Genomic Regions Associated with Resistance to Three Rusts in CIMMYT Wheat Line “Mokue#1”
Abstract
1. Introduction
2. Results
2.1. Genetic Analysis
2.1.1. Seedling Rust Response Assessment
2.1.2. Field Rust Response Assessment
2.2. Linkage Map Construction
2.3. QTL Mapping
2.3.1. Seedling Resistance
2.3.2. Pleiotropic QTL Identified for Adult Plant Resistance to Stripe Rust and Leaf Rust
2.3.3. Other Identified QTLs for Stripe Rust and Stem Rust Resistance
2.4. Additive Interactions of Different QTLs Enhancing Rust Resistance
3. Discussion
3.1. QLrYr.cim-1BL
3.2. QLrYr.cim-2AS
3.3. QLrSr.cim-2DS
3.4. QYrKen.cim-2DL
3.5. QYrKEN.cim-6BS
3.6. QSr.cim-3AL
3.7. QSr.cim-6AS
4. Materials and Methods
4.1. Genetic Materials
4.2. Pathogen Materials
4.3. Greenhouse Phenotyping for Stripe Rust and Leaf Rust
4.4. Field Phenotyping for Stripe Rust, Leaf Rust, and Stem Rust
4.4.1. Stripe Rust and Leaf Rust Phenotyping in Mexico
4.4.2. Stripe Rust and Stem Rust Phenotyping in Njoro, Kenya
4.4.3. Rust Scoring
4.5. Statistical Analysis
4.6. Genotyping
4.6.1. DNA Extraction, Quantification, and DArTSeq Genotyping
4.6.2. Marker Validation
4.6.3. Linkage Map Construction and QTL Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Huerta-Espino, J.; Singh, R.P.; Crespo-Herrera, L.A.; Villaseñor-Mir, H.E.; Rodriguez-Garcia, M.F.; Dreisigacker, S. Adult plant slow rusting genes confer high levels of resistance to rusts in bread wheat cultivars from Mexico. Front. Plant Sci. 2020, 11, 824. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Dubcovsky, J.; Rogers, J.; Morris, C.; Appels, R.; Xia, X. Catalogue of Gene Symbols for Wheat, 2017 Supplement. 2017. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/symbolClassList.jsp (accessed on 1 August 2021).
- McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Xia, X.C.; Raupp, W.J. Catalogue of Gene Symbols for Wheat, 2020 Supplement. Ann. Wheat Newslett. 2020, 66, 109–128. [Google Scholar]
- Bhavani, S.; Hodson, D.P.; Huerta-Espino, J.; Randhawa, M.S.; Singh, R.P. Progress in breeding for resistance to Ug99 and other races of the stem rust fungus in CIMMYT wheat germplasm. Front. Agric. Sci. Eng. 2019, 6, 210–224. [Google Scholar] [CrossRef]
- Bhavani, S.; Singh, P.K.; Qureshi, N.; He, X.; Biswal, A.K.; Juliana, P.; Dababat, A.; Mourad, A.M.I. Globally important wheat diseases, status, challenges, breeding and genomic tools to enhance resistance durability. Genomic Des. Biot. Stress Resist. Cereal Crops. 2021, 2, 59–128. [Google Scholar]
- Singh, R.P.; Huerta-Espino, J.; Rajaram, S. Achieving near immunity to leaf and stripe rusts in wheat by combining slow rusting resistance genes. Acta Phytopathol. et Entomol. Hung. 2000, 35, 133–139. [Google Scholar]
- Li, J.; Dundas, I.; Dong, C.; Li, G.; Trethowan, R.; Yang, Z.; Hoxha, S.; Zhang, P. Identification and characterization of a new stripe rust resistance gene Yr83 on rye chromosome 6R in wheat. Theor. Appl. Genet. 2020, 133, 1095–1107. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.M.; Kang, Z.S. Introduction, history of research, symptoms, taxonomy of the pathogen, host range, distribution, and impact of stripe rust. In Stripe Rust; Chen, X.M., Kang, Z.S., Eds.; Springer: Dordrecht, The Netherlands, 2017; pp. 1–33. [Google Scholar]
- Feng, J.Y.; Wang, M.N.; See, D.R.; Chao, S.M.; Zheng, Y.L.; Chen, X.M. Characterization of novel gene Yr79 and four additional QTL for all-stage and high-temperature adult-plant resistance to stripe rust in spring wheat PI 182103. Phytopathology 2018, 108, 737–747. [Google Scholar] [CrossRef]
- Kolmer, J.A.; Su, Z.; Bernardo, A.; Bai, G.; Chao, S. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat. Theor. Appl. Genet. 2018, 131, 1553–1560. [Google Scholar] [CrossRef]
- Kolmer, J.A.; Bernardo, A.; Bai, G.; Hayden, M.J.; Chao, S. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL. Phytopathology 2018, 108, 246–253. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Welling, C.R.; Park, R.F. Wheat Rusts, An Atlas of Resistance Genes; CSIRO: Melbourne, Australia, 1995; p. 200. [Google Scholar]
- Nsabiyera, V.; Bariana, H.S.; Qureshi, N.; Wong, D.; Hayden, M.J.; Bansal, U.K. Characterisation and mapping of adult plant stripe rust resistance in wheat accession Aus27284. Theor. App. Genet. 2018, 131, 1459–1467. [Google Scholar] [CrossRef]
- Pakeerathan, K.; Bariana, H.; Qureshi, N.; Wong, D.; Hayden, M.; Bansal, U. Identification of a new source of stripe rust resistance Yr82 in wheat. Theor. Appl. Genet. 2019, 132, 3169–3176. [Google Scholar] [CrossRef]
- Pinto da Silva, G.B.; Zanella, C.M.; Martinelli, J.A.; Chaves, M.S.; Hiebert, C.W.; McCallum, B.D.; Boyd, L.A. Quantitative Trait Loci Conferring Leaf Rust Resistance in Hexaploid Wheat. Phytopathology 2018, 108, 1344–1354. [Google Scholar] [CrossRef] [PubMed]
- Rosewarne, G.M.; Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Lan, C.X.; He, Z. Quantitative trait loci of stripe rust resistance in wheat. Theor. Appl. Genet. 2013, 126, 2427–2449. [Google Scholar] [CrossRef] [PubMed]
- Kilian, A.; Wenzl, P.; Huttner, E.; Carling, J.; Xia, L.; Blois, H.; Caig, V.; Heller-Uszynska, K.; Jaccoud, D.; Hopper, C.; et al. Diversity arrays technology, a generic genome profiling technology on open platforms. Data Prod. Anal. Popul. Genom. Methods Protoc. 2012, 888, 67–89. [Google Scholar]
- Wang, S.; Wong, D.; Forrest, K.; Allen, A.; Chao, S.; Huang, B.E.; Maccaferri, M.; Salvi, S.; Milner, S.G.; Cattivelli, L.; et al. Characterization of polyploid wheat genomic diversity using a high-density 90,000 single nucleotide polymorphism array. Plant Biotech. J. 2014, 12, 787–796. [Google Scholar] [CrossRef] [PubMed]
- IWGSC. Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar] [CrossRef] [PubMed]
- Peterson, R.F.; Campbell, A.B.; Hannah, A.E. A diagrammatic scale for estimating rust intensity on leaves and stems of cereals. Can. J. Res. 1948, 26, 496–500. [Google Scholar] [CrossRef]
- Singh, R.P.; Herrera-Foessel, S.A.; Huerta-Espino, J.; Lan, C.X.; Basnet, B.R.; Bhavani, S.; Lagudah, E.S. Pleiotropic gene Lr46/Yr29/Pm39/Ltn2 confers slow rusting, adult plant resistance to wheat stem rust fungus. In Proceedings of the 2013 Technical Workshop, Borlaug Global Rust Initiative, New Delhi, India, 19–22 August 2013; APS Publications: St. Paul, MN, USA; p. 17.1. [Google Scholar]
- Borlaug, N.E.; Rupert, J.A.; Harrar, J.G. Nuevos Trigos Para México; México, D.F., Ed.; áFolleto de divulgación de Secretaria de Agricultura y Ganaderıá: Binghamton, NY, USA, 1949; p. 29. [Google Scholar]
- William, M.; Singh, R.P.; Huerta-Espino, J.; Islas, S.O.; Hoisington, D. Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene Yr29 in wheat. Phytopathology 2003, 93, 153–159. [Google Scholar] [CrossRef]
- Dreisigacker, S.; Crossa, J.; Pérez-rodríguez, P.; Montesinos-López, O.; Rosyara, U.; Juliana, P.; Mondal, S.; Crespo-Herrera, L.; Govindan, V.; Singh, R.P.; et al. Implementation of genomic selection in the CIMMYT global wheat program, findings from the past 10 years. Crop. Breed. Genet. Genom. 2021, 3, e210005. [Google Scholar]
- Lan, C.; Basnet, B.R. Overview of Bi-Parental QTL Mapping and Cloning Genes in the Context of Wheat Rust. In CIMMYT Wheat Molecular Genetics, Laboratory Protocols and Applications to Wheat Breeding; CIMMYT: El Batan, Mexico, 2016; pp. 39–46. [Google Scholar]
- Singh, R.P.; Mujeeb-Kazi, A.; Huerta-Espino, J. Lr46, a gene conferring slow rusting resistance to leaf rust in wheat. Phytopathology 1998, 88, 890–894. [Google Scholar] [CrossRef]
- Basnet, B.R.; Singh, R.P.; Herrera-Foessel, S.A.; Ibrahim, A.M.H.; Huerta-Espino, J.; Calvo-Salazar, V.; Rudd, J. Genetic analysis of adult plant resistance to yellow rust and leaf rust in common spring wheat Quaiu#3. Plant Dis. 2013, 97, 728–736. [Google Scholar]
- Lan, C.; Zhang, Y.; Herrera-Foessel, S.A.; Basnet, B.R.; Huerta-Espino, J.; Lagudah, E.S.; Singh, R.P. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata. Theor. Appl. Genet. 2015, 128, 549–561. [Google Scholar] [CrossRef]
- Lan, C.X.; Rosewarne, G.M.; Singh, R.P.; Herrera-Foessel, S.A.; Huerta-Espino, J.; Basnet, B.R.; Zhang, Y.L.; Yang, E.N. QTL characterization of resistance to leaf rust and stripe rust in the spring wheat line Francolin#1. Mol. Breed. 2014, 34, 789–803. [Google Scholar]
- Liu, D.; Yuan, C.; Singh, R.P.; Randhawa, M.S.; Bhavani, S.; Kumar, U.; Huerta-Espino, J.; Lagudah, E.; Lan, C. Stripe rust and leaf rust resistance in CIMMYT wheat line “Mucuy” is conferred by combinations of race-specific and adult-plant resistance loci. Front. Plant Sci. 2022, 13, 880138. [Google Scholar] [CrossRef]
- Ye, B.; Singh, R.P.; Yuan, C.; Liu, D.; Randhawa, M.S.; Huerta-Espino, J.; Bhavani, S.; Lagudah, E.; Lan, C. Three co-located resistance genes confer resistance to leaf rust and stripe rust in wheat variety Borlaug 100. Crop. J. 2022, 10, 490–497. [Google Scholar] [CrossRef]
- Yuan, C.; Singh, R.P.; Liu, D.; Randhawa, M.S.; Huerta-Espino, J.; Lan, C. Genome-Wide mapping of adult plant resistance to leaf rust and stripe rust in CIMMYT wheat line Arableu#1. Plant Dis. 2020, 104, 1455–1464. [Google Scholar]
- Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Zhong-qi, L.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop. Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
- Gao, L.; Koo, D.H.; Juliana, P.; Rife, T.; Singh, D.; Lemes Da Silva, C.; Lux, T.; Dorn, K.M.; Clinesmith, M.; Silva, P.; et al. The Aegilops ventricosa 2NvS segment in bread wheat, Cytology, genomics and breeding. Theor. Appl. Genet. 2021, 134, 529–542. [Google Scholar] [CrossRef] [PubMed]
- Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosomeª 2A. Genome 1993, 36, 476–482. [Google Scholar] [CrossRef] [PubMed]
- Bayles, R.A.; Flath, K.; Hovmoller, M.S.; Vallavieille-Pope, C.D. Breakdown of the Yr17 resistance to yellow rust of wheat in northern Europe. Agronomie 2000, 20, 805–811. [Google Scholar] [CrossRef]
- Hovmøller, M.S. Report for Puccinia striiformis Race Analysis 2013; Global Rust Reference Center, Aarhus University: Aarhus, Denmark, 2014; Available online: https://agro.au.dk/fileadmin/Summary_of_Puccinia_striiformis_race_analyses_2013.pdf (accessed on 1 August 2021).
- Wellings, C.R. Puccinia striiformis in Australia, A review of the incursion, evolution, and adaptation of stripe rust in the period 1979−2006. Aust. J. Agric. Res. 2007, 58, 567–575. [Google Scholar] [CrossRef]
- Sharma-Poudyal, D.; Chen, X.M.; Wan, A.M.; Zhan, G.M.; Kang, Z.S.; Cao, S.Q.; Jin, S.L.; Morgounov, A.; Akin, B.; Mert, Z.; et al. Virulence characterization of international collections of the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici. Plant Dis. 2013, 97, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, H.; Xie, J.; Guo, B.; Chen, Y.; Zhang, H.; Lu, P.; Wu, Q.; Li, M.; Zhang, D.; et al. Mapping stripe rust resistance genes by BSR-Seq, YrMM58 and YrHY1 on chromosome 2AS in Chinese wheat lines Mengmai 58 and Huaiyang 1 are Yr17. Crop. J. 2018, 6, 91–98. [Google Scholar] [CrossRef]
- He, X.; Kabir, M.R.; Roy, K.K.; Marza, F.; Chawade, A.; Duveiller, E.; Saint-Pierre, C.; Singh, P.K. Genetic dissection for head blast resistance in wheat using two mapping populations. Heredity 2022, 128, 402–410. [Google Scholar] [CrossRef]
- Toth, J.; Pandurangan, S.; Burt, A.; Mitchell-Fetch, J.; Kumar, S. Marker-assisted breeding of hexaploid spring wheat in the canadian prairies. Can. J. Plant Sci. 2019, 99, 111–127. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Yamazaki, Y.; Dubcovsky, J.; Rogers, J.; Morris, C.; Somers, D.J.; Appels, R.; Devos, K.M. Catalogue of Gene Symbols for Wheat. National BioResource Project, Komugi-Wheat Genetic Resources Database. 2008. Available online: http://shigen.nig.ac.jp/wheat/komugi/genes/download.jsp (accessed on 1 August 2021).
- Lan, C.; Hale, I.L.; Herrera-Foessel, S.A.; Basnet, B.R.; Randhawa, M.S.; Huerta-Espino, J.; Dubcovsky, J.; Singh, R.P. Characterization and mapping of leaf rust and stripe rust resistance loci in hexaploid wheat lines UC1110 and PI610750 under Mexican environments. Front. Plant Sci. 2017, 8, 1450. [Google Scholar] [CrossRef]
- Bhavani, S.; Singh, R.P.; Argillier, O.; Huerta-Espino, J.; Singh, S.; Njau, P.; Brun, S.; Lacam, S.; Desmouceaux, N. Mapping durable adult plant stem rust resistance to the race Ug99 group in six CIMMYT wheats. In Proceedings of the Borlaug Global Rust Initiative 2011 Technical Workshop, Borlaug Global Rust Initiative, Ithaca, NY, USA, 13–16 June 2011; McIntosh, R.A., Ed.; APS Publisher: Saint Paul, MN, USA; pp. 43–53. [Google Scholar]
- Bajgain, P.; Rouse, M.N.; Bhavani, S.; Anderson, J.A. QTL mapping of adult plant resistance to Ug99 stem rust in the spring wheat population RB07/MN06113-8. Mol. Breed. 2015, 35, 1–15. [Google Scholar] [CrossRef]
- Riley, R.; Chapman, V.; Johnson, R. The incorporation of alien disease resistance in wheat by genetic interference with the regulation of meiotic chromosome synapsis. Genet. Res. 1968, 12, 199–219. [Google Scholar] [CrossRef]
- Worland, A.J.; Law, C.N. Genetic analysis of chromosome 2D of wheat I. The location of genes affecting height, day-length insensitivity, hybrid dwarfism and yellow-rust resistance. Z. für Pflanzenzüchtung. 1986, 96, 331–345. [Google Scholar]
- Marais, G.F.; McCallum, B.; Snyman, J.E.; Pretorius, Z.A.; Marais, A.S. Leaf rust and stripe rust resistance genes Lr54 and Yr37 transferred to wheat from Aegilops kotschyi. Plant Breed. 2005, 124, 538–541. [Google Scholar] [CrossRef]
- Wang, M.N.; Chen, X.M. Stripe rust resistance. In Stripe Rust; Chen, X.M., Kang, Z.S., Eds.; Springer: Dordrecht, The Netherlands, 2017; pp. 353–558. [Google Scholar]
- Mallard, S.; Gaudet, D.; Aldeia, A.; Abelard, C.; Besnard, A.L.; Sourdille, P.; Dedryver, F. Genetic analysis of durable resistance to yellow rust in bread wheat. Theor. Appl. Genet. 2005, 110, 1401–1409. [Google Scholar] [CrossRef] [PubMed]
- Jagger, L.J.; Newell, C.; Berry, S.T.; Maccormack, R.; Boyd, L.A. Histopathology provides a phenotype by which to characterize stripe rust resistance genes in wheat. Plant Pathol. 2011, 60, 640–648. [Google Scholar] [CrossRef]
- Rollar, S.; Geyer, M.; Hartl, L.; Mohler, V.; Ordon, F.; Serfling, A. Quantitative Trait Loci mapping of adult plant and seedling resistance to stripe rust (Puccinia striiformis Westend.) in a multiparent advanced generation intercross wheat population. Front. Plant Sci. 2021, 12, 684671. [Google Scholar] [CrossRef]
- Ren, Y.; He, Z.; Li, J.; Lillemo, M.; Wu, L.; Bai, B.; Lu, Q.; Zhu, H.; Zhou, G.; Du, J.; et al. QTL mapping of adult-plant resistance to stripe rust in a population derived from common wheat cultivars Naxos and Shanghai 3/Catbird. Theor. Appl. Genet. 2012, 125, 1211–1221. [Google Scholar] [CrossRef]
- Suenaga, K.; Singh, R.P.; Huerta-Espino, J.; William, H.M. Microsatellite markers for genes Lr34/Yr18 and other quantitative trait loci for leaf rust and stripe rust resistance in bread wheat. Phytopathology 2003, 93, 881–890. [Google Scholar] [CrossRef]
- Uauy, C.; Brevis, J.C.; Chen, X.; Khan, I.; Jackson, L.; Chicaiza, O.; Distelfeld, A.; Fahima, T.; Dubcovsky, J. High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. Dicoccoides is closely linked to the grain protein content locus Gpc-B1. Theor. Appl. Genet. 2005, 112, 97–105. [Google Scholar]
- Dong, Z.; Hegarty, J.M.; Zhang, J.; Zhang, W.; Chao, S.; Chen, X.; Zhou, Y.; Dubcovsky, J. Validation and characterization of a QTL for adult plant resistance to stripe rust on wheat chromosome arm 6BS (Yr78). Theor. Appl. Genet. 2017, 130, 2127–2137. [Google Scholar] [CrossRef]
- Soriano, J.M.; Alvaro, F. Discovering consensus genomic regions in wheat for root-related traits by QTL meta-analysis. Sci. Rep. 2019, 9, 10537. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Hu, Y.; Gong, F.; Jin, Y.; Xia, Y.; He, Y.; Jiang, Y.; Zhou, Q.; He, J.; Feng, L.; et al. Identification and mapping of QTL for stripe rust resistance in the Chinese wheat cultivar Shumai126. Plant Dis. 2022, 106, 1278–1285. [Google Scholar] [CrossRef] [PubMed]
- Bariana, H.; Bansal, U.; Schmidt, A.; Lehmensiek, J.; Kaur, H.; Miah, N.; Howes, H.M.; Intyre, C.L. Molecular mapping of adult plant stripe rust resistance in wheat and identification of pyramided QTL genotypes. Euphytica 2010, 176, 251–260. [Google Scholar] [CrossRef]
- Santra, D.K.; Chen, X.M.; Santra, M.; Campbell, K.G.; Kidwell, K.K. Identification and mapping QTL for high-temperature adult-plant resistance to stripe rust in winter wheat (Triticum aestivum L.) cultivar ‘Stephens’. Theor. Appl. Genet. 2008, 117, 793–802. [Google Scholar] [CrossRef]
- Liu, L.; Yuan, C.Y.; Wang, M.N.; See, D.R.; Zemetra, R.S.; Chen, X.M. QTL analysis of durable stripe rust resistance in the North American winter wheat cultivar Skiles. Theor. Appl. Genet. 2019, 132, 1677–1691. [Google Scholar] [CrossRef]
- Yu, L.X.; Barbier, H.; Rouse, M.N.; Singh, S.; Singh, R.P.; Bhavani, S.; Huerta-Espino, J.; Sorrells, M.E. A consensus map for Ug99 stem rust resistance loci in wheat. Theor. Appl. Genet. 2014, 127, 1561–1581. [Google Scholar] [CrossRef]
- Letta, T.; Maccaferri, M.; Badebo, A.; Ammar, K.; Ricci, A.; Crossa, J.; Tuberosa, R. Searching for novel sources of field resistance to Ug99 and Ethiopian stem rust races in durum wheat via association mapping. Theor. Appl. Genet. 2013, 126, 1237–1256. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.P.; McIntosh, R.A. Cytogenetical studies in wheat. XIV. Sr8b for resistance to Puccinia graminis f. sp. tritici. Can. J. Genet. Cytol. 1986, 28, 189–197. [Google Scholar] [CrossRef]
- Hailu, E.; Woldaeb, G.; Denbel, W.; Alemu, W.; Abebe, T. Distribution of stem rust (Puccinia graminis f. sp. tritici) races in Ethiopia. Adv. Crop. Sci. Tech. 2015, 3, 173. [Google Scholar] [CrossRef]
- Olivera, P.D.; Jin, Y.; Rouse, M.N.; Badebo, A.; Fetch, T.; Singh, R.P.; Yahyaoui, A. Races of Puccinia graminis f. sp. tritici with combined virulence to Sr13 and Sr9e in a field stem rust screening nursery in Ethiopia. Plant Dis. 2012, 96, 623–628. [Google Scholar] [CrossRef] [PubMed]
- Nirmala, J.; Saini, J.; Newcomb, M.; Olivera, P.; Gale, S.; Klindworth, D.; Elias, E.; Talbert, L.; Chao, S.; Faris, J.; et al. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates. Genes Genomes Genet. 2017, 7, 3481–3490. [Google Scholar] [CrossRef] [PubMed]
- Randhawa, M.S.; Lan, C.; Basnet, B.R.; Bhavani, S.; Huerta-Espino, J.; Forrest, K.L.; Hayden, M.J.; Singh, R.P. Interactions among genes Sr2/Yr30, Lr34/Yr18/Sr57 and Lr68 confer enhanced adult plant resistance to rust diseases in common wheat (Triticum aestivum L.) line Arula. Aust. J. Crop. Sci. 2018, 12, 1023–1033. [Google Scholar] [CrossRef]
- Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Rosewarne, G.M.; Periyannan, S.K.; Viccars, L.; Calvo-Salazar, V.; Lan, C.; Lagudah, E.S. Lr68, a new gene conferring slow rusting resistance to leaf rust in wheat. Theor. Appl. Genet. 2012, 124, 1475–1486. [Google Scholar] [CrossRef]
- Kosgey, Z.C.; Edae, E.A.; Dill-Macky, R.; Jin, Y.; Bulbula, W.D.; Gemechu, A.; Macharia, G.; Bhavani, S.; Randhawa, M.S.; Rouse, M.N. Mapping and validation of stem rust resistance loci in spring wheat line CI 14275. Front. Plant. Sci. 2021, 11, 609659. [Google Scholar] [CrossRef] [PubMed]
- Hovmøller, M.S.; Patpour, M.; Rodrigues-Algaba, J.; Thach, T.; Sorensen, C.K.; Justesen, A.F.; Hansen, J.G. GRRC Report of Yellow and Stem Rust Genotyping and Race Analyses 2021; Global Rust Reference Center, Aarhus University: Aarhus, Denmark, 2021; Available online: https://agro.au.dk/fileadmin/www.grcc.au.dk/International_Services/Pathotype_YR_results/GRRC_Annual_Report2021.pdf (accessed on 1 August 2021).
- Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: El Batan, Mexico, 1992. [Google Scholar]
- Knott, D.R. The wheat rust pathogens. In The Wheat Rusts—Breeding for Resistance; Springer: Berlin/Heidelberg, Germany, 1989; pp. 14–37. [Google Scholar]
- Wright, S. Evolution and the Genetics of Populations, Volume 1: Genetic and Biometric Foundations; University of Chicago Press: Chicago, IL, USA, 1968. [Google Scholar]
- Dreisigacker, S.; Sehgal, D.; Luna, B.; Reyes, A.E.; Mollins, J. CIMMYT Wheat Molecular Genetics Laboratory Protocols and Applications to Wheat Breeding; CIMMYT: El Batan, Mexico, 2012. [Google Scholar]
- Qureshi, N.; Bariana, H.; Forrest, K.; Hayden, M.; Keller, B.; Wicker, T.; Faris, J.; Salina, E.; Bansal, U. Fine mapping of the chromosome 5B region carrying closely linked rust resistance genes Yr47 and Lr52 in wheat. Theor. App. Genet. 2017, 130, 495–504. [Google Scholar] [CrossRef]
- Seah, S.; Bariana, H.; Jahier, J.; Sivasithamparam, K.; Lagudah, E.S. The introgressed segment carrying rust resistance genes Yr17, Lr37 and Sr38 in wheat can be assayed by a cloned disease resistance gene-like sequence. Theor. Appl. Genet. 2001, 102, 600–605. [Google Scholar] [CrossRef]
- Hussain, W.; Baenziger, P.S.; Belamkar, V.; Guttieri, M.J.; Venegas, J.P.; Easterly, A.; Sallam, A.; Poland, J. Genotyping-by-Sequencing Derived High-Density Linkage Map and its Application to QTL Mapping of Flag Leaf Traits in Bread Wheat. Sci. Rep. 2017, 7, 16394. [Google Scholar] [CrossRef] [PubMed]
- Taylor, J.; Butler, D. R package ASMap, efficient genetic linkage map construction and diagnosis. J. Stat. Softw. 2017, 79, 1–29. [Google Scholar] [CrossRef]
- Wang, S.; Basten, C.J.; Zeng, Z.B. Windows QTL Cartographer 2.5; Department of Statistics, North Carolina State University: Raleigh, NC, USA, 2011. [Google Scholar]
- Li, H.H.; Ye, G.Y.; Wang, J.K. A modified algorithm for the improvement of composite interval mapping. Genetics 2007, 175, 361–374. [Google Scholar] [CrossRef]
- Voorrips, R. MapChart, software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]






| LR19-1 | LR19-2 | LR20 | LR21-1 | LR21-2 | YR20-1 | YR20-2 | YR20-3 | YR20-4 | YR21-1 | |
|---|---|---|---|---|---|---|---|---|---|---|
| LR19-2 | 0.82 | |||||||||
| LR20 | 0.69 | 0.80 | ||||||||
| LR21-1 | 0.78 | 0.84 | 0.81 | |||||||
| LR21-2 | 0.79 | 0.85 | 0.82 | 0.94 | ||||||
| YR20-1 | 0.57 | 0.65 | 0.61 | 0.65 | 0.67 | |||||
| YR20-2 | 0.59 | 0.69 | 0.64 | 0.69 | 0.71 | 0.97 | ||||
| YR20-3 | 0.55 | 0.65 | 0.63 | 0.65 | 0.67 | 0.92 | 0.93 | |||
| YR20-4 | 0.56 | 0.67 | 0.64 | 0.67 | 0.69 | 0.92 | 0.94 | 0.97 | ||
| YR21-1 | 0.53 | 0.60 | 0.62 | 0.62 | 0.66 | 0.85 | 0.86 | 0.87 | 0.88 | |
| YR21-2 | 0.57 | 0.62 | 0.62 | 0.66 | 0.68 | 0.85 | 0.87 | 0.87 | 0.88 | 0.97 |
| YRKEN20-1 | YRKEN20-2 | YRKEN21-1 | YRKEN21-2 | SR20-1 | SR20-2 | SR20-3 | SR21-1 | SR21-2 | |
|---|---|---|---|---|---|---|---|---|---|
| YRKEN20-2 | 0.93 | ||||||||
| YRKEN21-1 | 0.86 | 0.88 | |||||||
| YRKEN21-2 | 0.86 | 0.88 | 0.96 | ||||||
| SR20-1 | 0.30 | 0.31 | 0.24 | 0.18 | |||||
| SR20-2 | 0.22 | 0.22 | 0.14 | 0.10 | 0.91 | ||||
| SR20-3 | 0.16 | 0.17 | 0.08 | 0.06 | 0.80 | 0.91 | |||
| SR21-1 | −0.06 | −0.07 | −0.10 | −0.13 | 0.51 | 0.53 | 0.55 | ||
| SR21-2 | −0.14 | −0.14 | −0.18 | −0.22 | 0.51 | 0.55 | 0.59 | 0.88 | |
| SR21-3 | −0.16 | −0.16 | −0.20 | −0.24 | 0.48 | 0.53 | 0.59 | 0.79 | 0.93 |
| QTL | Year * | Left Peak Marker | Right Peak Marker | Wheat Consensus Map v4 | LOD | PVE ** (%) | Additive Effect |
|---|---|---|---|---|---|---|---|
| QLrYr.cim-1BL | LR19-1 | 100116174a1 | CIM0003 | 257–258 cM | 18.5 | 18 | 7.1 |
| LR19-2 | 100116174a1 | CIM0003 | 257–258 cM | 18.86 | 17 | 9.5 | |
| LR20 | 100116174a1 | CIM0003 | 257–258 cM | 11.02 | 15 | 10.4 | |
| LR21-1 | CIM0003 | 2930786a1 | 257–258 cM | 5.19 | 5 | 6.84 | |
| LR21-2 | CIM0003 | 2930786a1 | 257–258 cM | 5.74 | 5 | 8.24 | |
| YR20-1 | 100116174a1 | CIM0003 | 257–258 cM | 17.42 | 10 | 8.46 | |
| YR20-2 | 100116174a1 | CIM0003 | 257–258 cM | 18.14 | 11 | 10.2 | |
| YR20-3 | 100116174a1 | CIM0003 | 257–258 cM | 15 | 9 | 7.6 | |
| YR20-4 | 100116174a1 | CIM0003 | 257–258 cM | 17.9 | 10 | 9.7 | |
| YR21-1 | 100116174a1 | CIM0003 | 257–258 cM | 10.2 | 5 | 6 | |
| YR21-2 | 100116174a1 | CIM0003 | 257–258 cM | 14.3 | 8 | 9.15 | |
| YRKEN20-1 | 100116174a1 | SNPG122 | 257–258 cM | 21.8 | 22 | 7.6 | |
| YRKEN20-2 | CIM0003 | 2930786a1 | 257–258 cM | 20.64 | 19 | 10.9 | |
| YRKEN21-1 | 1202629a1 | SNPG122 | 257–258 cM | 14.97 | 17 | 10.2 | |
| YRKEN21-2 | 1202629a1 | SNPG122 | 257–258 cM | 13 | 13 | 11.9 | |
| QLrYr.cim-2AS | LRMBJ/SP | 100043009 | 1229550 | 8–15 cM | 5.44 | 6 | 0.12 |
| Lr19-1 | 100043009 | 1229550 | 8–15 cM | 15.5 | 15 | 6.39 | |
| Lr19-2 | 100043009 | 1229550 | 8–15 cM | 21.96 | 19 | 10.92 | |
| LR20 | 100043009 | 1229550 | 8–15 cM | 19.3 | 19 | 11.65 | |
| LR21-1 | 100159996 | WGGB156 | 3–8 cM | 16.58 | 13 | 7.51 | |
| LR21-2 | WGGB156 | 1696236 | 3–8 cM | 28.6 | 24 | 13.6 | |
| YRMEX14.191 | 100159996 | WGGB156 | 3–8 cM | 14.72 | 21 | 0.23 | |
| YR20-1 | 100159996 | WGGB156 | 3–8 cM | 59 | 46 | 18.7 | |
| YR20-2 | 100159996 | WGGB156 | 3–8 cM | 55.8 | 45 | 22.1 | |
| YR20-3 | 100159996 | WGGB156 | 3–8 cM | 12.6 | 7 | 11.2 | |
| YR20-4 | 100159996 | WGGB156 | 3–8 cM | 13.6 | 7 | 13.6 | |
| YR21-1 | 100159996 | WGGB156 | 3–8 cM | 14.2 | 7 | 11.4 | |
| YR21-2 | 100159996 | WGGB156 | 3–8 cM | 4.7 | 3 | 9.25 | |
| QLrSr.cim-2DS | Lr19-1 | 1102611 | 1111273 | 14–16 cM | 14 | 14 | 6.3 |
| Lr19-2 | 1102611 | 1111273 | 14–16 cM | 18.8 | 15 | 9.4 | |
| LR20 | 1102611 | 1111273 | 14–16 cM | 15.2 | 14 | 9.9 | |
| LR21-1 | 1102611 | 1111273 | 14–16 cM | 19.9 | 19 | 8.6 | |
| LR21-2 | 1102611 | 1111273 | 14–16 cM | 24.7 | 20 | 11.5 | |
| SR21-1 | 1102611 | 1111273 | 14–16 cM | 6.43 | 9 | 2 | |
| SR21-2 | 1102611 | 1111273 | 14–16 cM | 8.7 | 12 | 4 | |
| SR21-3 | 1102611 | 1111273 | 14–16 cM | 7 | 8 | 4.3 | |
| QYrKen.cim-2DL | YRKEN20-1 | 100016397 | NA *** | 134 cM | 8.65 | 8 | 4.6 |
| YRKEN20-2 | 100016397 | NA *** | 134 cM | 11.6 | 11 | 8.1 | |
| YRKEN21-1 | 100085243 | NA *** | 128 cM | 12.11 | 13 | 9.2 | |
| YRKEN21-2 | 100085243 | NA *** | 128 cM | 14.4 | 15 | 13.2 | |
| QYrKen.cim-6BS | YRKEN20-1 | 1391687 | 100043543 | 21–24 Mb **** | 6.97 | 8 | 4.3 |
| YRKEN20-2 | 1391687 | 100043543 | 21–24 Mb **** | 4 | 4 | 4.6 | |
| YRKEN21-2 | 1391687 | 100043543 | 21–24 Mb **** | 4 | 5 | 7.18 | |
| QSr.cim-3AL | SR20-1 | 1216682 | 100151514 | 65–68 cM | 5.6 | 8 | 2.64 |
| SR20-2 | 1216682 | 100151514 | 65–68 cM | 9.07 | 13 | 6.05 | |
| QSr.cim-6AS | SR20-1 | 12698326 | 33870647 | 13 Mb **** | 4 | 8 | 3 |
| SR20-2 | 12698326 | 33870647 | 13 Mb **** | 7.4 | 14 | 5.04 | |
| SR20-3 | 12698326 | 33870647 | 13 Mb **** | 7.3 | 15 | 6.48 |
| S/No. | DArTSeq Marker | KASP Marker | Allele A1 a Primer | Allele A2 b Primer | Common Primer | SNP |
|---|---|---|---|---|---|---|
| 1 | 2259918 | CIM0003 | tcaaacactcgtcacagtacc | tcaaacactcgtcacagtacg | ctcgaacatcacgtcctccc | [G/C] |
| 2 | 100072906 | CIM0001 | tgggcgtgaagatggagaa | tgggcgtgaagatggagag | ctccaggcaggggagctc | [T/C] |
| 3 | 991084 | CIM0004 | atgtccggacagactgcagg | atgtccggacagactgcaga | ccctctgagcaagcatacga | [G/A] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qureshi, N.; Singh, R.P.; Gonzalez, B.M.; Velazquez-Miranda, H.; Bhavani, S. Genomic Regions Associated with Resistance to Three Rusts in CIMMYT Wheat Line “Mokue#1”. Int. J. Mol. Sci. 2023, 24, 12160. https://doi.org/10.3390/ijms241512160
Qureshi N, Singh RP, Gonzalez BM, Velazquez-Miranda H, Bhavani S. Genomic Regions Associated with Resistance to Three Rusts in CIMMYT Wheat Line “Mokue#1”. International Journal of Molecular Sciences. 2023; 24(15):12160. https://doi.org/10.3390/ijms241512160
Chicago/Turabian StyleQureshi, Naeela, Ravi Prakash Singh, Blanca Minerva Gonzalez, Hedilberto Velazquez-Miranda, and Sridhar Bhavani. 2023. "Genomic Regions Associated with Resistance to Three Rusts in CIMMYT Wheat Line “Mokue#1”" International Journal of Molecular Sciences 24, no. 15: 12160. https://doi.org/10.3390/ijms241512160
APA StyleQureshi, N., Singh, R. P., Gonzalez, B. M., Velazquez-Miranda, H., & Bhavani, S. (2023). Genomic Regions Associated with Resistance to Three Rusts in CIMMYT Wheat Line “Mokue#1”. International Journal of Molecular Sciences, 24(15), 12160. https://doi.org/10.3390/ijms241512160

