Purine Nucleotide Alterations in Tumoral Cell Lines Maintained with Physiological Levels of Folic Acid
Abstract
:1. Introduction
2. Results
2.1. Physiological Levels of FA Induce ZMP Accumulation in Jurkat Cells
2.2. Physiological Levels of FA do Not Induce AMPK Activation in Jurkat Cells
2.3. Physiological Levels of FA Decrease Tetrazolium Dye Reduction by Jurkat Cells without Changes in Mitochondrial Membrane Potential
2.4. ZMP Levels in Different Human Cell Lines Maintained with Physiological Folate
2.5. Differential Effect of AICAr in Purine Nucleotide Levels of Tumoral Cell Lines
2.6. Expression of the Reduced Folate Carrier (RFC) SLC19A1 in Human Cell Lines
3. Discussion
3.1. Jurkat Cells Maintained with Physiological Folate Accumulate ZMP, but AMPK Is Not Activated
3.2. Differential ZMP Accumulation in Human Cell Lines
3.3. Folate Transport and ZMP Accumulation
3.4. Could ZMP, or Any of Its Derivatives, Be Used as a Tumoral Marker?
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Growth
4.3. Purine Measurement
4.4. Protein Quantification
4.5. MTT Assay
4.6. Mitoprobe DilC1(5) Assay
4.7. Western Blot
4.8. qRT-PCR
SLC19A1 | Forward: CCTCGTGTGCTACCTTTGCTT |
Reverse: TGATCTCGTTCGTGACCTGC | |
RPS11 | Forward: CCGAGACTATCTGCACTACATCC |
Reverse: GTGCCGGCAGCCTTG | |
TPT1 | Forward: CACCTGCAGGAAACAAGTTTC |
Reverse: GTCACACCATCCTCACGGTAG | |
ADK-S | Forward: TAGAGCATCGGACGCGGGCG |
Reverse: GACTGACGTCATGGCTTCG |
4.9. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Garcia-Gil, M.; Camici, M.; Allegrini, S.; Pesi, R.; Petrotto, E.; Tozzi, M.G. Emerging Role of Purine Metabolizing Enzymes in Brain Function and Tumors. Int. J. Mol. Sci. 2018, 19, 3598. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedley, A.M.; Pareek, V.; Benkovic, S.J. The Purinosome: A Case Study for a Mammalian Metabolon. Annu. Rev. Biochem. 2022, 91, 89–106. [Google Scholar] [CrossRef] [PubMed]
- Yamaoka, T.; Yano, M.; Kondo, M.; Sasaki, H.; Hino, S.; Katashima, R.; Moritani, M.; Itakura, M. Feedback inhibition of amidophosphoribosyltransferase regulates the rate of cell growth via purine nucleotide, DNA, and protein syntheses. J. Biol. Chem. 2001, 276, 21285–21291. [Google Scholar] [CrossRef] [Green Version]
- Stout, J.T.; Caskey, C.T. Hypoxanthine guanine phosphoribosyltransferase deficency: The Lesch-Nyhan syndrome and gouty arthritis. In Metabolic Basis of Inherited Disease, 6th ed.; Scriver, C.R., Ed.; McGraw-Hill: New York, NY, USA, 1989; pp. 1007–1028. [Google Scholar]
- Jinnah, H.A.; Visser, J.E.; Harris, J.C.; Verdu, A.; Larovere, L.; Ceballos-Picot, I.; Gonzalez-Alegre, P.; Neychev, V.; Torres, R.J.; Dulac, O.; et al. Delineation of the motor disorder of Lesch-Nyhan disease. Brain 2006, 129, 1201–1217. [Google Scholar] [CrossRef] [Green Version]
- Rosenbloom, F.M.; Henderson, J.F.; Caldwell, I.C.; Kelley, W.N.; Seegmiller, J.E. Biochemical bases of accelerated purine biosynthesis de novo in human fibroblasts lacking hypoxanthine-guanine phosphoribosyltransferase. J. Biol. Chem. 1968, 243, 1166–1173. [Google Scholar] [CrossRef]
- Fu, R.; Sutcliffe, D.; Zhao, H.; Huang, X.; Schretlen, D.J.; Benkovic, S.; Jinnah, H.A. Clinical severity in Lesch-Nyhan disease: The role of residual enzyme and compensatory pathways. Mol. Genet. Metab. 2015, 114, 55–61. [Google Scholar] [CrossRef] [Green Version]
- López, J.M.; Outtrim, E.L.; Fu, R.; Sutcliffe, D.J.; Torres, R.J.; Jinnah, H.A. Physiological levels of folic acid reveal purine alterations in Lesch-Nyhan disease. Proc. Natl. Acad. Sci. USA 2020, 117, 12071–12079. [Google Scholar] [CrossRef]
- Racanelli, A.C.; Rothbart, S.B.; Heyer, C.L.; Moran, R.G. Therapeutics by cytotoxic metabolite accumulation: Pemetrexed causes ZMP accumulation, AMPK activation, and mammalian target of rapamycin inhibition. Cancer Res. 2009, 69, 5467–5474. [Google Scholar] [CrossRef] [Green Version]
- Ducker, G.S.; Rabinowitz, J.D. One-Carbon Metabolism in Health and Disease. Cell Metab. 2017, 25, 27–42. [Google Scholar] [CrossRef] [Green Version]
- Ducker, G.S.; Chen, L.; Morscher, R.J.; Ghergurovich, J.M.; Esposito, M.; Teng, X.; Kang, Y.; Rabinowitz, J.D. Reversal of Cytosolic One-Carbon Flux Compensates for Loss of the Mitochondrial Folate Pathway. Cell Metab. 2016, 23, 1140–1153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, W.D.; Pirona, A.C.; Sarvin, B.; Stern, A.; Nevo-Dinur, K.; Besser, E.; Sarvin, N.; Lagziel, S.; Mukha, D.; Raz, S.; et al. Tumor Reliance on Cytosolic versus Mitochondrial One-Carbon Flux Depends on Folate Availability. Cell Metab. 2021, 33, 190–198.e6. [Google Scholar] [CrossRef] [PubMed]
- Jackson, R.C.; Weber, G.; Morris, H.P. IMP dehydrogenase, an enzyme linked with proliferation and malignancy. Nature 1975, 256, 331–333. [Google Scholar] [CrossRef] [PubMed]
- Natsumeda, Y.; Prajda, N.; Donohue, J.P.; Glover, J.L.; Weber, G. Enzymic capacities of purine de Novo and salvage pathways for nucleotide synthesis in normal and neoplastic tissues. Cancer Res. 1984, 44, 2475–2479. [Google Scholar]
- Mannava, S.; Grachtchouk, V.; Wheeler, L.J.; Im, M.; Zhuang, D.; Slavina, E.G.; Mathews, C.K.; Shewach, D.S.; Nikiforov, M.A. Direct role of nucleotide metabolism in C-MYC-dependent proliferation of melanoma cells. Cell Cycle. 2008, 7, 2392–2400. [Google Scholar] [CrossRef] [PubMed]
- Villa, E.; Ali, E.S.; Sahu, U.; Ben-Sahra, I. Cancer Cells Tune the Signaling Pathways to Empower de Novo Synthesis of Nucleotides. Cancers 2019, 11, 688. [Google Scholar] [CrossRef] [Green Version]
- Robinson, A.D.; Eich, M.L.; Varambally, S. Dysregulation of de novo nucleotide biosynthetic pathway enzymes in cancer and targeting opportunities. Cancer Lett. 2020, 470, 134–140. [Google Scholar] [CrossRef]
- Schneider, U.; Schwenk, H.U.; Bornkamm, G. Characterization of EBV-genome negative "null" and "T" cell lines derived from children with acute lymphoblastic leukemia and leukemic transformed non-Hodgkin lymphoma. Int. J. Cancer. 1977, 19, 621–626. [Google Scholar] [CrossRef]
- Jurkat, Clone E6-1 (ATCC TIB-152). Available online: https://www.atcc.org/products/tib-152 (accessed on 7 August 2023).
- Hardie, D.G.; Hawley, S.A. AMP-activated protein kinase: The energy charge hypothesis revisited. Bioessays 2001, 23, 1112–1119. [Google Scholar] [CrossRef]
- Lukens, L.; Flaks, J.; Colowick, S.P. Intermediates in purine nucleotide synthesis. In Methods in Enzymology; Colowick, S.P., Kaplan, N.O., Eds.; Academic Press: San Diego, CA, USA, 1963; Volume 6, pp. 671–702. [Google Scholar]
- Cantor, J.R.; Abu-Remaileh, M.; Kanarek, N.; Freinkman, E.; Gao, X.; Louissaint, A., Jr.; Lewis, C.A.; Sabatini, D.M. Physiologic Medium Rewires Cellular Metabolism and Reveals Uric Acid as an Endogenous Inhibitor of UMP Synthase. Cell 2017, 169, 258–272.e17. [Google Scholar] [CrossRef] [Green Version]
- Atkinson, D.E.; Walton, G.M. Adenosine triphosphate conservation in metabolic regulation. Rat liver citrate cleavage enzyme. J. Biol. Chem. 1967, 242, 3239–3241. [Google Scholar] [CrossRef]
- Sabina, R.L.; Patterson, D.; Holmes, E.W. 5-Amino-4-imidazolecarboxamide riboside (Z-riboside) metabolism in eukaryotic cells. J. Biol. Chem. 1985, 260, 6107–6114. [Google Scholar] [CrossRef]
- Liu, X.; Chhipa, R.R.; Pooya, S.; Wortman, M.; Yachyshin, S.; Chow, L.M.; Kumar, A.; Zhou, X.; Sun, Y.; Quinn, B.; et al. Discrete mechanisms of mTOR and cell cycle regulation by AMPK agonists independent of AMPK. Proc. Natl. Acad. Sci. USA 2014, 111, E435–E444. [Google Scholar] [CrossRef]
- Vincent, E.E.; Coelho, P.P.; Blagih, J.; Griss, T.; Viollet, B.; Jones, R.G. Differential effects of AMPK agonists on cell growth and metabolism. Oncogene 2015, 34, 3627–3639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, L.; Yang, F.; Fang, H.; Sun, H.; Chen, Y.; Xu, Y.; Li, H.; Zheng, L.; Zhou, B.S. AICAr suppresses cell proliferation by inducing NTP and dNTP pool imbalances in acute lymphoblastic leukemia cells. FASEB J. 2019, 33, 4525–4537. [Google Scholar] [CrossRef] [PubMed]
- O’Connor, C.; Wallace-Povirk, A.; Ning, C.; Frühauf, J.; Tong, N.; Gangjee, A.; Matherly, L.H.; Hou, Z. Folate transporter dynamics and therapy with classic and tumor-targeted antifolates. Sci. Rep. 2021, 11, 6389. [Google Scholar] [CrossRef] [PubMed]
- Corton, J.M.; Gillespie, J.G.; Hawley, S.A.; Hardie, D.G. 5-aminoimidazole-4-carboxamide ribonucleoside. A specific method for activating AMP-activated protein kinase in intact cells? Eur. J. Biochem. 1995, 229, 558–565. [Google Scholar] [CrossRef] [PubMed]
- López, J.M.; Santidrián, A.F.; Campàs, C.; Gil, J. 5-Aminoimidazole-4-carboxamide riboside induces apoptosis in Jurkat cells, but the AMP-activated protein kinase is not involved. Biochem. J. 2003, 370, 1027–1032. [Google Scholar] [CrossRef] [Green Version]
- Guigas, B.; Taleux, N.; Foretz, M.; Detaille, D.; Andreelli, F.; Viollet, B.; Hue, L. AMP-activated protein kinase-independent inhibition of hepatic mitochondrial oxidative phosphorylation by AICA riboside. Biochem. J. 2007, 404, 499–507. [Google Scholar] [CrossRef]
- Berridge, M.V.; Herst, P.M.; Tan, A.S. Tetrazolium dyes as tools in cell biology: New insights into their cellular reduction. Biotechnol. Annu. Rev. 2005, 11, 127–152. [Google Scholar] [CrossRef]
- Cakmakli, H.F.; Torres, R.J.; Menendez, A.; Yalcin-Cakmakli, G.; Porter, C.C.; Puig, J.G.; Jinnah, H.A. Macrocytic anemia in Lesch-Nyhan disease and its variants. Genet. Med. 2019, 21, 353–360. [Google Scholar] [CrossRef]
- Allison, A.C.; Hovi, T.; Watts, R.W.; Webster, A.D. Immunological observations on patients with Lesch-Nyhan syndrome, and on the role of de-novo purine synthesis in lymphocyte transformation. Lancet 1975, 2, 1179–1183. [Google Scholar] [CrossRef] [PubMed]
- Hakoda, M.; Hirai, Y.; Akiyama, M.; Yamanaka, H.; Terai, C.; Kamatani, N.; Kashiwazaki, S. Selection against blood cells deficient in hypoxanthine phosphoribosyltransferase (HPRT) in Lesch-Nyhan heterozygotes occurs at the level of multipotent stem cells. Hum. Genet. 1995, 96, 674–680. [Google Scholar] [CrossRef] [PubMed]
- Saltman, D.; Bansal, N.S.; Ross, F.M.; Ross, J.A.; Turner, G.; Guy, K. Establishment of a karyotypically normal B-chronic lymphocytic leukemia cell line; evidence of leukemic origin by immunoglobulin gene rearrangement. Leuk. Res. 1990, 14, 381–387. [Google Scholar] [CrossRef] [PubMed]
- Klijn, C.; Durinck, S.; Stawiski, E.W.; Haverty, P.M.; Jiang, Z.; Liu, H.; Degenhardt, J.; Mayba, O.; Gnad, F.; Liu, J.; et al. A comprehensive transcriptional portrait of human cancer cell lines. Nat. Biotechnol. 2015, 33, 306–312. [Google Scholar] [CrossRef]
- Goswami, M.T.; Chen, G.; Chakravarthi, B.V.; Pathi, S.S.; Anand, S.K.; Carskadon, S.L.; Giordano, T.J.; Chinnaiyan, A.M.; Thomas, D.G.; Palanisamy, N.; et al. Role and regulation of coordinately expressed de novo purine biosynthetic enzymes PPAT and PAICS in lung cancer. Oncotarget 2015, 6, 23445–23461. [Google Scholar] [CrossRef] [Green Version]
- Chakravarthi, B.V.S.K.; Rodriguez Pena, M.D.C.; Agarwal, S.; Chandrashekar, D.S.; Hodigere Balasubramanya, S.A.; Jabboure, F.J.; Matoso, A.; Bivalacqua, T.J.; Rezaei, K.; Chaux, A.; et al. A Role for De Novo Purine Metabolic Enzyme PAICS in Bladder Cancer Progression. Neoplasia 2018, 20, 894–904. [Google Scholar] [CrossRef]
- Zhao, H.; Chiaro, C.R.; Zhang, L.; Smith, P.B.; Chan, C.Y.; Pedley, A.M.; Pugh, R.J.; French, J.B.; Patterson, A.D.; Benkovic, S.J. Quantitative analysis of purine nucleotides indicates that purinosomes increase de novo purine biosynthesis. J. Biol. Chem. 2015, 290, 6705–6713. [Google Scholar] [CrossRef] [Green Version]
- Ali, E.S.; Sahu, U.; Villa, E.; O’Hara, B.P.; Gao, P.; Beaudet, C.; Wood, A.W.; Asara, J.M.; Ben-Sahra, I. ERK2 Phosphorylates PFAS to Mediate Posttranslational Control of De Novo Purine Synthesis. Mol. Cell. 2020, 78, 1178–1191. [Google Scholar] [CrossRef]
- Keller, K.E.; Tan, I.S.; Lee, Y.S. SAICAR stimulates pyruvate kinase isoform M2 and promotes cancer cell survival in glucose-limited conditions. Science 2012, 338, 1069–1072. [Google Scholar] [CrossRef] [Green Version]
- Laikind, P.K.; Seegmiller, J.E.; Gruber, H.E. Detection of 5′-phosphoribosyl-4-(N-succinylcarboxamide)-5-aminoimidazole in urine by use of the Bratton-Marshall reaction: Identification of patients deficient in adenylosuccinate lyase activity. Anal. Biochem. 1986, 56, 81–90. [Google Scholar] [CrossRef]
- Baggott, J.E.; Morgan, S.L.; Sams, W.M.; Linden, J. Urinary adenosine and aminoimidazolecarboxamide excretion in methotrexate-treated patients with psoriasis. Arch. Dermatol. 1999, 135, 813–817. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marie, S.; Heron, B.; Bitoun, P.; Timmerman, T.; Van Den Berghe, G.; Vincent, M.F. AICA-ribosiduria: A novel, neurologically devastating inborn error of purine biosynthesis caused by mutation of ATIC. Am. J. Hum. Genet. 2004, 74, 1276–1281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bratton, A.C.; Marshall, E.K. A new coupling component for sulfanilamide determination. J. Biol. Chem. 1939, 128, 537–550. [Google Scholar] [CrossRef]
- Stetten, M.R.; Fox, C.L., Jr. An amine ed formed by bacteria during sulfonamide bacteriostasis. Biol. Chem. 1945, 161, 333–349. [Google Scholar] [CrossRef] [PubMed]
Condition | 25 nM FA | 25 nM FA + 350 µM UA | 2200 nM FA | |
---|---|---|---|---|
Nucleotide | Mean ± SEM | Mean ± SEM | Mean ± SEM | |
ATP | 15.8 ± 4.6 | 10.6 ± 1.3 | 23.0 ± 5.9 | |
ADP | 5.0 ± 2.2 | 1.8 ± 0.2 | 5.2 ± 0.7 | |
AMP | 0.6 ± 0.2 | 0.3 ± 0.1 | 1.1 ± 0.3 | |
GTP | 6.3 ± 1.6 | 5.3 ± 0.9 | 7.7 ± 1.9 | |
GDP | 1.2 ± 0.4 | 0.6 ± 0.1 | 1.2 ± 0.3 | |
GMP | 0.5 ± 0.2 | 0.3 ± 0.1 | 0.5 ± 0.2 | |
ZMP | 1.2 ± 0.4 ** | 0.8 ± 0.2 | 0.1 ± 01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cano-Estrada, C.; de Benito-Gómez, L.; Escudero-Ferruz, P.; Ontiveros, N.; Iglesias-Serret, D.; López, J.M. Purine Nucleotide Alterations in Tumoral Cell Lines Maintained with Physiological Levels of Folic Acid. Int. J. Mol. Sci. 2023, 24, 12573. https://doi.org/10.3390/ijms241612573
Cano-Estrada C, de Benito-Gómez L, Escudero-Ferruz P, Ontiveros N, Iglesias-Serret D, López JM. Purine Nucleotide Alterations in Tumoral Cell Lines Maintained with Physiological Levels of Folic Acid. International Journal of Molecular Sciences. 2023; 24(16):12573. https://doi.org/10.3390/ijms241612573
Chicago/Turabian StyleCano-Estrada, Claudia, Lidia de Benito-Gómez, Paula Escudero-Ferruz, Neus Ontiveros, Daniel Iglesias-Serret, and José M. López. 2023. "Purine Nucleotide Alterations in Tumoral Cell Lines Maintained with Physiological Levels of Folic Acid" International Journal of Molecular Sciences 24, no. 16: 12573. https://doi.org/10.3390/ijms241612573