In Silico Identification of Potential Quadruplex Forming Sequences in LncRNAs of Cervical Cancer
Abstract
1. Introduction
2. Results
2.1. Identification of G-Quadruplex-Harboring Dysregulated LncRNAs in Cervical Cancer
2.2. In Vitro Characterization of PQS in Identified LncRNA Clusters
2.3. RNA G-Quadruplex Structures Are Stabilized by the Presence of Monovalent Cations
2.4. Protein-Interacting Partners and Co-Expression Network of Selected LncRNAs
2.5. Protein-Interacting Partners for LncRNAs Using Bottom-to-Top Approach
2.6. Identifying LncRNA and RNA-Binding Protein Localization
3. Discussion
4. Materials and Methods
4.1. Bioinformatic Prediction of Putative G4-Forming Sequences, G4-Protein Interactions and Localization
4.1.1. Selection of LncRNAs Dysregulated in Cervical Cancer
4.1.2. Prediction of PQS
4.1.3. Prediction of LncRNA-Protein Interaction
4.1.4. Prediction of LncRNA and Interacting Protein Localization
4.2. Oligonucleotides and Compounds
4.3. CD Spectroscopy
4.4. Fluorescence Spectroscopy
4.5. Reverse-Transcriptase Stop Assay
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, X.; Sood, A.K.; Dang, C.V.; Zhang, L. The Role of Long Noncoding RNAs in Cancer: The Dark Matter Matters. Curr. Opin. Genet. Dev. 2018, 48, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Dai, X.; Kaushik, A.C.; Zhang, J. The Emerging Role of Major Regulatory RNAs in Cancer Control. Front. Oncol. 2019, 9, 920. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhang, X.; Chen, W.; Hu, X.; Li, J.; Liu, C. Regulatory Roles of Long Noncoding RNAs Implicated in Cancer Hallmarks. Int. J. Cancer 2020, 146, 906–916. [Google Scholar] [CrossRef]
- Chen, X.-Q.; Shen, T.; Fang, S.-J.; Sun, X.-M.; Li, G.-Y.; Li, Y.-F. Protein Homeostasis in Aging and Cancer. Front. Cell Dev. Biol. 2023, 11, 1143532. [Google Scholar] [CrossRef]
- Roy, P.; Saikia, B. Cancer and Cure: A Critical Analysis. Indian J. Cancer 2016, 53, 441. [Google Scholar] [CrossRef] [PubMed]
- Balasubramaniam, G.; Gaidhani, R.H.; Khan, A.; Saoba, S.; Mahantshetty, U.; Maheshwari, A. Survival Rate of Cervical Cancer from a Study Conducted in India. Indian J. Med. Sci. 2020, 73, 203–211. [Google Scholar] [CrossRef]
- Kaarthigeyan, K. Cervical Cancer in India and HPV Vaccination. Indian J. Med. Paediatr. Oncol. 2012, 33, 7–12. [Google Scholar] [CrossRef]
- Chi, H.-C.; Tsai, C.-Y.; Tsai, M.-M.; Yeh, C.-T.; Lin, K.-H. Roles of Long Noncoding RNAs in Recurrence and Metastasis of Radiotherapy-Resistant Cancer Stem Cells. Int. J. Mol. Sci. 2017, 18, 1903. [Google Scholar] [CrossRef] [PubMed]
- Bhatt, U.; Kretzmann, A.L.; Guédin, A.; Ou, A.; Kobelke, S.; Bond, C.S.; Evans, C.W.; Hurley, L.H.; Mergny, J.-L.; Iyer, K.S.; et al. The Role of G-Quadruplex DNA in Paraspeckle Formation in Cancer. Biochimie 2021, 190, 124–131. [Google Scholar] [CrossRef]
- Ramírez-Colmenero, A.; Oktaba, K.; Fernandez-Valverde, S.L. Evolution of Genome-Organizing Long Non-Coding RNAs in Metazoans. Front. Genet. 2020, 11, 589697. [Google Scholar] [CrossRef] [PubMed]
- Jayaraj, G.G.; Pandey, S.; Scaria, V.; Maiti, S. Potential G-Quadruplexes in the Human Long Non-Coding Transcriptome. RNA Biol. 2012, 9, 81–89. [Google Scholar] [CrossRef]
- Tassinari, M.; Richter, S.N.; Gandellini, P. Biological Relevance and Therapeutic Potential of G-Quadruplex Structures in the Human Noncoding Transcriptome. Nucleic Acids Res. 2021, 49, 3617–3633. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.Y.; Lejault, P.; Chevrier, S.; Boidot, R.; Robertson, A.G.; Wong, J.M.Y.; Monchaud, D. Transcriptome-Wide Identification of Transient RNA G-Quadruplexes in Human Cells. Nat. Commun. 2018, 9, 4730. [Google Scholar] [CrossRef]
- Matsumura, K.; Kawasaki, Y.; Miyamoto, M.; Kamoshida, Y.; Nakamura, J.; Negishi, L.; Suda, S.; Akiyama, T. The Novel G-Quadruplex-Containing Long Non-Coding RNA GSEC Antagonizes DHX36 and Modulates Colon Cancer Cell Migration. Oncogene 2017, 36, 1191–1199. [Google Scholar] [CrossRef]
- Jana, S.; Jana, J.; Patra, K.; Mondal, S.; Bhat, J.; Sarkar, A.; Sengupta, P.; Biswas, A.; Mukherjee, M.; Tripathi, S.P.; et al. LINCRNA00273 Promotes Cancer Metastasis and Its G-Quadruplex Promoter Can Serve as a Novel Target to Inhibit Cancer Invasiveness. Oncotarget 2017, 8, 110234–110256. [Google Scholar] [CrossRef] [PubMed]
- Simko, E.A.J.; Liu, H.; Zhang, T.; Velasquez, A.; Teli, S.; Haeusler, A.R.; Wang, J. G-Quadruplexes Offer a Conserved Structural Motif for NONO Recruitment to NEAT1 Architectural LncRNA. Nucleic Acids Res. 2020, 48, 7421–7438. [Google Scholar] [CrossRef] [PubMed]
- Thapar, R.; Wang, J.L.; Hammel, M.; Ye, R.; Liang, K.; Sun, C.; Hnizda, A.; Liang, S.; Maw, S.S.; Lee, L.; et al. Mechanism of Efficient Double-Strand Break Repair by a Long Non-Coding RNA. Nucleic Acids Res. 2020, 48, 10953–10972. [Google Scholar] [CrossRef] [PubMed]
- Wu, R.; Li, L.; Bai, Y.; Yu, B.; Xie, C.; Wu, H.; Zhang, Y.; Huang, L.; Yan, Y.; Li, X.; et al. The Long Noncoding RNA LUCAT1 Promotes Colorectal Cancer Cell Proliferation by Antagonizing Nucleolin to Regulate MYC Expression. Cell Death Dis. 2020, 11, 908. [Google Scholar] [CrossRef]
- Lorenz, R.; Bernhart, S.H.; Qin, J.; Siederdissen, C.H.Z.; Tanzer, A.; Amman, F.; Hofacker, I.L.; Stadler, P.F. 2D Meets 4G: G-Quadruplexes in RNA Secondary Structure Prediction. IEEE/ACM Trans. Comput. Biol. Bioinform. 2013, 10, 832–844. [Google Scholar] [CrossRef]
- Bensaid, M.; Melko, M.; Bechara, E.G.; Davidovic, L.; Berretta, A.; Catania, M.V.; Gecz, J.; Lalli, E.; Bardoni, B. FRAXE-Associated Mental Retardation Protein (FMR2) Is an RNA-Binding Protein with High Affinity for G-Quartet RNA Forming Structure. Nucleic Acids Res. 2009, 37, 1269–1279. [Google Scholar] [CrossRef]
- Wu, B.; Su, S.; Patil, D.P.; Liu, H.; Gan, J.; Jaffrey, S.R.; Ma, J. Molecular Basis for the Specific and Multivariant Recognitions of RNA Substrates by Human HnRNP A2/B1. Nat. Commun. 2018, 9, 420. [Google Scholar] [CrossRef] [PubMed]
- Cong, R.; Das, S.; Bouvet, P. The Multiple Properties and Functions of Nucleolin. In The Nucleolus; Olson, M.O.J., Ed.; Springer: New York, NY, USA, 2011; pp. 185–212. [Google Scholar] [CrossRef]
- Sauer, M.; Juranek, S.A.; Marks, J.; De Magis, A.; Kazemier, H.G.; Hilbig, D.; Benhalevy, D.; Wang, X.; Hafner, M.; Paeschke, K. DHX36 Prevents the Accumulation of Translationally Inactive MRNAs with G4-Structures in Untranslated Regions. Nat. Commun. 2019, 10, 2421. [Google Scholar] [CrossRef]
- Das, S.; Krainer, A.R. Emerging Functions of SRSF1, Splicing Factor and Oncoprotein, in RNA Metabolism and Cancer. Mol. Cancer Res. 2014, 12, 1195–1204. [Google Scholar] [CrossRef] [PubMed]
- Ha, J.; Jang, H.; Choi, N.; Oh, J.; Min, C.; Pradella, D.; Jung, D.-W.; Williams, D.R.; Park, D.; Ghigna, C.; et al. SRSF9 Regulates Cassette Exon Splicing of Caspase-2 by Interacting with Its Downstream Exon. Cells 2021, 10, 679. [Google Scholar] [CrossRef] [PubMed]
- Sama, R.R.K.; Ward, C.L.; Bosco, D.A. Functions of FUS/TLS From DNA Repair to Stress Response: Implications for ALS. ASN Neuro 2014, 6, 175909141454447. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Lee, O.-H.; Xin, H.; Chen, L.-Y.; Qin, J.; Chae, H.K.; Lin, S.-Y.; Safari, A.; Liu, D.; Songyang, Z. TRF2 Functions as a Protein Hub and Regulates Telomere Maintenance by Recognizing Specific Peptide Motifs. Nat. Struct. Mol. Biol. 2009, 16, 372–379. [Google Scholar] [CrossRef]
- Mekky, R.Y.; Ragab, M.F.; Manie, T.; Attia, A.A.; Youness, R.A. MALAT-1: Immunomodulatory LncRNA Hampering the Innate and the Adaptive Immune Arms in Triple Negative Breast Cancer. Transl. Oncol. 2023, 31, 101653. [Google Scholar] [CrossRef]
- Yuan, L.; Zhou, M.; Lv, H.; Qin, X.; Zhou, J.; Mao, X.; Li, X.; Xu, Y.; Liu, Y.; Xing, H. Involvement of NEAT1/MiR-133a Axis in Promoting Cervical Cancer Progression via Targeting SOX4. J. Cell. Physiol. 2019, 234, 18985–18993. [Google Scholar] [CrossRef]
- Shen, X.; Zhao, W.; Zhang, Y.; Liang, B. Long Non-Coding RNA-NEAT1 Promotes Cell Migration and Invasion via Regulating MiR-124/NF-ΚB Pathway in Cervical Cancer. OncoTargets Ther. 2020, 13, 3265–3276. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, W.; Zhang, R.; Li, J.; Li, S.; Ma, Y.; Jin, W.; Wang, K. Overexpressed Long Noncoding RNA CRNDE with Distinct Alternatively Spliced Isoforms in Multiple Cancers. Front. Med. 2019, 13, 330–343. [Google Scholar] [CrossRef]
- Guo, H.; Yang, S.; Li, S.; Yan, M.; Li, L.; Zhang, H. LncRNA SNHG20 Promotes Cell Proliferation and Invasion via MiR-140-5p-ADAM10 Axis in Cervical Cancer. Biomed. Pharmacother. 2018, 102, 749–757. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, H.; Shi, L.; Yu, X.; Gu, Y.; Sun, X. LINP1 Facilitates DNA Damage Repair through Non-Homologous End Joining (NHEJ) Pathway and Subsequently Decreases the Sensitivity of Cervical Cancer Cells to Ionizing Radiation. Cell Cycle 2018, 17, 439–447. [Google Scholar] [CrossRef]
- Wang, X.; Wang, Z.; Wang, J.; Wang, Y.; Liu, L.; Xu, X. LncRNA MEG3 Has Anti-Activity Effects of Cervical Cancer. Biomed. Pharmacother. 2017, 94, 636–643. [Google Scholar] [CrossRef]
- Del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. G-Quadruplex Secondary Structure Obtained from Circular Dichroism Spectroscopy. Angew. Chem. Int. Ed. 2018, 57, 7171–7175. [Google Scholar] [CrossRef] [PubMed]
- Karsisiotis, A.I.; Hessari, N.M.; Novellino, E.; Spada, G.P.; Randazzo, A.; Webba da Silva, M. Topological Characterization of Nucleic Acid G-Quadruplexes by UV Absorption and Circular Dichroism. Angew. Chem. Int. Ed. 2011, 50, 10645–10648. [Google Scholar] [CrossRef] [PubMed]
- Martadinata, H.; Phan, A.T. Structure of Propeller-Type Parallel-Stranded RNA G-Quadruplexes, Formed by Human Telomeric RNA Sequences in K + Solution. J. Am. Chem. Soc. 2009, 131, 2570–2578. [Google Scholar] [CrossRef]
- Pandey, S.; Agarwala, P.; Maiti, S. Effect of Loops and G-Quartets on the Stability of RNA G-Quadruplexes. J. Phys. Chem. B 2013, 117, 6896–6905. [Google Scholar] [CrossRef]
- Tang, C.-F.; Shafer, R.H. Engineering the Quadruplex Fold: Nucleoside Conformation Determines Both Folding Topology and Molecularity in Guanine Quadruplexes. J. Am. Chem. Soc. 2006, 128, 5966–5973. [Google Scholar] [CrossRef] [PubMed]
- Lyons, S.M.; Gudanis, D.; Coyne, S.M.; Gdaniec, Z.; Ivanov, P. Identification of Functional Tetramolecular RNA G-Quadruplexes Derived from Transfer RNAs. Nat. Commun. 2017, 8, 1127. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.M. Strontium(2+) Facilitates Intermolecular G-Quadruplex Formation of Telomeric Sequences. Biochemistry 1992, 31, 3769–3776. [Google Scholar] [CrossRef]
- Smargiasso, N.; Rosu, F.; Hsia, W.; Colson, P.; Baker, E.S.; Bowers, M.T.; De Pauw, E.; Gabelica, V. G-Quadruplex DNA Assemblies: Loop Length, Cation Identity, and Multimer Formation. J. Am. Chem. Soc. 2008, 130, 10208–10216. [Google Scholar] [CrossRef] [PubMed]
- Umar, M.I.; Ji, D.; Chan, C.-Y.; Kwok, C.K. G-Quadruplex-Based Fluorescent Turn-On Ligands and Aptamers: From Development to Applications. Molecules 2019, 24, 2416. [Google Scholar] [CrossRef]
- Hagihara, M.; Yoneda, K.; Yabuuchi, H.; Okuno, Y.; Nakatani, K. A Reverse Transcriptase Stop Assay Revealed Diverse Quadruplex Formations in UTRs in MRNA. Bioorg. Med. Chem. Lett. 2010, 20, 2350–2353. [Google Scholar] [CrossRef]
- Gholamalipour, Y.; Karunanayake Mudiyanselage, A.; Martin, C.T. 3′ End Additions by T7 RNA Polymerase Are RNA Self-Templated, Distributive and Diverse in Character—RNA-Seq Analyses. Nucleic Acids Res. 2018, 46, 9253–9263. [Google Scholar] [CrossRef] [PubMed]
- Pleiss, J.A.; Derrick, M.L.; Uhlenbeck, O.C. T7 RNA Polymerase Produces 5′ End Heterogeneity during in Vitro Transcription from Certain Templates. RNA 1998, 4, 1313–1317. [Google Scholar] [CrossRef] [PubMed]
- Balas, M.M.; Johnson, A.M. Exploring the Mechanisms behind Long Noncoding RNAs and Cancer. Non Coding RNA Res. 2018, 3, 108–117. [Google Scholar] [CrossRef]
- Wang, K.C.; Chang, H.Y. Molecular Mechanisms of Long Noncoding RNAs. Mol. Cell 2011, 43, 904–914. [Google Scholar] [CrossRef]
- Kuo, C.-C.; Hänzelmann, S.; Sentürk Cetin, N.; Frank, S.; Zajzon, B.; Derks, J.-P.; Akhade, V.S.; Ahuja, G.; Kanduri, C.; Grummt, I.; et al. Detection of RNA–DNA Binding Sites in Long Noncoding RNAs. Nucleic Acids Res. 2019, 47, e32. [Google Scholar] [CrossRef]
- Achour, C.; Aguilo, F. Long Non-Coding RNA and Polycomb: An Intricate Partnership in Cancer Biology. Front. Biosci. Landmark Ed. 2018, 23, 2106–2132. [Google Scholar] [CrossRef]
- Sun, X.; Haider Ali, M.S.S.; Moran, M. The Role of Interactions of Long Non-Coding RNAs and Heterogeneous Nuclear Ribonucleoproteins in Regulating Cellular Functions. Biochem. J. 2017, 474, 2925–2935. [Google Scholar] [CrossRef]
- Yang, Y.W.; Flynn, R.A.; Chen, Y.; Qu, K.; Wan, B.; Wang, K.C.; Lei, M.; Chang, H.Y. Essential Role of LncRNA Binding for WDR5 Maintenance of Active Chromatin and Embryonic Stem Cell Pluripotency. eLife 2014, 3, e02046. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Han, C.; Song, K.; Chen, W.; Ungerleider, N.; Yao, L.; Ma, W.; Wu, T. The Long-Noncoding RNA MALAT1 Regulates TGF-β/Smad Signaling through Formation of a LncRNA-Protein Complex with Smads, SETD2 and PPM1A in Hepatic Cells. PLoS ONE 2020, 15, e0228160. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, R.; Lal, A. Long Noncoding RNAs in the P53 Network. WIREs RNA 2017, 8, e1410. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Liu, S.; Ye, F.; Shen, Y.; Tie, Y.; Zhu, J.; Wei, L.; Jin, Y.; Fu, H.; Wu, Y.; et al. Long Noncoding RNA MEG3 Interacts with P53 Protein and Regulates Partial P53 Target Genes in Hepatoma Cells. PLoS ONE 2015, 10, e0139790. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Luo, Y.; Liang, B.; Ye, L.; Lu, G.; He, W. Potential Applications of MEG3 in Cancer Diagnosis and Prognosis. Oncotarget 2017, 8, 73282–73295. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Yao, J.; Yi, H.; Huang, X.; Zhao, W.; Yang, Z. To Unwind the Biological Knots: The DNA/RNA G-quadruplex Resolvase RHAU (DHX36) in Development and Disease. Anim. Models Exp. Med. 2022, 5, 542–549. [Google Scholar] [CrossRef]
- Tippana, R.; Chen, M.C.; Demeshkina, N.A.; Ferré-D’Amaré, A.R.; Myong, S. RNA G-Quadruplex Is Resolved by Repetitive and ATP-Dependent Mechanism of DHX36. Nat. Commun. 2019, 10, 1855. [Google Scholar] [CrossRef]
- Ning, S.; Zhang, J.; Wang, P.; Zhi, H.; Wang, J.; Liu, Y.; Gao, Y.; Guo, M.; Yue, M.; Wang, L.; et al. Lnc2Cancer: A Manually Curated Database of Experimentally Supported LncRNAs Associated with Various Human Cancers. Nucleic Acids Res. 2016, 44, D980–D985. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Wang, P.; Wang, Y.; Ma, X.; Zhi, H.; Zhou, D.; Li, X.; Fang, Y.; Shen, W.; Xu, Y.; et al. Lnc2Cancer v2.0: Updated Database of Experimentally Supported Long Non-Coding RNAs in Human Cancers. Nucleic Acids Res. 2019, 47, D1028–D1033. [Google Scholar] [CrossRef]
- Gao, Y.; Shang, S.; Guo, S.; Li, X.; Zhou, H.; Liu, H.; Sun, Y.; Wang, J.; Wang, P.; Zhi, H.; et al. Lnc2Cancer 3.0: An Updated Resource for Experimentally Supported LncRNA/CircRNA Cancer Associations and Web Tools Based on RNA-Seq and ScRNA-Seq Data. Nucleic Acids Res. 2021, 49, D1251–D1258. [Google Scholar] [CrossRef]
- Kikin, O.; D’Antonio, L.; Bagga, P.S. QGRS Mapper: A Web-Based Server for Predicting G-Quadruplexes in Nucleotide Sequences. Nucleic Acids Res. 2006, 34, W676–W682. [Google Scholar] [CrossRef] [PubMed]
- Cer, R.Z.; Donohue, D.E.; Mudunuri, U.S.; Temiz, N.A.; Loss, M.A.; Starner, N.J.; Halusa, G.N.; Volfovsky, N.; Yi, M.; Luke, B.T.; et al. Non-B DB v2.0: A Database of Predicted Non-B DNA-Forming Motifs and Its Associated Tools. Nucleic Acids Res. 2012, 41, D94–D100. [Google Scholar] [CrossRef] [PubMed]
- Ren, C.; An, G.; Zhao, C.; Ouyang, Z.; Bo, X.; Shu, W. Lnc2Catlas: An Atlas of Long Noncoding RNAs Associated with Risk of Cancers. Sci. Rep. 2018, 8, 1909. [Google Scholar] [CrossRef] [PubMed]
- Brázda, V.; Hároníková, L.; Liao, J.; Fojta, M. DNA and RNA Quadruplex-Binding Proteins. Int. J. Mol. Sci. 2014, 15, 17493–17517. [Google Scholar] [CrossRef] [PubMed]
- Mas-Ponte, D.; Carlevaro-Fita, J.; Palumbo, E.; Hermoso Pulido, T.; Guigo, R.; Johnson, R. LncATLAS Database for Subcellular Localization of Long Noncoding RNAs. RNA 2017, 23, 1080–1087. [Google Scholar] [CrossRef] [PubMed]
- Brunelle, J.L.; Green, R. In Vitro Transcription from Plasmid or PCR-Amplified DNA. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 2013; Volume 530, pp. 101–114. [Google Scholar] [CrossRef]
- Xu, S.; Li, Q.; Xiang, J.; Yang, Q.; Sun, H.; Guan, A.; Wang, L.; Liu, Y.; Yu, L.; Shi, Y.; et al. Thioflavin T as an Efficient Fluorescence Sensor for Selective Recognition of RNA G-Quadruplexes. Sci. Rep. 2016, 6, 24793. [Google Scholar] [CrossRef]








| Sr. No. | LncRNA Cluster Name | PQS Containing Isoforms for Each LncRNA Cluster | Expression | Max G-Score in PQS |
|---|---|---|---|---|
| 1 | H19 | 7 | upregulated | 144 |
| 2 | MEG3 | 5 | downregulated | 70 |
| 3 | NEAT1 | 6 | upregulated | 72 |
| 4 | SNHG20 | 1 | upregulated | 72 |
| 5 | GHET1 | 1 | upregulated | 64 |
| 6 | CRNDE | 1 | upregulated | 71 |
| 7 | HAGLR | 6 | upregulated | 71 |
| 8 | NORAD | 5 | upregulated | 71 |
| 9 | CASC2 | 1 | downregulated | 65 |
| 10 | SLC16A1-AS1 | 1 | differential | 61 |
| 11 | MALAT1 | 4 | upregulated | 70 |
| 10 | FEZF1-AS1 | 1 | upregulated | 63 |
| 13 | EWSAT1 | 4 | downregulated | 69 |
| 14 | LINP1 | 1 | upregulated | 69 |
| Name | Sequence (5′ to 3′) | G-Score | Length |
|---|---|---|---|
| TERRA | GGGTTAGGGTTAGGGTTAGGG | 72 | 60 |
| SNHG20 | GGGTTTGGGCTGGGGCCTGGG | 72 | 36 |
| MEG3 | GGGAAATTCTCAGGAGGGGGACCTGGGCCAAGGG | 64 | 40 |
| LINP1 | GGGGTAGGAGAGGGTATGGGGACCAGGGCACTCTGTAAGGG | 69 | 30 |
| CRNDE R1 | GGGCTAGGGCCTGGGCCTCGGG | 71 | 34 |
| CRNDE R2 | GGGTGTCGGGGTTCGGGGCGGG | 72 | 33 |
| LncRNA | Protein | Protein Transcript | Score | Cancer Type |
|---|---|---|---|---|
| LINP1 | PTEN | PTEN-001 | 213.74 | CSCC and EA * |
| LINP1 | PTEN | PTEN-001 | 213.74 | CSCC and EA |
| LINP1 | TP53 | TP53-001 | 165.3 | CSCC and EA |
| MEG3 | SMAD4 | SMAD4-001 | 308.18 | CSCC and EA |
| MEG3 | TP53 | TP53-001 | 249.83 | CSCC and EA |
| CRNDE | TP53 | TP53-001 | 106.82 | CSCC and EA |
| CRNDE | TP53 | TP53-001 | 106.82 | CSCC and EA |
| SNHG20 | TP53 | TP53-001 | 339.1 | CSCC and EA |
| SNHG20 | CDKN2A | CDKN2A-001 | 273.52 | CSCC and EA |
| SNHG20 | TP53 | TP53-001 | 339.1 | CSCC and EA |
| LncRNA | Binding Protein | RF-Score a | SVM-Score |
|---|---|---|---|
| LINP1 | FMR2 | 0.8 | 0.91 |
| hnRNP A2 | 0.85 | 0.72 | |
| Nucleolin | 0.9 | 0.946 | |
| DHX36 | 0.8 | 0.989 | |
| SRSF1 | 0.95 | 0.947 | |
| SRSF9 | 0.8 | 0.922 | |
| TLS | 0.9 | 0.869 | |
| TRF2 | 0.85 | 0.948 | |
| CRNDE | FMR2 | 0.75 | 0.99 |
| hnRNP A2 | 0.9 | 0.85 | |
| Nucleolin | 0.95 | 0.981 | |
| DHX36 | 0.75 | 0.997 | |
| SRSF1 | 0.95 | 0.978 | |
| SRSF9 | 0.75 | 0.968 | |
| TLS | 0.9 | 0.945 | |
| TRF2 | 0.8 | 0.983 | |
| SNHG20 | FMR2 | 0.8 | 0.81 |
| Nucleolin | 0.8 | 0.702 | |
| DHX36 | 0.75 | 0.961 | |
| SRSF1 | 0.8 | 0.657 | |
| SRSF9 | 0.7 | 0.71 | |
| TRF2 | 0.85 | 0.68 | |
| MEG3 | FMR2 | 0.8 | 0.91 |
| hnRNP A2 | 0.7 | 0.9 | |
| Nucleolin | 0.85 | 0.574 | |
| DHX36 | 0.7 | 0.824 | |
| SRSF1 | 0.8 | 0.511 |
| RNA-Binding Protein | LncRNAs | Subcellular Localization | Biological Function |
|---|---|---|---|
| FMR2 | LINP1 | Cytoplasm | Transcriptional regulation [20] |
| hnRNP A2 | MEG3, CRNDE, LINP1 | Nucleoplasm/Nucleus | Maturation, transport and metabolism of mRNA [21] |
| Nucleolin | MEG3, SNHG20, CRNDE, LINP1 | Nucleoplasm/Nucleus | Facilitates chromatin transcription, chromatin remodeling [22] |
| DHX36 | LINP1, MEG3, SNHG20, CRNDE | Nucleoplasm and Cytoplasm | Helicase resolving RNA G-quadruplexes [23] |
| SRSF1 | MEG3, SNHG20, CRNDE, LINP1 | Nucleoplasm/Nucleus | Regulating mRNA transcription, stability and nuclear export, translation and protein sumoylation [24] |
| SRSF9 | SNHG20, CRNDE, LINP1 | Nucleoplasm/Nucleus | mRNA processing, mRNA splicing [25] |
| TLS | CRNDE, LINP1 | Nucleoplasm/Nucleus | DNA repair, transcription, protein translation, RNA splicing and transport [26] |
| TRF2 | SNHG20, CRNDE, LINP1 | Nucleoplasm/Nucleus | DNA binding, double-stranded telomeric DNA binding, protein homodimerization activity, telomeric DNA binding, telomerase activity [27] |
| LncRNA | Biological Function |
|---|---|
| MEG3 | Cell growth, epithelial-to-mesenchymal transition |
| LINP1 | Cell growth, apoptosis |
| CRNDE | Cell growth, epithelial-to-mesenchymal transition, apoptosis |
| SNHG20 | Not known |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Singh, D.; Desai, N.; Shah, V.; Datta, B. In Silico Identification of Potential Quadruplex Forming Sequences in LncRNAs of Cervical Cancer. Int. J. Mol. Sci. 2023, 24, 12658. https://doi.org/10.3390/ijms241612658
Singh D, Desai N, Shah V, Datta B. In Silico Identification of Potential Quadruplex Forming Sequences in LncRNAs of Cervical Cancer. International Journal of Molecular Sciences. 2023; 24(16):12658. https://doi.org/10.3390/ijms241612658
Chicago/Turabian StyleSingh, Deepshikha, Nakshi Desai, Viraj Shah, and Bhaskar Datta. 2023. "In Silico Identification of Potential Quadruplex Forming Sequences in LncRNAs of Cervical Cancer" International Journal of Molecular Sciences 24, no. 16: 12658. https://doi.org/10.3390/ijms241612658
APA StyleSingh, D., Desai, N., Shah, V., & Datta, B. (2023). In Silico Identification of Potential Quadruplex Forming Sequences in LncRNAs of Cervical Cancer. International Journal of Molecular Sciences, 24(16), 12658. https://doi.org/10.3390/ijms241612658

