Frank, S.; Richter, W. Proliferation as a requirement for in vitro chondrogenesis of human mesenchymal stem cells. Stem Cells Dev. 2012, 21, 2160–2169. [Google Scholar] [CrossRef] [Green Version]
  93. Iwamoto, T.; Nakamura, T.; Doyle, A.; Ishikawa, M.; de Vega, S.; Fukumoto, S.; Yamada, Y. Pannexin 3 regulates intracellular ATP/cAMP levels and promotes chondrocyte differentiation. J. Biol. Chem. 2010, 285, 18948–18958. [Google Scholar] [CrossRef] [Green Version]
  94. Kwon, H.J. Extracellular ATP signaling via P2X(4) receptor and cAMP/PKA signaling mediate ATP oscillations essential for prechondrogenic condensation. J. Endocrinol. 2012, 214, 337–348. [Google Scholar] [CrossRef] [Green Version]
  95. Jiang, W.; Xu, J. Immune modulation by mesenchymal stem cells. Cell Prolif. 2020, 53, e12712. [Google Scholar] [CrossRef] [Green Version]
  96. Kerkelä, E.; Laitinen, A.; Räbinä, J.; Valkonen, S.; Takatalo, M.; Larjo, A.; Veijola, J.; Lampinen, M.; Siljander, P.; Lehenkari, P.; et al. Adenosinergic Immunosuppression by Human Mesenchymal Stromal Cells Requires Co-Operation with T cells. Stem Cells 2016, 34, 781–790. [Google Scholar] [CrossRef] [Green Version]
  97. Bradley, J.R. TNF-mediated inflammatory disease. J. Pathol. 2008, 214, 149–160. [Google Scholar] [CrossRef]
  98. Beldi, G.; Khosravi, M.; Abdelgawad, M.E.; Salomon, B.L.; Uzan, G.; Haouas, H.; Naserian, S. TNFα/TNFR2 signaling pathway: An active immune checkpoint for mesenchymal stem cell immunoregulatory function. Stem Cell Res. Ther. 2020, 11, 281. [Google Scholar] [CrossRef]
  99. Wei, J.; Wang, K.; Hettinghouse, A.; Liu, C. Atsttrin Promotes Cartilage Repair Primarily Through TNFR2-Akt Pathway. Front. Cell Dev. Biol. 2020, 8, 577572. [Google Scholar] [CrossRef] [PubMed]
  100. Wajant, H.; Pfizenmaier, K.; Scheurich, P. Tumor necrosis factor signaling. Cell Death Differ. 2003, 10, 45–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  101. Xiao, D.; Bi, R.; Liu, X.; Mei, J.; Jiang, N.; Zhu, S. Notch Signaling Regulates MMP-13 Expression via Runx2 in Chondrocytes. Sci. Rep. 2019, 9, 15596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  102. Sandell, L.J.; Aigner, T. Articular cartilage and changes in Arthritis: Cell biology of osteoarthritis. Arthritis Res. Ther. 2001, 3, 107. [Google Scholar] [CrossRef] [Green Version]
  103. Gelse, K.; Pöschl, E.; Aigner, T. Collagens--structure, function, and biosynthesis. Adv. Drug Deliv. Rev. 2003, 55, 1531–1546. [Google Scholar] [CrossRef] [Green Version]
  104. Hong, Y.; Park, E.Y.; Kim, D.; Lee, H.; Jung, H.S.; Jun, H.S. Glucosamine potentiates the differentiation of adipose-derived stem cells into glucose-responsive insulin-producing cells. Ann. Transl. Med. 2020, 8, 561. [Google Scholar] [CrossRef]
  105. Sandell, L.J.; Morris, N.; Robbins, J.R.; Goldring, M.B. Alternatively spliced type II procollagen mRNAs define distinct populations of cells during vertebral development: Differential expression of the amino-propeptide. J. Cell Biol. 1991, 114, 1307–1319. [Google Scholar] [CrossRef] [Green Version]
  106. Lian, C.; Wang, X.; Qiu, X.; Wu, Z.; Gao, B.; Liu, L.; Liang, G.; Zhou, H.; Yang, X.; Peng, Y.; et al. Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1-SMAD1 interaction. Bone Res. 2019, 7, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  107. Vornehm, S.I.; Dudhia, J.; Von der Mark, K.; Aigner, T. Expression of collagen types IX and XI and other major cartilage matrix components by human fetal chondrocytes in vivo. Matrix. Biol. 1996, 15, 91–98. [Google Scholar] [CrossRef] [PubMed]
  108. Sandberg, M.; Vuorio, E. Localization of types I, II, and III collagen mRNAs in developing human skeletal tissues by in situ hybridization. J. Cell Biol. 1987, 104, 1077–1084. [Google Scholar] [CrossRef] [Green Version]
  109. Müller, P.K.; Lemmen, C.; Gay, S.; Gauss, V.; Kühn, K. Immunochemical and biochemical study of collagen synthesis by chondrocytes in culture. Exp. Cell Res. 1977, 108, 47–55. [Google Scholar] [CrossRef] [PubMed]
  110. Reichenberger, E.; Aigner, T.; von der Mark, K.; Stöss, H.; Bertling, W. In situ hybridization studies on the expression of type X collagen in fetal human cartilage. Dev. Biol. 1991, 148, 562–572. [Google Scholar] [CrossRef] [PubMed]
  111. Chawla, S.; Mainardi, A.; Majumder, N.; Dönges, L.; Kumar, B.; Occhetta, P.; Martin, I.; Egloff, C.; Ghosh, S.; Bandyopadhyay, A.; et al. Chondrocyte Hypertrophy in Osteoarthritis: Mechanistic Studies and Models for the Identification of New Therapeutic Strategies. Cells 2022, 11, 4034. [Google Scholar] [CrossRef]
  112. Wang, M.; Sampson, E.R.; Jin, H.; Li, J.; Ke, Q.H.; Im, H.J.; Chen, D. MMP13 is a critical target gene during the progression of osteoarthritis. Arthritis Res. Ther. 2013, 15, R5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  113. Scapin, G.; Bertalot, T.; Vicentini, N.; Gatti, T.; Tescari, S.; De Filippis, V.; Marega, C.; Menna, E.; Gasparella, M.; Parnigotto, P.P.; et al. Neuronal commitment of human circulating multipotent cells by carbon nanotube-polymer scaffolds and biomimetic peptides. Nanomedicine 2016, 11, 1929–1946. [Google Scholar] [CrossRef]
  114. Messore, A.; Madia, V.N.; Pescatori, L.; Saccoliti, F.; Tudino, V.; De Leo, A.; Bortolami, M.; De Vita, D.; Scipione, L.; Pepi, F.; et al. Novel Symmetrical Benzazolyl Derivatives Endowed with Potent Anti-Heparanase Activity. J. Med. Chem. 2018, 61, 10834–10859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  115. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  116. Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2−∆∆CT method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
Ijms 24 10397 g001 550
Figure 1. (A) Optical microscopy of CMC cells. Bar: 10 µm. (B–H) Flow cytometry analysis of subconfluent cultures. IgG control (grey peak); target protein (black peak). Data were normalized to the peak height (number of events), resulting in relative percentages (%) ± standard deviation (SD). The analysis was performed using FlowJo™ v10.8.1 Software (Ashland, OR, USA).
Figure 1. (A) Optical microscopy of CMC cells. Bar: 10 µm. (B–H) Flow cytometry analysis of subconfluent cultures. IgG control (grey peak); target protein (black peak). Data were normalized to the peak height (number of events), resulting in relative percentages (%) ± standard deviation (SD). The analysis was performed using FlowJo™ v10.8.1 Software (Ashland, OR, USA).
Ijms 24 10397 g001
Ijms 24 10397 g002 550
Figure 2. Cell viability analysis on CMCs pretreated with TNFα (10 ng/mL) for 3 h and then stimulated for a further 24 h with DCF001 (1 µg/mL) in a proliferative (A) or chondrogenic (B) medium. Data were expressed as a percentage (%) ± SD of viable cells detected using cell counting with the trypan blue exclusion of dead cells. In parallel, extracellular ATP (eATP) in PM (C) and CM (D) cultures was evaluated using the CellTiter-Glo® Luminescent Cell Viability Assay. Luminescence was read with a VICTOR® Nivo™ Plate Reader (PerkinElmer, Waltham, MA, USA) and then reported in relative light units (RLU). * p: vs. control; ° p: vs. DCF001-induced cells; ^ p: vs. TNFα-primed cells.
Figure 2. Cell viability analysis on CMCs pretreated with TNFα (10 ng/mL) for 3 h and then stimulated for a further 24 h with DCF001 (1 µg/mL) in a proliferative (A) or chondrogenic (B) medium. Data were expressed as a percentage (%) ± SD of viable cells detected using cell counting with the trypan blue exclusion of dead cells. In parallel, extracellular ATP (eATP) in PM (C) and CM (D) cultures was evaluated using the CellTiter-Glo® Luminescent Cell Viability Assay. Luminescence was read with a VICTOR® Nivo™ Plate Reader (PerkinElmer, Waltham, MA, USA) and then reported in relative light units (RLU). * p: vs. control; ° p: vs. DCF001-induced cells; ^ p: vs. TNFα-primed cells.
Ijms 24 10397 g002
Ijms 24 10397 g003 550
Figure 3. Detection of CD39 (A,C) and CD73 (B,D) expression in CMC cells. The samples were pretreated with TNFα (10 μg/mL) for 3 h and thus cultured for a further 24 h with a proliferative (PM) or chondrogenic (CM) medium supplemented with DCF001 (1 µg/mL). Unstimulated cells (control) or samples treated with only DCF001 or TNFα were used as references. The analysis was performed by flow cytometry using direct staining, and data were reported as representative histograms and relative MFI values (Rel. MFI = target MFI/Isotype IgG MFI). * p: vs. control; ^ p: vs. TNFα-primed cells.
Figure 3. Detection of CD39 (A,C) and CD73 (B,D) expression in CMC cells. The samples were pretreated with TNFα (10 μg/mL) for 3 h and thus cultured for a further 24 h with a proliferative (PM) or chondrogenic (CM) medium supplemented with DCF001 (1 µg/mL). Unstimulated cells (control) or samples treated with only DCF001 or TNFα were used as references. The analysis was performed by flow cytometry using direct staining, and data were reported as representative histograms and relative MFI values (Rel. MFI = target MFI/Isotype IgG MFI). * p: vs. control; ^ p: vs. TNFα-primed cells.
Ijms 24 10397 g003
Ijms 24 10397 g004 550
Figure 4. FCM analysis of TNFR1 and TNFR2 in CMC cells cultured in proliferative (PM) or chondrogenic (CM) medium or cells treated with only TNFα (10 μg/mL) and/or DCF001 (1 µg/mL). (+) Added to culture medium; (-) not added to culture medium. Histograms represent the basal expression of both TNFR1 and TNFR2 under PM and CM medium. Data from all experimental groups were reported in the table as the mean value of percent positive cells ±SEM. * p: vs. control in PM; ° p: vs. DCF001-induced cells in PM; ^ p: vs. TNFα-induced cells in CM.
Figure 4. FCM analysis of TNFR1 and TNFR2 in CMC cells cultured in proliferative (PM) or chondrogenic (CM) medium or cells treated with only TNFα (10 μg/mL) and/or DCF001 (1 µg/mL). (+) Added to culture medium; (-) not added to culture medium. Histograms represent the basal expression of both TNFR1 and TNFR2 under PM and CM medium. Data from all experimental groups were reported in the table as the mean value of percent positive cells ±SEM. * p: vs. control in PM; ° p: vs. DCF001-induced cells in PM; ^ p: vs. TNFα-induced cells in CM.
Ijms 24 10397 g004
Ijms 24 10397 g005 550
Figure 5. FCM detection of p-IκBα and IκBα in CMC cells cultured for 24 h by regular growth (control) or after treatment with DCF001 and/or TNFα under proliferative (PM) (blue peaks) or chondrogenic (CM) (red peaks) conditions. Data were reported as percentage expression (%) and p-IκB/IκBα expression ratio. The analysis was performed using indirect staining with primary antibodies against mouse anti-human p-IκBα or rabbit anti-human IκBα and Alexa Fluor® 488-conjugated secondary antibodies. Samples treated with only secondary antibodies were used as control (grey peaks). * p: vs. control; ^ p: vs. TNFα-primed cells.
Figure 5. FCM detection of p-IκBα and IκBα in CMC cells cultured for 24 h by regular growth (control) or after treatment with DCF001 and/or TNFα under proliferative (PM) (blue peaks) or chondrogenic (CM) (red peaks) conditions. Data were reported as percentage expression (%) and p-IκB/IκBα expression ratio. The analysis was performed using indirect staining with primary antibodies against mouse anti-human p-IκBα or rabbit anti-human IκBα and Alexa Fluor® 488-conjugated secondary antibodies. Samples treated with only secondary antibodies were used as control (grey peaks). * p: vs. control; ^ p: vs. TNFα-primed cells.
Ijms 24 10397 g005
Ijms 24 10397 g006 550
Figure 6. Gene expression study of CMCs stimulated with DCF001 under proliferative (A) or chondrogenic (B) conditions. Cell cultures were challenged with TNFα (100 ng/mL) for 3 h before stimulation for a further 24 h with DCF001 solubilized in a PM or CM medium. Total RNA was extracted using the TRI Reagent solution and analyzed by quantitative real-time polymerase chain reaction (RT-qPCR). Data were reported as a relative fold increase in gene expression. * p: vs. control; ^ p: vs. TNFα-primed sample.
Figure 6. Gene expression study of CMCs stimulated with DCF001 under proliferative (A) or chondrogenic (B) conditions. Cell cultures were challenged with TNFα (100 ng/mL) for 3 h before stimulation for a further 24 h with DCF001 solubilized in a PM or CM medium. Total RNA was extracted using the TRI Reagent solution and analyzed by quantitative real-time polymerase chain reaction (RT-qPCR). Data were reported as a relative fold increase in gene expression. * p: vs. control; ^ p: vs. TNFα-primed sample.
Ijms 24 10397 g006
Table
Table 1. Antibodies used for flow cytometry analysis.
Table 1. Antibodies used for flow cytometry analysis.
Primary AntibodiesManufacturing Company
Mouse anti-human CD39Santa Cruz Biotecnology, Inc. (Dallas, TX, USA)
FITC mouse anti-human CD44 BioLegend, Inc. (San Diego, CA, USA)
PE mouse anti-human CD45 Santa Cruz Biotecnology, Inc.
PE mouse anti-human CD73BioLegend, Inc.
FITC mouse anti-human CD90Santa Cruz Biotecnology, Inc.
PE mouse anti-human CD105 Santa Cruz Biotecnology, Inc.
PE mouse anti-human HLA DRSanta Cruz Biotecnology, Inc.
Rabbit anti-human TNFRIImmunological Sciences (Rome, Italy)
Rabbit anti-human TNFRIIImmunological Sciences
Mouse anti-human phospho-IκBα (Ser32/36)Cell Signaling Technology (Danvers, MA, USA)
Rabbit anti-human IκBαCell Signaling Technology
Isotype controlsManufacturing Company
FITC Isotype Control Santa Cruz Biotechnology, Inc.
PE Isotype Control BD Biosciences (San Jose, CA, USA)
Secondary antibodiesManufacturing Company
Alexa Fluor® 488-conjugated anti-rabbit secondary antibodyInvitrogen (Waltham, MA, USA)
Alexa Fluor® 488-conjugated anti-mouse secondary antibodyInvitrogen
Table
Table 2. Oligonucleotides used for RT qPCR analysis.
Table 2. Oligonucleotides used for RT qPCR analysis.
Target Gene AcronymSequence (5′–3′) Reference Sequence
Hypoxanthine Phosphoribosyltransferase1HPRT1 F: TGGACAGGACTGAACGTCTTGCT
R: TTGAGCACACAGAGGGCTACAATG		NM_000194.2
Collagen type II alpha 1 chain COL2A1F: CGGGCAGAGGGCAATAGCAGGTT
R: CAATGATGGGGAGGCGTGAG		NM_001844.4
Runt-related transcription factor RUNX2F: TCCGGAATGCCTCTTGCTGTTATGA
R: ACTGAGGCGGTCAGAGAACAAACT		BC108919
Matrix metallopeptidase 13MMP13F: GTTGGTCCGATGTAACTCCTC
R: GAAGTCGCCATGCTCCTTAAT		NM_002427
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gasparella, M.; Cenzi, C.; Piccione, M.; Madia, V.N.; Di Santo, R.; Tudino, V.; Artico, M.; Taurone, S.; De Ponte, C.; Costi, R.; et al. Effects of Modified Glucosamine on the Chondrogenic Potential of Circulating Stem Cells under Experimental Inflammation. Int. J. Mol. Sci. 2023, 24, 10397. https://doi.org/10.3390/ijms241210397

AMA Style

Gasparella M, Cenzi C, Piccione M, Madia VN, Di Santo R, Tudino V, Artico M, Taurone S, De Ponte C, Costi R, et al. Effects of Modified Glucosamine on the Chondrogenic Potential of Circulating Stem Cells under Experimental Inflammation. International Journal of Molecular Sciences. 2023; 24(12):10397. https://doi.org/10.3390/ijms241210397

Chicago/Turabian Style

Gasparella, Marco, Carola Cenzi, Monica Piccione, Valentina Noemi Madia, Roberto Di Santo, Valeria Tudino, Marco Artico, Samanta Taurone, Chiara De Ponte, Roberta Costi, and et al. 2023. "Effects of Modified Glucosamine on the Chondrogenic Potential of Circulating Stem Cells under Experimental Inflammation" International Journal of Molecular Sciences 24, no. 12: 10397. https://doi.org/10.3390/ijms241210397

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop