Next Article in Journal
The Role of Intracellular Ca2+ and Mitochondrial ROS in Small Aβ1-42 Oligomer-Induced Microglial Death
Previous Article in Journal
Interactome of Arabidopsis ATG5 Suggests Functions beyond Autophagy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 15
10.3390/ijms241512313
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression Profiling Reveals the Possible Involvement of the Ubiquitin–Proteasome Pathway in Abiotic Stress Regulation in Gracilariopsis lemaneiformis

by
Feng Qin
,
Guangqiang Shui
,
Zheng Li
,
Mengge Tu
and
Xiaonan Zang
*
Key Laboratory of Marine Genetics and Breeding, Ministry of Education, Ocean University of China, Qingdao 266003, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(15), 12313; https://doi.org/10.3390/ijms241512313
Submission received: 12 June 2023 / Revised: 16 July 2023 / Accepted: 25 July 2023 / Published: 1 August 2023
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Review Reports Versions Notes

Abstract

:
Gracilariopsis lemaneiformis is an economically important red macroalga, the cultivation of which is affected by abiotic stresses. This research intends to study the response mechanism of various components of the ubiquitin-protease pathway to abiotic stress in G. lemaneiformis. The algae were treated with five common external stresses (high temperature, low temperature, O3, PEG, and water shortage) to study the macroscopic and microscopic manifestations of the ubiquitin–proteasome pathway. Firstly, the changes in soluble protein and ubiquitin were detected during the five treatments, and the results showed that the content of soluble protein and ubiquitin significantly increased under most stresses. The content of the soluble protein increased the most on the second day after 20% PEG treatment, which was 1.38 times higher than that of the control group, and the content of ubiquitin increased the most 30 min after water shortage treatment, which was 3.6 times higher than that of the control group. Then, 12 key genes (E1, E2, UPL1, HRD1, UFD1, Cul3, Cul4, DDB2, PIAS1, FZR1, APC8, and COP1) of the ubiquitin–proteasome pathway were studied, including an estimation of the probably regulatory elements in putative promoter regions and an analysis of transcript levels. The results showed that CAAT box, LTR, GC motif, and MBS elements were present in the putative promoter regions, which might have endowed the genes with the ability to respond to stress. The transcript analysis showed that under high temperature, low temperature, PEG, O3, and water shortage, all of the genes exhibited instant and significant up-regulation, and different genes had different response levels to different stresses. Many of them also showed the synergistic effect of transcript up-regulation under various stress treatments. In particular, E1, E2, Cul3, Cul4, UPL1, HRD1, and COP1 performed most significantly under the five stresses. Collectively, our exploration of the ubiquitin–proteasome pathway and the transcript levels of key genes suggest a significant role to cope with adversity, and potential candidate genes can be selected for transformation to obtain stress-resistant strains.

1. Introduction

Gracilariopsis lemaneiformis is one of the major seaweeds in China, which has important economic value due to its high agar content, many beneficial active substances such as phycobiliproteins and sulfated polysaccharides, and its ability of bioremediation. Wild G. lemaneiformis is mainly distributed in the intertidal zone of the Shandong Peninsula, the growth and development of which is significantly affected by abiotic stresses, such as temperature, O3, and water shortage, which can cause organelle dysfunction, alterations in cell structure, or cell death. During their long-term evolution, algae have developed various behavioral and molecular strategies to avoid or eliminate the damage caused by abiotic stresses. Studies on algae under various stresses have shown that the antioxidant system, the signal transduction system, the heat shock protein response system, the ubiquitin–protease degradation system, and other functional factors all play an important role in the process of different stresses [1,2,3,4]. Algae often activate the antioxidant systems in response to stress, including antioxidant enzymes that comprise superoxide dismutase, glutathione reductase, catalases, ascorbate peroxidase, and non-enzymatic components that comprise ascorbate, flavonoids, carotenoids, glutathione, tocopherols, and phenols, which can respond to alleviate the damage of free radicals in the early stages of stress [5,6,7]. The presence of the ubiquitin–proteasome pathway is also considered to be an important strategy used to cope with these abiotic stresses. Protein ubiquitination (ubiquitin–proteasome system, UPS) is an important process that is essential for maintaining a balanced level of proteins by degradation of the damaged or surplus proteins. The essential components of protein ubiquitination are ubiquitin, ubiquitin-activating enzyme E1, ubiquitin-binding enzyme E2, ubiquitin-protein ligase E3, and 26S proteasome. More than 80% of intracellular proteins are degraded through their cascade reactions. The ubiquitin–proteasome system participates in all aspects of plant life, including growth and development, circadian rhythm, signal transduction, and abiotic stress [8,9,10,11]. Many reports have shown that the components of the ubiquitin–proteasome system result in enhanced tolerance to abiotic stresses in algae. For example, Ligr found that the ratio of ubiquitin-binding proteins and the rate of ubiquitin synthesis in Chlamydomonas reinhardtii increased during cold stress [12]. Tang et al. conducted a transcriptome analysis on pathogen infections in Porphyra yezoensis and found that the expression of genes related to the ubiquitin–proteasome system (UPS) significantly increased during infection [13]. There is a difference in ubiquitin in Saccharina japonica under normal stress and heat stress: compared with normal conditions, 152 lysine ubiquitination sites in 106 proteins were significantly up-regulated after heat shock [14]. Niaz et al. found that the ubiquitin–proteasome system in Alexandrium catenella was activated and significantly up-regulated under low nitrogen and low phosphorus [15]. Li et al. analyzed the expression of the ubiquitin-activating enzyme (E1) and the ubiquitin-binding enzyme (E2) in G. lemaneiformis under high temperature stress, which showed that the ubiquitin–proteasome system could be effectively activated to cope with high temperatures [16]. These findings suggest that protein ubiquitination plays an important role in stress resistance in algae. However, research on the ubiquitin–proteasome system in large red algae is still significantly lacking.
In our previous study, the transcriptome sequencing of G. lemaneiformis at low temperatures was performed and it was found that most genes of the ubiquitin–protease degradation pathway were significantly up-regulated during low-temperature stress [17]. The genes were also reported to have an essential role in most stresses [18,19,20,21]. The above findings prompted us to undertake an analysis of these genes and check for the abiotic stress regulatory roles of these genes in G. lemaneiformis. Therefore, in this study, first, soluble protein and ubiquitin were detected in G. lemaneiformis after exposure to various common stresses (high temperature, low temperature, O3, PEG, and water shortage) for different durations (0, 1, 2, 3, 6, and 9 days). This study also predicted the putative promoter regions of these genes to explore potential cis-acting elements. In addition, a transcript analysis under a variety of abiotic stress conditions was carried out. Our findings can provide insight into the physiological mechanisms of resistance to stresses, as well as the identification of candidate UPS-related genes that might have roles in inducing stress tolerance and could be exploited for stress manipulation in G. lemaneiformis.

2. Results

2.1. Identification and Analysis of the Upstream Sequences of UPS-Related Genes

The nucleotide sequence of 1 kb upstream of the starting codon ATG was assessed, and a good amount of stress- and signal-responsive elements were discovered (Figure 1). The upstream region of all genes contained at least one CAAT box and ABRE, distributed at different locations upstream of the genes; 92% of the upstream region of the genes contained TGACG-motif and MYB recognition sites, 83% of the upstream region of the genes contained STRE, 75% of the upstream region of the genes contained G-box, 50% of the upstream region of the genes contained MBS, and 33% of the upstream region of the genes contained CAAT box and LTR. Only the upstream region of E1 contained GARE and AT-rich elements. These elements are all related to abiotic stress, indicating that UPS-related genes may be involved in various abiotic stresses.

2.2. Changes in Soluble Protein and Ubiquitin (Ub) under Different Stresses

2.2.1. Changes in Soluble Protein and Ubiquitin (Ub) under High Temperature Stress

Changes in the content of soluble protein and ubiquitin were observed under high temperature (33 °C) stress (Figure 2). In the HT (high temperature) group, both soluble protein and ubiquitin displayed an increasing and then a decreasing trend as the heat stress duration extended. This pattern suggests that short-term exposure to high temperature led to an elevation in ubiquitin content, potentially enhancing the stress resistance of algae. However, prolonged exposure to high temperature caused severe protein denaturation, leading to a decline in soluble protein content. Despite this, the level of ubiquitin remained higher than that of the control group, suggesting its role in assisting the algae in coping with stress. Notably, the highest soluble protein content was observed after two days of heat stress, exhibiting a significant increase of 10.8% compared to the control group (p < 0.05). Similarly, the highest ubiquitin levels were recorded after two days of heat stress, showing a substantial increase of 179% compared to the control group (p < 0.05). Overall, high temperature exposure induced an increase in both ubiquitin and soluble protein content.

2.2.2. Changes in Soluble Protein and Ubiquitin under Low Temperature Stress

Under low temperature (5 °C) stress (Figure 3), the content of soluble protein and ubiquitin exhibited distinct changes. In the LT (low temperature) group, the content of soluble protein showed a declining trend as the stress duration increased. Conversely, the content of ubiquitin demonstrated an increasing pattern over time, reaching its highest level after nine days of stress, with a significant increase of 247% compared to the control group (p < 0.05). Overall, the low temperature stress resulted in an elevation in ubiquitin content. However, this stress condition did not contribute to an increase in soluble protein content.

2.2.3. Changes in Soluble Protein and Ubiquitin under O3 Stress

The content of soluble protein and ubiquitin changed under O3 stress (Figure 4). The content of soluble protein displayed fluctuations over the stress period, while the content of ubiquitin exhibited a notable and significant increase on the sixth day after stress, surpassing that of the control group (p < 0.05).

2.2.4. Changes in Soluble Protein and Ubiquitin under PEG Stresses

Different concentrations of PEG induced distinct changes in the content of soluble protein and ubiquitin (Figure 5). Under 5% and 20% PEG stresses, the content of soluble protein in the treatment group was consistently higher than that of the control group at most time points (p < 0.05) (Figure 5a,e). This increase in soluble protein content was in line with the observed elevation in ubiquitin content. Conversely, under 10% PEG stress, the content of ubiquitin increased initially and then decreased with stress duration, mirroring the fluctuations in soluble protein content compared to the control group (Figure 5c,d). In summary, both excessively high and excessively low PEG concentrations led to an increase in both ubiquitin and soluble protein contents.

2.2.5. Changes in Soluble Protein and Ubiquitin under Water Shortage Stress

Distinct responses in the content of soluble protein and ubiquitin were observed under different periods of water shortage stress (Figure 6). The content of ubiquitin started to increase significantly after 20 to 30 min of drought stress (p < 0.05), whereas no significant increase was observed during the initial 5 to 10 min of stress. Similarly, the content of soluble protein did not increase until 10 min of drought stress (p < 0.05). Overall, the occurrence of water shortage stress triggered an augmentation in both ubiquitin and soluble protein contents.

2.3. Transcriptional Regulation of Genes in Response to Different Stress

A heat map depicting gene transcription under each experimental condition was generated (Figure 7), and the expression levels were also represented as bar charts in Figure S2. The gene transcription levels were calculated at different time points under stress conditions relative to the untreated control group at corresponding time points.
In response to high temperature stress, the transcription level of E2 was immediately activated and continued to increase until 6 h, while UPL1 started its activation early and continued to increase until 72 h. The transcription level of E1 was 2.8 and 3.9 times higher than that of the control group at 6 and 24 h, respectively. Similarly, the transcription level of HRD1 was 3.9 and 3.3 times higher than that of the control group at 6 and 12 h, respectively. Additionally, the transcription level of COP1 was 9.1 times higher than that of the control group at 24 h.
Under low temperature stress, only UPL1 displayed an immediate response (1 h), with the transcription level of 8.3 times higher than that of the control group, which was significantly different from the control group. Nearly all genes were up-regulated at 24 and 48 h, and HRD1 consistently exhibited high expression levels at 6, 12, 24, 48, and 72 h.
Under the treatment of O3, the immediate activation of E1, E2, UPL1, UFD1, Cul3, Cul4, and COP1 in response to O3 stress suggests the rapid damage caused by O3 to the algae. Subsequently, all genes showed up-regulation at 12 h. Notably, UPL1, Cul3, Cul4, and COP1 maintained high expression levels during the later stages of stress (48 and 72 h).
In the case of water shortage stress, most genes exhibited immediate up-regulation, but they did not sustain further enhancement, except for UFD1. This suggests that severe water shortage stress may inhibit the transcription levels of genes, hindering their continued up-regulation.
To investigate the impact of different stress levels, 5%, 10%, and 20% PEG stresses were used. At equivalent stress time points, an increasing trend of gene expression levels from the 5% PEG to the 20% PEG group was observed. Cul3, Cul4, and COP1 consistently exhibited up-regulation in both the 5% and 20% PEG groups. Surprisingly, most genes did not up-regulate as expected under 10% PEG stress, except at 12 h. This observation suggests that an appropriate concentration of PEG might ensure the stability of enzyme proteins, thus weakening the expression of related enzyme proteins of the ubiquitin–proteasome system as a pathway for degrading erroneous or damaged proteins.
Additionally, the Venn diagrams depicting the overlaps of gene transcription in response to high temperature, low temperature, O3, and different concentrations of PEG at specific time points are presented (Figure 8a–f). The up-regulated genes in response to various abiotic stress treatments are also listed in Table S1. Specifically, E2 exhibited up-regulation at 1 h under all five different stress conditions. At 6 h, E2, HRD1, Cul3, and Cul4 were up-regulated under all five stress conditions. Similarly, HRD1, Cul3, FZR1, COP1, and APC8 showed up-regulation at 12 h under all five different stress treatments. At 24 h, E1, PIAS1, and COP1 were up-regulated in response to all five different stresses, while COP1 was up-regulated at 48 h under all stress conditions. Additionally, E2 was up-regulated at 72 h during all five different stress treatments. Furthermore, the overlaps of gene transcription in response to water shortage at different time points are represented in Figure 8g. Under water shortage conditions, HRD1, Cul3, Cul4, FZR1, and COP1 were up-regulated at 5 and 10 min, but all genes exhibited down-regulation at 20 and 30 min, except for UFD1.
Furthermore, E1 and E2, the pivotal enzymes involved in the ubiquitin–proteasome system, consistently exhibited high transcription levels under all five stress conditions, especially prominent during the O3 stress. This observation aligns with their functional roles in accepting and transferring ubiquitin molecules and ensuring the activation of the related genes encoding E3 and UFD1. The transcription levels of nine E3 ubiquitin ligases are presented in Figure 7. Notably, UPL1 consistently displayed up-regulation at each time point during high temperature and O3 stress treatments. Similarly, Cul3 and Cul4 were consistently up-regulated in response to O3, 5% PEG, and 20% PEG treatments. HRD1 maintained up-regulation at 6, 12, 24, 48, and 72 h under low temperature and 5% PEG treatment, as well as at each time point during 20% PEG stress. Moreover, COP1 sustained up-regulation at 12, 24, and 48 h under high temperature, low temperature, O3, and 10% PEG treatments, and it also remained up-regulated at each time point during 5% PEG and 20% PEG conditions. Furthermore, UFD1, known for mediating the transfer of ubiquitin to the 26S proteasome, remained up-regulated after exposure to O3 for 1, 12, 24, and 72 h, as well as at each time point during 20% PEG stress. The consistent up-regulation of these enzymes, which are integral to the ubiquitin–proteasome pathway and encoded by the identified genes, suggests their crucial positive roles in responding to diverse stresses.

3. Discussion

Although ubiquitination plays a crucial role in cellular processes, its investigation in algae remains limited. Abiotic stresses, including high temperature, low temperature, drought, and oxidation, can have severe detrimental effects on algae. These stresses impede algae’s photosynthesis, disrupt chloroplast stability, and induce protein damage and denaturation [22,23]. G. lemaneiformis, a large agar-producing algae, is particularly susceptible to these abiotic stresses, leading to a significant reduction in its yield. In response to these abiotic stresses, algae initiate the regulation of gene expression to modulate their growth and development. Therefore, the initial step in comprehending algae’s stress response involves identifying genes that potentially play a role in stress regulation. Through the screening of differentially expressed genes in G. lemaneiformis under low temperature stress, it was discovered that the ubiquitin–proteasome pathway plays a pivotal role in this regulatory process [17]. Consequently, this study aims to elucidate the fundamental components of the ubiquitin–protease degradation system, with a specific focus on its efficient regulation under stressful conditions.
Under stress conditions, the up-regulation of most genes in the ubiquitin–protease degradation system may be attributed to the presence of specific regulatory elements, such as the CAAT box and TATA box, located in their promoter regions. These boxes serve as binding sites for the transcription factor CTF/NF-1, which modulates transcription initiation frequency and contributes to the induction of gene expression [24,25,26]. Additionally, the presence of LTR in promoter regions of certain genes indicates their responsiveness to low temperature stress. The activation of E1, UFD1, UPL1, and COP1 under low temperature stress may be associated with the presence of LTR in their upstream regions. Similarly, genes responding to anoxic inducibility harbor GC motifs in their upstream regions. The activation of FZR1, Cul4, and COP1 under ozone stress may be linked to the presence of GC motifs in their promoters. Moreover, genes involved in drought resistance demonstrate the presence of MYB binding sites (MBS), where MYB transcription factors potentially regulate their response to drought stress signals and transcriptional mechanisms. E1, HRD1, UFD1, Cul3, FZR1, and PIAS1 possess MBS motifs in their upstream promoter regions, indicating their crucial role in responding to drought stress. Additionally, genes containing ABA response elements (ABRE) and MYB elements are known to enhance resistance to various stresses in plants. E1, E2, HRD1, UFD1, UPL1, Cul3, Cul4, DDB2, PIAS1, FZR1, APC8, and COP1 all harbor ABA response elements in their promoter regions, suggesting their significance in responding to multiple stresses. Furthermore, genes responding to osmotic stress and heat shock contain stress-responsive elements (STRE) in their promoter regions. The activation of E2, HRD1, UFD1, Cul3, Cul4, DDB2, FZR1, APC8, and COP1 under high temperature, PEG-induced, and water shortage stresses may be attributed to the presence of STRE elements in their upstream regions. Additionally, E2, Cul4, DDB2, and PIAS1 possess the CAAT box in their promoter regions, which is indicative of their involvement in meristem-related processes and suggest their role in the growth and development of algae, apart from participating in abiotic and biotic stress responses.
The ubiquitin-activating enzyme E1 is the initial enzyme in the ubiquitin–protease degradation pathway, responsible for initiating the protein ubiquitination process. Its primary role involves utilizing ATP-derived energy to activate ubiquitin and transfer it to the ubiquitin-conjugating enzyme E2 [27]. The up-regulation of E1 under various stress conditions establishes a foundation for the functions of E2, E3, and subsequent enzymes in the ubiquitination process. Serving as the second step in ubiquitination, the ubiquitin-conjugating enzyme E2 receives ubiquitin from the upstream E1, forms the E2-Ub complex, and subsequently transfers it to the E3 ubiquitin ligase [28]. The up-regulated expression of E2 under diverse stress conditions establishes the foundation for the operation of E3 ubiquitin ligase in the process. The E3 ubiquitin ligase represents the third and final enzyme in the ubiquitination process. Notably, E3 not only associates with E2 but also specifically recognizes various target proteins in the cell requiring ubiquitination. Its primary function involves transferring ubiquitin from E2 to the substrate target protein during the ubiquitination process. As a result, E3 plays a critical role in determining substrate specificity throughout the entire ubiquitination process. It has been established that E3 constitutes a large protein family, with members such as UPL1, HRD1, PIAS1, and COP1 being up-regulated under various stress conditions. These enzymes belong to the HECT type E3 and single RING-finger type E3, which are crucial for accepting ubiquitin from E2. Additionally, the Cul3 and Cul4 protein families, serving as core components and scaffold proteins of the E3 ubiquitin ligase complex, play a vital role in protein ubiquitination and subsequent degradation. This study also identified essential component genes, Cul3, Cul4, and DDB2, as being activated under diverse stress conditions. The APC/C family, a member of the RING family’s E3 ubiquitin ligases, plays a key role in the degradation of cell cycle-related proteins by mediating ubiquitination, thereby regulating cell cycle transitions, post-translational protein modifications, and maintaining balance and stability [29]. In this study, the critical component genes FZR1 and APC8 are found to be up-regulated under stress conditions. Furthermore, UFD1, a crucial factor in the regulation of protein degradation by the 26S proteasome, displayed significant up-regulation under various stress conditions. Collectively, these findings highlight the collaborative involvement of multiple components within the ubiquitin–protease degradation system under stress conditions, leading to enhanced ubiquitination level. This observation is consistent with the observed increase in ubiquitin content during various stress conditions.
Although the ubiquitin–proteasome pathway in algae remains underexplored, studies in plants and some algae have revealed the up-regulation of certain components involved in the ubiquitination process during stress conditions. For instance, Kaur et al. observed up-regulation of the ubiquitin-activating enzyme E1 during waterlogging stress in maize [30]. Similarly, Lemna minor L. exposed to high temperatures showed increased Ub-protein conjugates and transcription levels of E1 [31], suggesting a positive role for E1 in stress responses. The E2 ubiquitin-conjugating enzyme (UBC18) was found to regulate drought and salt stress responses in Arabidopsis thaliana by controlling downstream genes of ERF1 [32], and overexpression of mung bean E2 enhanced osmotic stress tolerance in Arabidopsis thaliana [33]. In the intertidal green macroalga Ulva fasciata, the transcript level of E2 increased during high salinity stress [34]. Consistent with these findings, E2 in G. lemaneiformis also exhibited activity under temperature, osmotic pressure, and oxidative stresses, indicating its involvement in stress responses. Ubiquitin-protein ligase E3, as reviewed by Shu and Yang, played essential roles in plant development and abiotic stress responses [35]. Various ubiquitin-protein ligase, including HECT type E3s, single RING-finger type E3s, APC-subtype E3s, and Cullin-box E3s, are effectively activated during drought, osmotic, salinity, and temperature stresses. UPLs, such as UPL1, UPL3, and UPL5, have been shown to play significant roles in plant immunity, with mutations in these genes reducing immune responses activated by salicylic acid [36,37,38]. UPL1 was found to be active during various stress treatments in G. lemaneiformis. HRD1 is involved in plant cuticular lipid biosynthesis and provides protection against biotic and abiotic stresses [39]. The disruption of the HRD1/HRD3 complex in Arabidopsis thaliana increased plant sensitivity to salt and led to the accumulation of ERAD substrates, implying HRD1’s involvement in protein degradation and salt stress resistance [40,41]. COP1, which regulates light signaling and plant growth and development, was found to contribute to stability in Arabidopsis thaliana under low temperature environments and positively contribute to salt stress resistance [42,43,44]. In this study, COP1 also exhibited positive participation in various abiotic stresses. Other E3 ubiquitin ligases have distinct functions. For example, CRLC (Cullin-RING ligase)3-based E3 ligases are involved in ABA biosynthesis, signaling, and downstream responses [45]. CUL4 E3 complexes regulate various processes in plants, such as photomorphogenesis, flowering, and abiotic stress response [46]. Additionally, DDB2 participated in nucleotide excision repair, UV response, and maintenance of genomic integrity [47,48]. The active expression of these E3 ubiquitin ligases plays a crucial role in degrading damaged proteins and maintaining cellular stability. Furthermore, UFD1 in grapevine was shown to be involved in responses to salt stress, light treatment, and pathogen infection during grapevine growth [49]. CDC48 and its cofactor UFD1 were found to be essential for regulating proteins and responding to oxidative stress [50]. In this study, UFD1 was up-regulated under most stress conditions, facilitating the efficient delivery of ubiquitin proteins to the 26S proteasome.
In addition, PEG was used as a drought regulator, which could cause cell dehydration and alter the structures of the plasma membrane to induce drought stress [51]. At different PEG concentrations, the genes’ response was also different. Both 5% and 20% PEG treatments caused up-regulation of genes related to the ubiquitin–proteasome degradation pathway. In comparison, the treatment with 10% PEG did not induce a positive gene response in the later stages. In addition to functioning as an osmotic regulator that could simulate adverse conditions such as drought, PEG could interact with proteins and provide a protective effect on them. Karla et al., found that PEG could protect the enzymatic activity of horseradish peroxidase (HRP), versatile peroxidase (VP), and commercial Coprinus peroxidase (BP) [52]. Jun-Beom et al., found that the attachment of PEG to cocaine esterase (CocE) protected CocE against thermal degradation and protease digestion [53]. Li et al., found that the combination of nanosilicasol and polyethylene glycol (PEG) 1000 could enhance the thermostability of beta-cyclodextrin glycosyltransferase in Bacillus circulans [54]. Others also described the potential positive effects of PEG [55,56]. Therefore, we speculated that when PEG reaches a specific concentration, the stability of enzymatic proteins could be improved, and the normal activity of the enzymes is guaranteed. The possibility of protein misfolding is reduced, which may prevent the activation of the ubiquitin–protease degradation system and the expression of genes involved in the ubiquitin–protease degradation system. When the concentration of PEG becomes too low or exceeds a certain amount, it could induce stress in algae. Dong studied the effect of PEG on the growth of onions and it was found that the 10% and 20% PEG treatments had a more pronounced inhibitory effect compared to the 15% PEG treatment [57].
Based on the transcription levels of genes associated with the ubiquitin–protease degradation system, it was observed that these genes were uniformly up-regulated under various stresses, indicating coordinated response and potential synergy (Figure 9). Specifically, E1 and E2 showed up-regulation during all five stress conditions (high temperature, low temperature, O3, PEG, and water shortage). Several genes belonging to different E3 families, such as Cullin-box E3 (Cul3 and Cul4), HECT type E3 (UPL1), and single RING-finger E3 (HRD1 and COP1), were up-regulated under multiple stress conditions. Additionally, UFD1 exhibited up-regulation in response to most stress conditions. These findings suggest that the proteins encoded by these genes likely play crucial roles in responding to environmental stresses in G. lemaneiformis. The observed synergistic mechanisms among various components of the ubiquitin–proteasome pathway in G. lemaneiformis are akin to what has been observed in plants. Furthermore, it was found that the content of ubiquitin increased, and then the content of soluble protein increased under most stress conditions. However, under low temperature and O3 stress, the content of soluble protein showed a downward trend, possibly attributed to severe stress leading to increased protein denaturation.

4. Materials and Methods

4.1. Algal Strains and Culture Conditions

Wild tetrasporophytes of G. lemaneiformis were collected from the intertidal zone of Fu shan Bay (36.0° N, 120.3° E), Qingdao, China in October 2022. The algae were thoroughly brushed to remove any epiphytes. They were cultured in tanks with sterile seawater enriched with f/2 medium (the composition of f/2 medium is provided in Table S2) at 21 °C under a 12 L:12 D photoperiod 20 µmol photons m−2 s−1 light intensity.

4.2. Nucleotide Sequence Retrieval and Putative Promoter Analysis of UPS-Related Genes

Based on the transcriptome database of G. lemaneiformis at low temperature [17], 12 differentially expressed genes in the ubiquitin–proteasome pathway (pathway number: ko04120) (Figure S1) were identified: E1 (ubiquitin-activating enzyme E1), E2 (ubiquitin-conjugating enzyme E2), UPL1 (E3 ubiquitin-protein ligase UPL1), HRD1 (E3 ubiquitin-protein ligase HRD1), UFD1 (ubiquitin fusion degradation protein 1 UFD1), Cul3 (Cul3), Cul4 (Cul4), DDB2 (DNA damage-binding protein 2), PIAS1 (E3 SUMO-protein ligase PIAS1), FZR1 (cell division cycle 20-like protein 1, cofactor of APC complex), APC8 (anaphase-promoting complex subunit 8), and COP1 (E3 ubiquitin-protein ligase COP1). To explore the possible correlation between the up-regulation of these UPS-related genes during various stresses and the presence of corresponding stress-responsive elements in their putative promoter regions, we performed an analysis of the 1 kb nucleotide sequence upstream of each gene using the Plant Cis-Acting Regulatory Elements (Plant CARE) database [58]. The putative promoter sequences of genes are presented in the Supplementary Materials.

4.3. Abiotic Stress Treatments and Tissue Sampling

After a 7-day adaptive culture in the laboratory, the algae were subjected to five different abiotic stress treatments, including heat stress (33 °C), cold stress (5 °C), PEG-8000 stress (5%, 10%, and 20%), O3 stress (1–2 g/h), and water shortage stress (5, 10, 20, and 30 min). Except for the above stress factors, all other cultivation conditions remained consistent. The algae branches were collected as three biological replicates at the same time points of 0, 1, 2, 3, 6, and 9 days for the detection of soluble protein and ubiquitin at 0, 1, 6, 12, 24, 48, and 72 h for the analysis of the transcript levels. The untreated control group was also sampled at the same time as the treatment group. The extracts were prepared using 0.3 g samples in 2.7 mL of 0.9% sodium chloride solution. The homogenate was centrifuged at 2500× g for 10 min at 4 °C, and the supernatants were used to measure the contents of soluble protein and ubiquitin. Algae (0.1–0.15 g) were sampled and then placed into liquid nitrogen for freezing. They were stored at −80 °C for RNA extraction and analysis of the transcript levels of the 12 UPS-related genes.

4.4. The Content of Soluble Protein

The content of soluble protein was determined using a spectrophotometric assay, following the instructions provided in the TP detection Kit manual (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Soluble protein determination is based on the Bradford method/reagent [59], using the staining method with Coomassie Brilliant Blue G250. In short, the solution will turn blue when the brownish red Coomassie brilliant blue combines with the -NH3+ of the protein. Absorption spectrophotometric values at a wavelength of 595 nm were measured and used to calculate the total protein content using the following formula:
TP   ( mg / g   FW ) = A s a m p l e − A c o n t r o l A s t a n d a r d − A c o n t r o l × C s t a n d a r d × 2.7 / 0.3
where the Acontrol is the absorbance of the distilled water, the Asample is the absorbance of the extract, and Astandard is the absorbance of the standard protein. Cstandard is the concentration of the standard protein (fetal bovine serum) (0.524 g/L).

4.5. Ubiquitin (Ub) Determination

Ubiquitin (Ub) was evaluated using the double antibody sandwich method, following the instruction manual of the Plant Ub ELISA Kit (Shanghai Fusheng Industrial Co., Ltd., Shanghai, China). Briefly, the antibody–antigen enzyme-labeled antibody complex will form when plant-Ub is added to a microwell plate containing a double antibody sandwich. After washing and coloring, the solution will turn yellow. The depth of color and the concentration of Ub in the sample were positively correlated. The absorption spectrophotometric values at a wavelength of 450 nm were measured and used to calculate the concentration of Ub in the sample using the standard curve.

4.6. RNA Extraction and cDNA Synthesis

Total RNA from all samples, under native and different conditions, was extracted following the instruction manual of the HP Plant RNA Kit (Omega Bio-Tek, Norcross, GA, USA). The quality of the RNA samples was assessed using agarose gel electrophoresis and NanoDrop, measuring the OD260/280 and OD260/230 ratios. The cDNA was synthesized according to the instruction manual of the Prime Script™ RT Master Mix (Perfect Real Time) (Takara Bio, Kusatsu, Japan). The synthesized cDNA was stored at −40 °C.

4.7. The Transcript Analysis of Genes

The qRT-PCR (TB Green Premix Ex TaqTM II Kit, Takara Bio, Kusatsu, Japan) was used to analyze the transcript levels of genes. Reaction steps followed the program [60]: 95 °C for 20 s, followed by 40 cycles of 95 °C for 15 s, 55 °C for 15 s, 72 °C for 20 s, and reading the fluorescence signal, followed by 1 cycle of 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s. Each reaction was performed in three biological replicates and three technical replicates. The RT-PCR was performed using the LightCycler® 96 System from Roche (Mannheim, Germany). The transcription of each gene in the control group at the same time point was used as a calibrator to determine the expression level of genes in the treatment groups. The amount of cDNA for each PCR sample was approximately 300 ng/μL; the β-actin gene (ACT) from G. lemaneiformis was used as the reference gene. All primers were designed using the Primer 5.0 software (Primer, Toronto, ON, Canada) and are listed in Table 1. The relative transcript level was calculated using the 2−∆∆Ct method [61].

4.8. Statistical Analysis

In the data analysis of soluble protein and ubiquitin of G. lemaneiformis under different stresses, separate one-way analysis of variance (ANOVA) was used and followed by pairwise comparisons at different groups using the LSD method (p = 0.05). All of the data were expressed as the mean ± standard deviation (SD).

5. Conclusions

In this study, the ubiquitin–proteasome pathway was found to play a pivotal role in the response of G. lemaneiformis to various common stresses, including high temperature, low temperature, O3, PEG, and water shortage. The up-regulation of most Ub-related genes, such as E1, E2, Cul3 (Cullin-box E3), Cul4 (Cullin-box E3), UPL1 (HECT type E3), HRD1, COP1 (single RING-finger type E3), and UFD1, was observed, consistently coinciding with the increase in ubiquitin content. These findings provide valuable insights into the functional roles of genes involved in the ubiquitin–proteasome pathway, and the identified potential candidate genes may hold promise for enhancing the stress tolerance of algae to various adverse conditions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241512313/s1.

Author Contributions

F.Q.: Conceptualization, Formal analysis, Methodology, Project admin istration, Writing—original draft, Writing—review and editing. X.Z.: Conceptualization, Funding acquisition, Methodology, Validation, Writing—review and editing. G.S. and Z.L.: Data curation, Formal analysis, Visualization. M.T.: Investigation, Visualization and Software. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Key Program of Science and Technology Innovation Ningbo (2019B10009) and the China Agriculture Research System (CARS-50).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We want to thank Chen Weizhou of Shantou University for providing the algae resources and cultivation system for this work.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yang, F.F.; Wei, Z.L.; Long, L.J. Transcriptomic and physiological responses of the tropical reef calcified macroalga Amphiroa fragilissima to elevated temperature. J. Phycol. 2021, 57, 1254–1265. [Google Scholar] [CrossRef] [PubMed]
  2. Roman, M.; Roman, S.; Vazquez, E.; Troncoso, J.; Olabarria, C. Heatwaves during low tide are critical for the physiological performance of intertidal macroalgae under global warming scenarios. Sci. Rep. 2021, 10, 21408. [Google Scholar] [CrossRef] [PubMed]
  3. Beaulieu, L. Insights into the regulation of algal proteins and bioactive peptides using proteomic and transcriptomic approaches. Molecules 2019, 24, 1708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Rathor, P.; Borza, T.; Bahmani, R.; Stone, S.; Tonon, T.; Yurgel, S.; Potin, P.; Prithiviraj, B. Expression of a heat shock protein 70 from the brown alga Ectocarpus sp. Imparts Salinity Stress Tolerance in Arabidopsis thaliana. J. Appl. Phycol. 2023, 35, 803–819. [Google Scholar] [CrossRef]
  5. Maryam, R.; Vahid, N.; Hassan, E. Oxidative damage and antioxidative system in algae. Toxicol. Rep. 2019, 6, 1309–1313. [Google Scholar] [CrossRef]
  6. Akakçe, N.; Uğur Görgün, A.; Tuney Kizilkaya, İ.; Öztürk Atay, N. Effect of radionuclides and trace elements on antioxidant system of brown seaweeds. Bull. Environ. Contam. Toxicol. 2023, 110, 51. [Google Scholar] [CrossRef] [PubMed]
  7. Vinuganesh, A.; Kumar, A.; Prakash, S.; Korany, S.M.; Alsherif, E.A.; Selim, S.; AbdElgawad, H. Evaluation of growth, primary productivity, nutritional composition, redox state, and antimicrobial activity of red seaweeds Gracilaria debilis and Gracilaria foliifera under pCO2-induced seawater acidification. Mar. Pollut. Bull. 2022, 185, 114296. [Google Scholar] [CrossRef] [PubMed]
  8. Ling, Q.H.; Jarvis, P. Functions of plastid protein import and the ubiquitin-proteasome system in plastid development. BBA Bioenerg. 2015, 1847, 939–948. [Google Scholar] [CrossRef] [Green Version]
  9. Vallentine, P.; Hung, C.Y.; Xie, J.H.; Van Hoewyk, D. The ubiquitin-proteasome pathway protects Chlamydomonas reinhardtii against selenite toxicity, but is impaired as reactive oxygen species accumulate. AoB Plants 2015, 6, plu062. [Google Scholar] [CrossRef]
  10. Harmon, F.; Imaizumi, T.; Gray, W.M. CUL1 regulates TOC1 protein stability in the Arabidopsis circadian clock. Plant J. 2008, 55, 568–579. [Google Scholar] [CrossRef] [Green Version]
  11. Yau, R.; Rape, M. The increasing complexity of the ubiquitin code. Nat. Cell Biol. 2016, 18, 579–586. [Google Scholar] [CrossRef] [PubMed]
  12. Ligr, M.; Malek, L. Ubiquitin metabolism in chlamydomonas reinhardtii following cold shock. Physiol. Plant. 1997, 101, 865–871. [Google Scholar] [CrossRef]
  13. Tang, L.; Qiu, L.P.; Liu, C.; Du, G.Y.; Mo, Z.L.; Tang, X.H.; Mao, Y.X. Transcriptomic insights into innate immunity responding to red rot disease in red alga Pyropia yezoensis. Int. J. Mol. Sci. 2020, 20, 5970. [Google Scholar] [CrossRef] [Green Version]
  14. Zhang, P.Y.; Liu, F.L.; Chen, S.Q.; Liang, Z.R.; Wang, W.J.; Sun, X.T. Comparative ubiquitome analysis under heat stress reveals diverse functions of ubiquitination in Saccharina japonica. Int. J. Mol. Sci. 2020, 21, 8210. [Google Scholar] [CrossRef]
  15. Niaz, Z.; Sui, Z.H.; Riaz, S.; Khan, S.; Du, Q.W.; Zhou, W.; Wang, J.G. Cloning, sequencing and transcriptional analysis of ubiquitin gene from Alexandrium catenella under different nutrient conditions. Pak. J. Bot. 2021, 53, 461–471. [Google Scholar] [CrossRef]
  16. Li, G.Q.; Zang, X.N.; Zhang, X.C.; Lu, N.; Ding, Y.; Gong, L.; Chen, W.C. Cloning of ubiquitin-activating enzyme and ubiquitin-conjugating enzyme genes from Gracilaria lemaneiformis and their activity under heat shock. Gene 2014, 538, 155–163. [Google Scholar] [CrossRef] [PubMed]
  17. Qin, F.; Zang, X.N.; Shui, G.Q. Transcriptome analysis of Gracilariopsis lemaneiformis at low temperature. J. Appl. Phycol. 2021, 33, 4035–4050. [Google Scholar] [CrossRef]
  18. Ko, J.H.; Yang, S.H.; Han, K.H. Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis. Plant J. 2006, 47, 343–355. [Google Scholar] [CrossRef]
  19. Kachewar, N.R.; Gupta, V.; Ranjan, A.; Patel, H.K.; Sonti, R.V. Overexpression of OsPUB41, a rice E3 ubiquitin ligase induced by cell wall degrading enzymes, enhances immune responses in Rice and Arabidopsis. BMC Plant Biol. 2019, 19, 530. [Google Scholar] [CrossRef]
  20. Zong, N.; Zhao, H.L.; Liu, K.; Lu, R.X.; Fan, Y.Z.; Miao, M. Study on tomato USP1 in response to drought and high temperature stress. J. Anhui Agric. Univ. 2022, 49, 916–922. [Google Scholar]
  21. Min, Y.A.; Dong, H.S.; Kim, W.T. PUB22 and PUB23 U-box E3 ubiquitin ligases negatively regulate 26S proteasome activity under proteotoxic stress conditions. J. Integr. Plant Biol. 2022, 64, 625–631. [Google Scholar] [CrossRef]
  22. Ramos, A.A.; Polle, J.; Tran, D.; Cushman, J.C.; Jin, E.; Va, J.C. The unicellular green alga Dunaliella salina Teod. as a model for abiotic stress tolerance: Genetic advances and future perspectives. Algae 2011, 26, 3–20. [Google Scholar] [CrossRef]
  23. Kaur, M.; Saini, K.C.; Ojah, H.; Sahoo, R.; Gupta, K.; Kumar, A.; Bast, F. Abiotic stress in algae: Response, signaling and transgenic approaches. J. Appl. Phycol. 2022, 34, 1843–1869. [Google Scholar] [CrossRef]
  24. Xu, F.; Huang, X.H.; Li, L.L.; Deng, G.; Cheng, H.; Rong, X.F.; Li, J.B.; Cheng, S.Y. Molecular cloning and characterization of GbDXS and GbGGPPS gene promoters from Ginkgo biloba. Genet. Mol. Res. 2013, 12, 293–301. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, X.H.; Qi, Y.X. Analysis on TATA -box, GC-Imx and CAAT.box in eukaryotic promoters. J. Anhui Agric. Sci. 2008, 36, 1380–1381. [Google Scholar]
  26. Viquez, O.M.; Konan, K.N.; Dodo, H.W. Structure and organization of the genomic clone of a major peanut allergen gene, Ara h 1. Mol. Immunol. 2004, 40, 565–571. [Google Scholar] [CrossRef]
  27. Hatfield, P.M.; Gosink, M.M.; Carpenter, T.B.; Vierstra, R.D. The ubiquitin-activating enzyme (El) gene family in Arabidopsis thaliana. Plant J. 1997, 11, 213–226. [Google Scholar] [CrossRef]
  28. Lau, O.; Deng, X. Effect of Arabidopsis COP10 ubiquitin E2 enhancement activity across E2 families and functional conservation among its canonical homologues. Biochem. J. 2009, 418, 683–690. [Google Scholar] [CrossRef] [Green Version]
  29. Fu, H.; Zhong, H.; Chen, P. Ubiquitin ligase APC/C in ubiquitylation and cell cycle regulation. Chin. J. Biochem. Mol. Biol. 2017, 33, 667–673. [Google Scholar]
  30. Kaur, G.; Vikal, Y.; Kaur, L.; Kalia, A.; Mittal, A.; Kaur, D.; Yadav, I. Elucidating the morpho-physiological adaptations and molecular responses under long-term waterlogging stress in maize through gene expression analysis. Plant Sci. 2021, 304, 110823. [Google Scholar] [CrossRef]
  31. Caeiro, A.; Ramos, P.; Teixeira, A.; Ferreira, R. The ubiquitin/proteasome pathway from Lemna minor subjected to heat shock. Biol. Plantarum. 2008, 52, 695–702. [Google Scholar] [CrossRef] [Green Version]
  32. Cheng, M.C.; Kuo, W.C.; Wang, Y.M.; Chen, H.Y.; Lin, T.P. UBC18 mediates ERF1 degradation under light-dark cycles. New Phytol. 2017, 213, 1156–1167. [Google Scholar] [CrossRef] [PubMed]
  33. Chung, E.; Cho, C.W.; So, H.A.; Kang, J.S.; Chung, Y.S.; Lee, J.H. Overexpression of VrUBC1, a mung bean E2 ubiquitin-conjugating enzyme, enhances osmotic stress tolerance in Arabidopsis. PLoS ONE 2013, 8, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Sung, M.S.; Hsu, Y.T.; Ho, K.L.; Lee, T.M. Implications of the up-regulation of genes encoding protein degradation enzymes and heat shock protein 90 for intertidal green macroalga Ulva fasciata Against Hypersalinity-Induced Protein Oxidation. Mar. Biotechnol. 2011, 13, 684–694. [Google Scholar] [CrossRef] [PubMed]
  35. Shu, K.; Yang, W. E3 ubiquitin ligases: Ubiquitous actors in plant development and abiotic stress responses. Plant Cell Physiol. 2017, 58, 1461–1476. [Google Scholar] [CrossRef] [Green Version]
  36. Xu, J.N.; Xing, S.S.; Cui, H.R.; Chen, X.S.; Wang, X.Y. Genome-wide identification and characterization of the apple (Malus domestica) HECT ubiquitin-protein ligase family and expression analysis of their responsiveness to abiotic stresses. Mol. Genet. Genom. 2016, 291, 635–646. [Google Scholar] [CrossRef]
  37. Furniss, J.J.; Grey, H.; Wang, Z.S.; Nomoto, M.; Jackson, L.; Tada, Y.; Spoel, S.H. Proteasome-associated HECT-type ubiquitin ligase activity is required for plant immunity. PLoS Pathog. 2018, 14, e1007447. [Google Scholar] [CrossRef] [Green Version]
  38. Lan, W.; Miao, Y. New Aspects of HECT-E3 ligases in cell senescence and cell death of plants. Plants 2019, 8, 483. [Google Scholar] [CrossRef] [Green Version]
  39. Wu, P.; Gao, H.N.; Liu, J.; Kosma, D.K.; Lu, S.Y.; Zhao, H.Y. Insight into the roles of the ER-associated degradation E3 ubiquitin ligase HRD1 in plant cuticular lipid biosynthesis. Plant Physiol. Biochem. 2021, 167, 358–365. [Google Scholar] [CrossRef]
  40. Liu, L.J.; Cui, F.; Li, Q.L.; Yin, B.J.; Zhang, H.W.; Lin, B.Y.; Wu, Y.R.; Xia, R.; Tang, S.Y.; Xie, Q. The endoplasmic reticulum-associated degradation is necessary for plant salt tolerance. Cell Res. 2010, 21, 957–969. [Google Scholar] [CrossRef] [Green Version]
  41. Hoewyk, D.V. Defects in endoplasmic reticulum-associated degradation (ERAD) increase selenate sensitivity in Arabidopsis. Plant Signal. Behav. 2018, 13, e1171451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Kim, J.Y.; Song, J.T.; Seo, H.S. COP1 regulates plant growth and development in response to light at the post-translational level. J. Exp. Bot. 2017, 68, 4737–4748. [Google Scholar] [CrossRef] [Green Version]
  43. Jang, K.; Lee, H.G.; Jung, S.J.; Paek, N.C.; Seo, P.J. The E3 ubiquitin ligase COP1 regulates thermosensory flowering by triggering GI degradation in Arabidopsis. Sci. Rep. 2015, 5, 12071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Lee, J.; Choi, B.; Yun, A.; Son, N.; Ahn, G.; Cha, J.Y.; Kim, W.Y.; Hwang, I. Long-term abscisic acid promotes golden2-like1 degradation through constitutive photomorphogenic 1 in a light intensity-dependent manner to suppress chloroplast development. Plant Cell Environ. 2021, 44, 3034–3048. [Google Scholar] [CrossRef] [PubMed]
  45. Kelley, D.R. E3 ubiquitin ligases: Key regulators of hormone signaling in plants. Mol. Cell. Proteom. 2018, 17, 1047–1054. [Google Scholar] [CrossRef] [Green Version]
  46. Biedermann, S.; Hellmann, H. WD40 and CUL4-based E3 ligases: Lubricating all aspects of life. Trends Plant Sci. 2010, 16, 38–46. [Google Scholar] [CrossRef]
  47. Biedermann, S.; Hellmann, H. The DDB1a interacting proteins ATCSA-1 and DDB2 are critical factors for UV-B tolerance and genomic integrity in Arabidopsis thaliana. Plant J. 2010, 62, 404–415. [Google Scholar] [CrossRef]
  48. Bernhardt, A.; Lechner, E.; Hano, P.; Schade, V.; Dieterle, M.; Anders, M.; Dubin, M.J.; Benvenuto, G.; Bowler, C.; Genschik, P.; et al. CUL4 associates with DDB1 and DET1 and its downregulation affects diverse aspects of development in Arabidopsis thaliana. Plant J. 2006, 47, 591–603. [Google Scholar] [CrossRef]
  49. Wei, L.Z.; Cheng, J.H.; Xiang, J.; Wu, J. Genome-wide identification and characterization of grapevine UFD1 genes during berry development and salt stress response. J. Plant Biochem. Biotechnol. 2022, 31, 592–601. [Google Scholar] [CrossRef]
  50. Li, J.L.; Yuan, J.R.; Li, Y.H.; Sun, H.L.; Ma, T.T.; Huai, J.L.; Yang, W.Q.; Zhang, W.H.; Lin, R.C. The CDC48 complex mediates ubiquitin-dependent degradation of intra-chloroplast proteins in plants. Cell Rep. 2022, 39, 110664. [Google Scholar] [CrossRef]
  51. Ma, L.J.; Wang, L.L.; Mei, Y.X.; Zhang, S.W.; Wei, W.; Wang, J.Y.; Zhang, Y.L. Cross adaptation tolerance in rice seedlings exposed to PEG induced salinity and drought Stress. Int. J. Agric. Biol. 2016, 18, 535–541. [Google Scholar] [CrossRef]
  52. Juarez-Moreno, K.; Ayala, M.; Vazquez-Duhalt, R. Antioxidant Capacity of Poly (Ethylene Glycol) (PEG) as Protection Mechanism Against Hydrogen Peroxide Inactivation of Peroxidases. Appl. Biochem. Biotechnol. 2015, 17, 1364–1373. [Google Scholar] [CrossRef] [PubMed]
  53. Park, J.B.; Kwon, Y.M.; Lee, T.Y.; Brim, R.; Ko, M.C.; Sunahara, R.K.; Woods, J.H.; Yang, V.C. PEGylation of bacterial cocaine esterase for protection against protease digestion and immunogenicity. J. Control. Release 2010, 142, 174–179. [Google Scholar] [CrossRef] [Green Version]
  54. Li, C.M.; Huang, M.; Gu, Z.B.; Hong, Y.; Cheng, L.; Li, Z.F. Nanosilica sol leads to further increase in polyethylene glycol (PEG) 1000-enhanced thermostability of β-cyclodextrin glycosyltransferase from Bacillus circulans. J. Agric. Food Chem. 2014, 62, 2919–2924. [Google Scholar] [CrossRef] [PubMed]
  55. Liu, Y.Q.; Bino, R.J.; vanderBurg, W.J.; Groot, S.P.C.; Hilhorst, H.W.M. Effects of osmotic priming on dormancy and storability of tomato (Lycopersicon esculentum Mill.) seeds. Seed Sci. Res. 1996, 6, 49–55. [Google Scholar] [CrossRef]
  56. Yao, X.H.; Wu, K.L. Effect of PEG pretreatment on germination, growth and its drought-resistance of hulless barley. J. China Agric. Univ. 2013, 18, 80–87. [Google Scholar]
  57. Dong, D.Z.; Liu, H.C.; Song, S.W.; Sun, G.W.; Chen, R.Y. Effect of Water Stress Induced by PEG on Growth and Quality of Bunching Onion. Intell. Mater. Appl. Mech. Des. Sci. 2012, 142, 116–119. [Google Scholar] [CrossRef]
  58. Rombauts, S.; Dehais, P.; Van Montagu, M.; Rouze, P. PlantCARE, a plant cis-acting regulatory element database. Nucleic Acids Res. 1999, 27, 295–296. [Google Scholar] [CrossRef] [Green Version]
  59. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  60. He, B.X.; Hou, L.L.; Dong, M.M.; Shi, J.W.; Huang, X.Y.; Ding, Y.T.; Cong, X.M.; Zhang, F.; Zhang, X.C.; Zang, X.N. Transcriptome Analysis in Haematococcus pluvialis: Astaxanthin induction by high light with acetate and Fe2+. Int. J. Mol. Sci. 2018, 19, 175. [Google Scholar] [CrossRef] [Green Version]
  61. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Ijms 24 12313 g001
Figure 1. The analysis of cis-acting elements in putative promoter sequences of the UPS genes. The nucleotide sequence ≤1 kb upstream of the ATG of each gene carries multiple stress and signal-responsive elements. A scale at the bottom indicates the approximate location of corresponding elements. Each element is shown with a different shape and color, which is described at the bottom of the figure. Each gene name is displayed on the left.
Figure 1. The analysis of cis-acting elements in putative promoter sequences of the UPS genes. The nucleotide sequence ≤1 kb upstream of the ATG of each gene carries multiple stress and signal-responsive elements. A scale at the bottom indicates the approximate location of corresponding elements. Each element is shown with a different shape and color, which is described at the bottom of the figure. Each gene name is displayed on the left.
Ijms 24 12313 g001
Ijms 24 12313 g002
Figure 2. The content of soluble protein and Ub in high temperature (33 °C) treatment group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Figure 2. The content of soluble protein and Ub in high temperature (33 °C) treatment group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Ijms 24 12313 g002
Ijms 24 12313 g003
Figure 3. The content of soluble protein and Ub in low temperature (5 °C) treatment group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Figure 3. The content of soluble protein and Ub in low temperature (5 °C) treatment group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Ijms 24 12313 g003
Ijms 24 12313 g004
Figure 4. The content of soluble protein and Ub in O3 treatment group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Figure 4. The content of soluble protein and Ub in O3 treatment group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Ijms 24 12313 g004
Ijms 24 12313 g005
Figure 5. The content of soluble protein and Ub in different concentrations of PEG groups and control group. (a) The content of soluble protein in 5% PEG group and control group. (b) The content of Ub in 5% PEG group and control group. (c) The content of soluble protein in 10% PEG group and control group. (d) The content of Ub in 10% PEG group and control group. (e) The content of soluble protein in 20% PEG group and control group. (f) The content of Ub in 20% PEG group and control group. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Figure 5. The content of soluble protein and Ub in different concentrations of PEG groups and control group. (a) The content of soluble protein in 5% PEG group and control group. (b) The content of Ub in 5% PEG group and control group. (c) The content of soluble protein in 10% PEG group and control group. (d) The content of Ub in 10% PEG group and control group. (e) The content of soluble protein in 20% PEG group and control group. (f) The content of Ub in 20% PEG group and control group. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Ijms 24 12313 g005
Ijms 24 12313 g006
Figure 6. The content of soluble protein and Ub in water shortage group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Figure 6. The content of soluble protein and Ub in water shortage group and control group. (a) The content of soluble protein. (b) The content of Ub. The data are expressed as the mean ± standard deviation (SD), *** indicates a significant difference from the control group (p < 0.05).
Ijms 24 12313 g006
Ijms 24 12313 g007
Figure 7. Cluster analysis of UPS genes at different conditions and different times. The vertical axis stands for relative transcription of different genes at different conditions, and the color represents the transcription level of the gene. The horizontal axis stands for different time points. (a) The cluster analysis of UPS genes under high temperature, low temperature, O3, 5%, 10%, and 20% PEG treatments. (b) The cluster analysis of UPS genes under water shortage treatment.
Figure 7. Cluster analysis of UPS genes at different conditions and different times. The vertical axis stands for relative transcription of different genes at different conditions, and the color represents the transcription level of the gene. The horizontal axis stands for different time points. (a) The cluster analysis of UPS genes under high temperature, low temperature, O3, 5%, 10%, and 20% PEG treatments. (b) The cluster analysis of UPS genes under water shortage treatment.
Ijms 24 12313 g007
Ijms 24 12313 g008
Figure 8. Venn diagram of the up-regulated genes under different conditions. (a–f) represents the overlaps of up-regulated genes at each time point under high temperature, low temperature, O3, 5% PEG, 10% PEG, and 20% PEG treatments. (g) represents the overlaps of up-regulated genes at each time point during water shortage.
Figure 8. Venn diagram of the up-regulated genes under different conditions. (a–f) represents the overlaps of up-regulated genes at each time point under high temperature, low temperature, O3, 5% PEG, 10% PEG, and 20% PEG treatments. (g) represents the overlaps of up-regulated genes at each time point during water shortage.
Ijms 24 12313 g008
Ijms 24 12313 g009
Figure 9. The ubiquitin–proteasome pathway in G. lemaneiformis. The red arrow indicates that both E1 and E2, as well as different elements of E3 and UFD1, exhibit positive effects and have synergistic effects under stress conditions. Different signals indicate various stress conditions. Signs and elements of E3 in the same box indicate that these elements may play important roles under these stresses.
Figure 9. The ubiquitin–proteasome pathway in G. lemaneiformis. The red arrow indicates that both E1 and E2, as well as different elements of E3 and UFD1, exhibit positive effects and have synergistic effects under stress conditions. Different signals indicate various stress conditions. Signs and elements of E3 in the same box indicate that these elements may play important roles under these stresses.
Ijms 24 12313 g009
Table 1. List of qPCR genes and primers.
Table 1. List of qPCR genes and primers.
Gene NamePrimer
ACT (actin)F: CTACTCGTTTACCACTTCTGCTGA
R: TTCCATTCCGACCAACTCTG
E1 (ubiquitin-activating enzyme E1)F: CACAGTCGTTTGCCATCAGC
R: TCTTCCCCACATCCCACCTA
E2 (ubiquitin-conjugating enzyme E2)F: TTATCCGTTCAAGCCACCG
R: GAGCGATTTCAGGCACAAG
UPL1 (E3 ubiquitin-protein ligase UPL1)F: GCGAAGGGGTTTGGAAATAAT
R: TGTCTGTAGACTTGACAGGAGGGAT
HRD1 (E3 ubiquitin-protein ligase HRD1)F: TTCCTCAGGTATCGCCGTGTT
R: GTTGCGGTTGTGCTTGGTTCT
UFD1 (ubiquitin fusion degradation protein 1)F: CACCTTCAGCACTCGACTCCTT
R: CGGCGATAAACTCCTGTACTCC
Cul3 (Cul3)F: GGATGCTGCGAAATGATAAGGT
R: ATTCTTGGGAGATGGGGATGGT
Cul4 (Cul4)F: GGGATATGGGCTTGCTTCTGTT
R: TGCGGTAGTAGGTGTCGGTTGA
DDB2 (DNA damage-binding protein 2)F: CACAATTCCCCTCCTCAACTC
R: TGAACAGACTGACGCTTCCCT
PIAS1 (E3 SUMO-protein ligase PIAS1)F: CCAGTCAAAGGCAAAAGGTGTC
R: CCTCCATATCATCGTCTTCGTCA
FZR1 (cell division cycle 20-like protein 1, cofactor of APC complex)F: CACATTCTGTCCAACGCCACT
R: GTTCCAAGCAACAGAGCATACA
APC8 (anaphase-promoting complex subunit 8)F: AACGACGAAAAGAAGAAGAGCG
R: CCAGTGGTTGTCAATGTCCAAA
COP1 (E3 ubiquitin-protein ligase COP1)F: TCACGGCATTCATTACTACG
R: GCACCAACAAACGCTACTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Qin, F.; Shui, G.; Li, Z.; Tu, M.; Zang, X. Expression Profiling Reveals the Possible Involvement of the Ubiquitin–Proteasome Pathway in Abiotic Stress Regulation in Gracilariopsis lemaneiformis. Int. J. Mol. Sci. 2023, 24, 12313. https://doi.org/10.3390/ijms241512313

AMA Style

Qin F, Shui G, Li Z, Tu M, Zang X. Expression Profiling Reveals the Possible Involvement of the Ubiquitin–Proteasome Pathway in Abiotic Stress Regulation in Gracilariopsis lemaneiformis. International Journal of Molecular Sciences. 2023; 24(15):12313. https://doi.org/10.3390/ijms241512313

Chicago/Turabian Style

Qin, Feng, Guangqiang Shui, Zheng Li, Mengge Tu, and Xiaonan Zang. 2023. "Expression Profiling Reveals the Possible Involvement of the Ubiquitin–Proteasome Pathway in Abiotic Stress Regulation in Gracilariopsis lemaneiformis" International Journal of Molecular Sciences 24, no. 15: 12313. https://doi.org/10.3390/ijms241512313

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop