Resistin-like Molecule α and Pulmonary Vascular Remodeling: A Multi-Strain Murine Model of Antigen and Urban Ambient Particulate Matter Co-Exposure
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Daley, E.; Emson, C.; Guignabert, C.; Malefyt, R.D.W.; Louten, J.; Kurup, V.P.; Hogaboam, C.; Taraseviciene-Stewart, L.; Voelkel, N.F.; Rabinovitch, M.; et al. Pulmonary arterial remodeling induced by a Th2 immune response. J. Exp. Med. 2008, 205, 361–372. [Google Scholar] [CrossRef] [PubMed]
- Cogan, J.D.; Pauciulo, M.W.; Batchman, A.P.; Prince, M.A.; Robbins, I.M.; Hedges, L.K.; Stanton, K.C.; Wheeler, L.A.; Phillips, J.A.; Loyd, J.E.; et al. High Frequency of BMPR2 Exonic Deletions/Duplications in Familial Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med. 2006, 174, 590–598. [Google Scholar] [CrossRef]
- Davies, R.J.; Morrell, N.W. Molecular mechanisms of pulmonary arterial hypertension: Role of mutations in the bone morphogenetic protein type II receptor. Chest 2008, 134, 1271–1277. [Google Scholar] [CrossRef] [PubMed]
- Sztrymf, B.; Coulet, F.; Girerd, B.; Yaici, A.; Jais, X.; Sitbon, O.; Montani, D.; Souza, R.; Simonneau, G.; Soubrier, F.; et al. Clinical outcomes of pulmonary arterial hypertension in carriers of BMPR2 mutation. Am. J. Respir. Crit. Care Med. 2008, 177, 1377–1383. [Google Scholar] [CrossRef] [PubMed]
- Crosswhite, P.; Sun, Z. Nitric oxide, oxidative stress and inflammation in pulmonary arterial hypertension. J. Hypertens. 2010, 28, 201–212. [Google Scholar] [CrossRef]
- Aldred, M.A.; Machado, R.D.; James, V.; Morrell, N.W.; Trembath, R.C. Characterization of the BMPR2 5′-Untranslated Region and a Novel Mutation in Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 2007, 176, 819–824. [Google Scholar] [CrossRef]
- Rabinovitch, M. Molecular pathogenesis of pulmonary arterial hypertension. J. Clin. Investig. 2008, 118, 2372–2379. [Google Scholar] [CrossRef]
- Chan, S.Y.; Loscalzo, J. Pathogenic mechanisms of pulmonary arterial hypertension. J. Mol. Cell Cardiol. 2008, 44, 14–30. [Google Scholar] [CrossRef]
- Strange, J.W.; Wharton, J.; Phillips, P.G.; Wilkins, M.R. Recent insights into the pathogenesis and therapeutics of pulmonary hypertension. Clin. Sci. 2002, 102, 253–268. [Google Scholar] [CrossRef]
- Grunig, G.; Marsh, L.M.; Esmaeil, N.; Jackson, K.; Gordon, T.; Reibman, J.; Kwapiszewska, G.; Park, S.-H. Perspective: Ambient Air Pollution: Inflammatory Response and Effects on the Lung’s Vasculature. Pulm. Circ. 2014, 4, 25–35. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-H.; Chen, W.-C.; Durmus, N.; Bleck, B.; Reibman, J.; Riemekasten, G.; Grunig, G. The Effects of Antigen-Specific IgG1 Antibody for the Pulmonary-Hypertension-Phenotype and B Cells for Inflammation in Mice Exposed to Antigen and Fine Particles from Air Pollution. PLoS ONE 2015, 10, e0129910. [Google Scholar] [CrossRef]
- Park, S.H.; Chen, W.C.; Esmaeil, N.; Lucas, B.; Marsh, L.M.; Reibman, J.L.; Grunig, G. IL-13 and IL-17A induced pulmonary-hypertension-phenotype due to inhalation of antigen and fine particles from air pollution. Pulm. Circ. 2014, 4, 654–668. [Google Scholar] [CrossRef] [PubMed]
- Angelini, D.J.; Su, Q.; Kolosova, I.A.; Fan, C.; Skinner, J.T.; Yamaji-Kegan, K.; Collector, M.; Sharkis, S.J.; Johns, R.A. Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELM alpha) recruits bone marrow-derived cells to the murine pulmonary vasculature. PLoS ONE 2010, 5, e11251. [Google Scholar] [CrossRef] [PubMed]
- Angelini, D.J.; Su, Q.; Yamaji-Kegan, K.; Fan, C.; Skinner, J.T.; Champion, H.C.; Crow, M.T.; Johns, R.A. Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELMalpha) induces the vascular and hemodynamic changes of pulmonary hypertension. Am. J. Physiol. Lung. Cell Mol. Physiol. 2009, 296, L582–L593. [Google Scholar] [CrossRef]
- Angelini, D.J.; Su, Q.; Yamaji-Kegan, K.; Fan, C.; Skinner, J.T.; Poloczek, A.; El-Haddad, H.; Cheadle, C.; Johns, R.A. Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELMalpha) in chronic hypoxia- and antigen-mediated pulmonary vascular remodeling. Respir. Res. 2013, 14, 1–16. [Google Scholar] [CrossRef]
- Teng, X.; Li, D.; Champion, H.C.; Johns, R.A. FIZZ1/RELMα, a Novel Hypoxia-Induced Mitogenic Factor in Lung With Vasoconstrictive and Angiogenic Properties. Circ. Res. 2003, 92, 1065–1067. [Google Scholar] [CrossRef] [PubMed]
- Yamaji-Kegan, K.; Su, Q.; Angelini, D.J.; Champion, H.C.; Johns, R.A. Hypoxia-induced mitogenic factor has proangiogenic and proinflammatory effects in the lung via VEGF and VEGF receptor-2. Am. J. Physiol. Cell Mol. Physiol. 2006, 291, L1159–L1168. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Tan, H.; Irwin, D.M. Evolution of the Vertebrate Resistin Gene Family. PLoS ONE 2015, 10, e0130188. [Google Scholar] [CrossRef]
- Hue, I.; Capilla, E.; Rosell-Moll, E.; Balbuena-Pecino, S.; Goffette, V.; Gabillard, J.-C.; Navarro, I. Recent advances in the crosstalk between adipose, muscle and bone tissues in fish. Front. Endocrinol. 2023, 14, 1155202. [Google Scholar] [CrossRef]
- Holcomb, I.N.; Kabakoff, R.C.; Chan, B.; Baker, T.W.; Gurney, A.; Henzel, W.; Nelson, C.; Lowman, H.B.; Wright, B.D.; Skelton, N.J.; et al. FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J. 2000, 19, 4046–4055. [Google Scholar] [CrossRef]
- Dong, L.; Wang, S.-J.; Camoretti-Mercado, B.; Li, H.-J.; Chen, M.; Bi, W.-X. FIZZ1 Plays a Crucial Role in Early Stage Airway Remodeling of OVA-Induced Asthma. J. Asthma 2008, 45, 648–653. [Google Scholar] [CrossRef]
- Munitz, A.; Waddell, A.; Seidu, L.; Cole, E.T.; Ahrens, R.; Hogan, S.P.; Rothenberg, M.E. Resistin-like molecule α enhances myeloid cell activation and promotes colitis. J. Allergy Clin. Immunol. 2008, 122, 1200–1207.e1. [Google Scholar] [CrossRef] [PubMed]
- Nair, M.G.; Du, Y.; Perrigoue, J.G.; Zaph, C.; Taylor, J.J.; Goldschmidt, M.; Swain, G.P.; Yancopoulos, G.D.; Valenzuela, D.M.; Murphy, A.; et al. Alternatively activated macrophage-derived RELM-{alpha} is a negative regulator of type 2 inflammation in the lung. J. Exp. Med. 2009, 206, 937–952. [Google Scholar] [CrossRef] [PubMed]
- Johns, R.A.; Takimoto, E.; Meuchel, L.W.; Elsaigh, E.; Zhang, A.; Heller, N.M.; Semenza, G.L.; Yamaji-Kegan, K. Hypoxia-Inducible Factor 1alpha Is a Critical Downstream Mediator for Hypoxia-Induced Mitogenic Factor (FIZZ1/RELMalpha)-Induced Pulmonary Hypertension. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 134–144. [Google Scholar] [CrossRef]
- Renigunta, A.; Hild, C.; Rose, F.; Klepetko, W.; Grimminger, F.; Seeger, W.; Hänze, J. Faculty Opinions recommendation of Human RELMbeta is a mitogenic factor in lung cells and induced in hypoxia. FEBS Lett. 2006, 580, 900–903. [Google Scholar] [CrossRef]
- Su, Q.; Zhou, Y.; Johns, R.A. Bruton’s tyrosine kinase (BTK) is a binding partner for hypoxia induced mitogenic factor (HIMF/FIZZ1) and mediates myeloid cell chemotaxis. FASEB J. 2007, 21, 1376–1382. [Google Scholar] [CrossRef] [PubMed]
- Fan, C.; Su, Q.; Li, Y.; Liang, L.; Angelini, D.J.; Guggino, W.B.; Johns, R.A.; Yadav, V.R.; Song, T.; Mei, L.; et al. Hypoxia-induced mitogenic factor/FIZZ1 induces intracellular calcium release through the PLC-IP3 pathway. Am. J. Physiol. Cell Mol. Physiol. 2009, 297, L263–L270. [Google Scholar] [CrossRef] [PubMed]
- Fan, C.; Fu, Z.; Su, Q.; Angelini, D.J.; Van Eyk, J.; Johns, R.A. S100A11 Mediates Hypoxia-induced Mitogenic Factor (HIMF)-induced Smooth Muscle Cell Migration, Vesicular Exocytosis, and Nuclear Activation. Mol. Cell Proteom. 2011, 10, M110.000901. [Google Scholar] [CrossRef]
- Patel, S.D.; Rajala, M.W.; Rossetti, L.; Scherer, P.E.; Shapiro, L. Disulfide-Dependent Multimeric Assembly of Resistin Family Hormones. Science 2004, 304, 1154–1158. [Google Scholar] [CrossRef]
- Gerstmayer, B.; Küsters, D.; Gebel, S.; Müller, T.; Van Miert, E.; Hofmann, K.; Bosio, A. Identification of RELMγ, a novel resistin-like molecule with a distinct expression pattern☆. Genomics 2003, 81, 588–595. [Google Scholar] [CrossRef]
- Steppan, C.M.; Brown, E.J.; Wright, C.M.; Bhat, S.; Banerjee, R.R.; Dai, C.Y.; Enders, G.H.; Silberg, D.G.; Wen, X.; Wu, G.D.; et al. A family of tissue-specific resistin-like molecules. Proc. Natl. Acad. Sci. USA 2001, 98, 502–506. [Google Scholar] [CrossRef]
- Munitz, A.; Seidu, L.; Cole, E.T.; Ahrens, R.; Hogan, S.P.; Rothenberg, M.E. Resistin-Like Molecule α Decreases Glucose Tolerance during Intestinal Inflammation. J. Immunol. 2009, 182, 2357–2363. [Google Scholar] [CrossRef]
- Pesce, J.T.; Ramalingam, T.R.; Wilson, M.S.; Mentink-Kane, M.M.; Thompson, R.W.; Cheever, A.W.; Urban, J.F.; Wynn, T.A. Retnla (Relmα/Fizz1) Suppresses Helminth-Induced Th2-Type Immunity. PLOS Pathog. 2009, 5, e1000393. [Google Scholar] [CrossRef]
- Munitz, A.; Cole, E.T.; Karo-Atar, D.; Finkelman, F.D.; Rothenberg, M.E. Resistin-Like Molecule–α Regulates IL-13–Induced Chemokine Production but Not Allergen-Induced Airway Responses. Am. J. Respir. Cell Mol. Biol. 2012, 46, 703–713. [Google Scholar] [CrossRef]
- Weatherald, J.; Boucly, A.; Peters, A.; Montani, D.; Prasad, K.; Psotka, M.A.; Zannad, F.; Gomberg-Maitland, M.; McLaughlin, V.; Simonneau, G.; et al. The evolving landscape of pulmonary arterial hypertension clinical trials. Lancet 2022, 400, 1884–1898. [Google Scholar] [CrossRef] [PubMed]
- Sanz, M.J.; Johnston, B.; Issekutz, A.; Kubes, P. Endothelin-1 causes P-selectin-dependent leukocyte rolling and adhesion within rat mesenteric microvessels. Am. J. Physiol. Circ. Physiol. 1999, 277, H1823–H1830. [Google Scholar] [CrossRef] [PubMed]
- Czopek, A.; Moorhouse, R.; Gallacher, P.J.; Pugh, D.; Ivy, J.R.; Farrah, T.E.; Godden, E.; Hunter, R.W.; Webb, D.J.; Tharaux, P.-L.; et al. Endothelin blockade prevents the long-term cardiovascular and renal sequelae of acute kidney injury in mice. Sci. Transl. Med. 2022, 14, eabf5074. [Google Scholar] [CrossRef] [PubMed]
- Takeda, K.; Haczku, A.; Lee, J.J.; Irvin, C.G.; Gelfand, E.W. Strain dependence of airway hyperresponsiveness reflects differences in eosinophil localization in the lung. Am. J. Physiol. Cell Mol. Physiol. 2001, 281, L394–L402. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Lamm, W.J.; Albert, R.K.; Chi, E.Y.; Henderson, W.R.; Lewis, D.B. Influence of the route of allergen administration and genetic background on the murine allergic pulmonary response. Am. J. Respir. Crit. Care Med. 1997, 155, 661–669. [Google Scholar] [CrossRef]
- Mills, C.D.; Kincaid, K.; Alt, J.M.; Heilman, M.J.; Hill, A.M. M-1/M-2 macrophages and the Th1/Th2 paradigm. J. Immunol. 2000, 164, 6166–6173. [Google Scholar] [CrossRef]
- Watanabe, H.; Numata, K.; Ito, T.; Takagi, K.; Matsukawa, A. Innate immune response in Th1- and Th2-dominant mouse strains. Shock 2004, 22, 460–466. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-H.; Chen, W.-C.; Hoffman, C.; Marsh, L.M.; West, J.; Grunig, G. Modification of Hemodynamic and Immune Responses to Exposure with a Weak Antigen by the Expression of a Hypomorphic BMPR2 Gene. PLoS ONE 2013, 8, e55180. [Google Scholar] [CrossRef] [PubMed]
- McKenzie, J.C.; Kelley, K.B.; Merisko-Liversidge, E.M.; Kennedy, J.; Klein, R.M. Developmental Pattern of Ventricular Atrial Natriuretic Peptide (ANP) Expression in Chronically Hypoxic Rats as an Indicator of the Hypertrophic Process. J. Mol. Cell Cardiol. 1994, 26, 753–767. [Google Scholar] [CrossRef] [PubMed]
- Sanada, S.; Hakuno, D.; Higgins, L.J.; Schreiter, E.R.; McKenzie, A.N.; Lee, R.T. IL-33 and ST2 comprise a critical biomechanically induced and cardioprotective signaling system. J. Clin. Investig. 2007, 117, 1538–1549. [Google Scholar] [CrossRef]
- Evans, J.D.; Girerd, B.; Montani, D.; Wang, X.J.; Galiè, N.; Austin, E.D.; Elliott, G.; Asano, K.; Grünig, E.; Yan, Y.; et al. BMPR2 mutations and survival in pulmonary arterial hypertension: An individual participant data meta-analysis. Lancet Respir. Med. 2016, 4, 129–137. [Google Scholar] [CrossRef]
- Lin, Q.; Fan, C.; Gomez-Arroyo, J.; Van Raemdonck, K.; Meuchel, L.W.; Skinner, J.T.; Everett, A.D.; Fang, X.; Macdonald, A.A.; Yamaji-Kegan, K.; et al. HIMF (Hypoxia-Induced Mitogenic Factor) Signaling Mediates the HMGB1 (High Mobility Group Box 1)-Dependent Endothelial and Smooth Muscle Cell Crosstalk in Pulmonary Hypertension. Arter. Thromb. Vasc. Biol. 2019, 39, 2505–2519. [Google Scholar] [CrossRef]
- Lin, Q.; Fan, C.; Skinner, J.T.; Hunter, E.N.; Macdonald, A.A.; Illei, P.B.; Yamaji-Kegan, K.; Johns, R.A. RELMα Licenses Macrophages for Damage-Associated Molecular Pattern Activation to Instigate Pulmonary Vascular Remodeling. J. Immunol. 2019, 203, 2862–2871. [Google Scholar] [CrossRef]
- Tarkowski, A.; Bjersing, J.; Shestakov, A.; Bokarewa, M.I. Resistin competes with lipopolysaccharide for binding to toll-like receptor 4. J. Cell Mol. Med. 2009, 14, 1419–1431. [Google Scholar] [CrossRef]
- Jang, J.C.; Li, J.; Gambini, L.; Batugedara, H.M.; Sati, S.; Lazar, M.A.; Fan, L.; Pellecchia, M.; Nair, M.G. Human resistin protects against endotoxic shock by blocking LPS–TLR4 interaction. Proc. Natl. Acad. Sci. USA 2017, 114, E10399–E10408. [Google Scholar] [CrossRef]
- Tsukamoto, H.; Fukudome, K.; Takao, S.; Tsuneyoshi, N.; Ohta, S.; Nagai, Y.; Ihara, H.; Miyake, K.; Ikeda, Y.; Kimoto, M. Reduced Surface Expression of TLR4 by a V254I Point Mutation Accounts for the Low Lipopolysaccharide Responder Phenotype of BALB/c B Cells. J. Immunol. 2013, 190, 195–204. [Google Scholar] [CrossRef]
- Hoeper, M.M.; Badesch, D.B.; Ghofrani, H.A.; Gibbs, J.S.R.; Gomberg-Maitland, M.; McLaughlin, V.V.; Preston, I.R.; Souza, R.; Waxman, A.B.; Grünig, E.; et al. Phase 3 Trial of Sotatercept for Treatment of Pulmonary Arterial Hypertension. N. Engl. J. Med. 2023, 388, 1478–1490. [Google Scholar] [CrossRef]
- Joshi, S.R.; Liu, J.; Bloom, T.; Atabay, E.K.; Kuo, T.-H.; Lee, M.; Belcheva, E.; Spaits, M.; Grenha, R.; Maguire, M.C.; et al. Sotatercept analog suppresses inflammation to reverse experimental pulmonary arterial hypertension. Sci. Rep. 2022, 12, 7803. [Google Scholar] [CrossRef]
- Grunig, G.; Eichstaedt, C.A.; Verweyen, J.; Durmus, N.; Saxer, S.; Krafsur, G.; Stenmark, K.; Ulrich, S.; Grünig, E.; Pylawka, S. Circulating MicroRNA Markers for Pulmonary Hypertension in Supervised Exercise Intervention and Nightly Oxygen Intervention. Front. Physiol. 2018, 9, 955. [Google Scholar] [CrossRef]
- Hemnes, A.R.; Beck, G.J.; Newman, J.H.; Abidov, A.; Aldred, M.A.; Barnard, J.; Rosenzweig, E.B.; Borlaug, B.A.; Chung, W.K.; Comhair, S.A.A. PVDOMICS: A Multi-Center Study to Improve Understanding of Pulmonary Vascular Disease Through Phenomics. Circ. Res. 2017, 121, 1136–1139. [Google Scholar] [CrossRef] [PubMed]
- Hemnes, A.R.; Leopold, J.A.; Radeva, M.K.; Beck, G.J.; Abidov, A.; Aldred, M.A.; Barnard, J.; Rosenzweig, E.B.; Borlaug, B.A.; Chung, W.K.; et al. Clinical Characteristics and Transplant-Free Survival Across the Spectrum of Pulmonary Vascular Disease. J. Am. Coll. Cardiol. 2022, 80, 697–718. [Google Scholar] [CrossRef] [PubMed]
- Louis, R.; Harrison, T.W.; Chanez, P.; Menzella, F.; Philteos, G.; Cosio, B.G.; Lugogo, N.L.; de Luiz, G.; Burden, A.; Adlington, T.; et al. Severe Asthma Standard-of-Care Background Medication Reduction With Benralizumab: ANDHI in Practice Substudy. J. Allergy Clin. Immunol. Pract. 2023, 11, 1759–1770.e7. [Google Scholar] [CrossRef] [PubMed]
- Lin, Q.; Johns, R.A. Resistin family proteins in pulmonary diseases. Am. J. Physiol. Lung Cell. Mol. Physiol. 2020, 319, L422–L434. [Google Scholar] [CrossRef]
- Gordon, T. A centrifugal particle concentrator for use in inhalation toxicology. Inhal. Toxicol. 1999, 11, 71–87. [Google Scholar] [CrossRef]
- Gordon, T. Linking Health Effects to PM Components, Size, and Sources. Inhal. Toxicol. 2007, 19, 3–6. [Google Scholar] [CrossRef]
- Eisenbarth, S.C.; Piggott, D.A.; Huleatt, J.W.; Visintin, I.; Herrick, C.A.; Bottomly, K. Lipopolysaccharide-enhanced, toll-like receptor 4–dependent T helper cell type 2 responses to inhaled antigen. J. Exp. Med. 2002, 196, 1645–1651. [Google Scholar] [CrossRef]
- Chen, W.C.; Park, S.H.; Hoffman, C.; Philip, C.; Robinson, L.; West, J.; Grunig, G. Right ventricular systolic pressure measurements in combination with harvest of lung and immune tissue samples in mice. J. Vis. Exp. 2013, 71, e50023. [Google Scholar]
- Hoffman, C.; Park, S.-H.; Daley, E.; Emson, C.; Louten, J.; Sisco, M.; Malefyt, R.d.W.; Grunig, G. Interleukin-19: A Constituent of the Regulome That Controls Antigen Presenting Cells in the Lungs and Airway Responses to Microbial Products. PLoS ONE 2011, 6, e27629. [Google Scholar] [CrossRef] [PubMed]
- Padilla, J.; Daley, E.; Chow, A.; Robinson, K.; Parthasarathi, K.; McKenzie, A.N.J.; Tschernig, T.; Kurup, V.P.; Donaldson, D.D.; Grunig, G. IL-13 Regulates the Immune Response to Inhaled Antigens. J. Immunol. 2005, 174, 8097–8105. [Google Scholar] [CrossRef] [PubMed]
- Ford, J.G.; Rennick, D.; Donaldson, D.D.; Venkayya, R.; McArthur, C.; Hansell, E.; Kurup, V.P.; Warnock, M.; Grunig, G. Il-13 and IFN-gamma: Interactions in lung inflammation. J. Immunol. 2001, 167, 1769–1777. [Google Scholar] [CrossRef]
- Grunig, G.; Warnock, M.; Wakil, A.E.; Venkayya, R.; Brombacher, F.; Rennick, D.M.; Sheppard, D.; Mohrs, M.; Donaldson, D.D.; Locksley, R.M.; et al. Requirement for IL-13 Independently of IL-4 in Experimental Asthma. Science 1998, 282, 2261–2263. [Google Scholar] [CrossRef]
Severely Remodeled Pulmonary Artery (OVA-PM Exposed) | C57BL/6 | BALB/c | ||||||
---|---|---|---|---|---|---|---|---|
Median | Quartiles | Group n | p-Value | Median | Quartiles | Group n | p-Value | |
Wild Type | 12.03 | 1.315, 50.460 | 8 | 0.1919 | 7.275 | 0.00, 10.390 | 10 | 0.0126 |
RELMα−/− | 39.13 | 19.790, 41.800 | 9 | 0.000 | 0.00, 3.846 | 10 |
Target | Gene Name | Sequence (5’ to 3’) |
---|---|---|
ANP-F 1 | nppa | TACAGTGCGGTGTCCAACACAG |
ANP-R | nppa | TGCTTCCTCAGTCTGCTCACTC |
BNP-F | nppb | TCCTAGCCAGTCTCCAGAGCAA |
BNP-R | nppb | GGTCCTTCAAGAGCTGTCTCTG |
IL-33-F | il33 | ACTGCATGAGACTCCGTTCTG |
IL-33-R | il33 | CCTAGAATCCCGTGGATAGGC |
ST2 F | il1rl1 | GGATTGAGGTTGCTCTGTTCTGG |
ST2 R | il1rl1 | TCGGGCAGAGTGTGGTGAACAA |
β-actin-F | actb | GGCTGTATTCCCCTCCATCG |
β-actin-R | actb | CCAGTTGGTAACAATGCCATGT |
RELMα (TaqMan) | retnla | CTTGCCAATCCAGCTAACTATCCCT |
RELMβ (TaqMan) | retnlb | GGAAGCTCTCAGTCGTCAAGAGCCT |
RELMγ (TaqMan) | retnlg | AAACCTGGCTCATATCCCATTGATG |
Actin, β (TaqMan) | actb | ACTGAGCTGCGTTTTACACCCTTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Durmus, N.; Chen, W.-C.; Park, S.-H.; Marsh, L.M.; Kwon, S.; Nolan, A.; Grunig, G. Resistin-like Molecule α and Pulmonary Vascular Remodeling: A Multi-Strain Murine Model of Antigen and Urban Ambient Particulate Matter Co-Exposure. Int. J. Mol. Sci. 2023, 24, 11918. https://doi.org/10.3390/ijms241511918
Durmus N, Chen W-C, Park S-H, Marsh LM, Kwon S, Nolan A, Grunig G. Resistin-like Molecule α and Pulmonary Vascular Remodeling: A Multi-Strain Murine Model of Antigen and Urban Ambient Particulate Matter Co-Exposure. International Journal of Molecular Sciences. 2023; 24(15):11918. https://doi.org/10.3390/ijms241511918
Chicago/Turabian StyleDurmus, Nedim, Wen-Chi Chen, Sung-Hyun Park, Leigh M. Marsh, Sophia Kwon, Anna Nolan, and Gabriele Grunig. 2023. "Resistin-like Molecule α and Pulmonary Vascular Remodeling: A Multi-Strain Murine Model of Antigen and Urban Ambient Particulate Matter Co-Exposure" International Journal of Molecular Sciences 24, no. 15: 11918. https://doi.org/10.3390/ijms241511918