Roles of Nrf2/HO-1 and ICAM-1 in the Protective Effect of Nano-Curcumin against Copper-Induced Lung Injury
Abstract
:1. Introduction
2. Results
2.1. Curc and nCurc Mitigate Oxidative Stress after CuSO4-Induced Lung Injury
2.2. Curc and nCurc Attenuate CuSO4-Induced Histopathological Changes in Lung Tissues
2.3. Curc and nCurc Modulate Pulmonary Keap-1/Nrf-2/HO-1 Signaling after CuSO4-Induced Lung Injury
2.4. Curc and nCurc Ameliorate Inflammation after CuSO4-Induced Lung Injury
2.5. Curc and nCurc Restore SP-C and MUC-1 Levels after CuSO4-Induced Lung Injury
2.6. Curc and nCurc Prevent Apoptosis by Regulating BAX and Bcl-2 Gene Expression Levels after CuSO4-Induced Lung Injury
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Animals and Experimental Design
4.3. Measuring Oxidative Stress Markers
4.4. Histological Evaluation
4.5. Determination of Inflammatory and Lung-Specific Biomarkers
4.6. Gene Expression
4.7. Western Blotting
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Uriu-Adams, J.Y.; Keen, C.L. Copper, oxidative stress, and human health. Mol. Asp. Med. 2005, 26, 268–298. [Google Scholar] [CrossRef]
- Scheiber, I.; Dringen, R.; Mercer, J.F. Copper: Effects of deficiency and overload. Met. Ions Life Sci. 2013, 13, 359–387. [Google Scholar] [CrossRef] [PubMed]
- Denoyer, D.; Masaldan, S.; La Fontaine, S.; Cater, M.A. Targeting copper in cancer therapy: ‘Copper That Cancer’. Met. Integr. Biometal Sci. 2015, 7, 1459–1476. [Google Scholar] [CrossRef]
- Gaetke, L.M.; Chow-Johnson, H.S.; Chow, C.K. Copper: Toxicological relevance and mechanisms. Arch. Toxicol. 2014, 88, 1929–1938. [Google Scholar] [CrossRef] [PubMed]
- Roychoudhury, S.; Nath, S.; Massanyi, P.; Stawarz, R.; Kacaniova, M.; Kolesarova, A. Copper-induced changes in reproductive functions: In vivo and in vitro effects. Physiol. Res. 2016, 65, 11–22. [Google Scholar] [CrossRef]
- Gosens, I.; Cassee, F.R.; Zanella, M.; Manodori, L.; Brunelli, A.; Costa, A.L.; Bokkers, B.G.H.; de Jong, W.H.; Brown, D.; Hristozov, D.; et al. Organ burden and pulmonary toxicity of nano-sized copper (II) oxide particles after short-term inhalation exposure. Nanotoxicology 2016, 10, 1084–1095. [Google Scholar] [CrossRef]
- Oe, S.; Miyagawa, K.; Honma, Y.; Harada, M. Copper induces hepatocyte injury due to the endoplasmic reticulum stress in cultured cells and patients with Wilson disease. Exp. Cell Res. 2016, 347, 192–200. [Google Scholar] [CrossRef]
- Lamtai, M.; Zghari, O.; Ouakki, S.; Marmouzi, I.; Mesfioui, A.; El Hessni, A.; Ouichou, A. Chronic copper exposure leads to hippocampus oxidative stress and impaired learning and memory in male and female rats. Toxicol. Res. 2020, 36, 359–366. [Google Scholar] [CrossRef]
- Hashish, E.A.; Elgaml, S.A. Hepatoprotective and Nephroprotective Effect of Curcumin against Copper Toxicity in Rats. Indian J. Clin. Biochem. IJCB 2016, 31, 270–277. [Google Scholar] [CrossRef]
- Motlhatlhedi, K.; Firth, J.A.; Setlhare, V.; Kaguamba, J.K.; Mmolaatshepe, M. A novel and fatal method of copper sulphate poisoning. Afr. J. Emerg. Med. 2014, 4, e23–e25. [Google Scholar] [CrossRef]
- Franchitto, N.; Gandia-Mailly, P.; Georges, B.; Galinier, A.; Telmon, N.; Ducassé, J.L.; Rougé, D. Acute copper sulphate poisoning: A case report and literature review. Resuscitation 2008, 78, 92–96. [Google Scholar] [CrossRef]
- Gamakaranage, C.S.; Rodrigo, C.; Weerasinghe, S.; Gnanathasan, A.; Puvanaraj, V.; Fernando, H. Complications and management of acute copper sulphate poisoning; a case discussion. J. Occup. Med. Toxicol. 2011, 6, 34. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.S.; Moon, J.M.; Jeong, Y.H.; Lee, D.H.; Chun, B.J. Successful extracorporeal life support in respiratory failure after copper sulphate ingestion. Natl. Med. J. India 2018, 31, 83–85. [Google Scholar] [CrossRef] [PubMed]
- Poland, C.A.; Hubbard, S.A.; Levy, L.; Mackie, C. Inhalation toxicity of copper compounds: Results of 14-day range finding study for copper sulphate pentahydrate and dicopper oxide and 28-day subacute inhalation exposure of dicopper oxide in rats. Toxicology 2022, 474, 153221. [Google Scholar] [CrossRef] [PubMed]
- Lawson, M.K.; Valko, M.; Cronin, M.T.D.; Jomová, K. Chelators in Iron and Copper Toxicity. Curr. Pharmacol. Rep. 2016, 2, 271–280. [Google Scholar] [CrossRef]
- Rahman, I.; Biswas, S.K.; Kode, A. Oxidant and antioxidant balance in the airways and airway diseases. Eur. J. Pharmacol. 2006, 533, 222–239. [Google Scholar] [CrossRef]
- Chiou, H.C.; Wang, C.W.; Chen, S.C.; Tsai, M.L.; Lin, M.H.; Hung, C.H.; Kuo, C.H. Copper Exposure Induces Epithelial-Mesenchymal Transition-Related Fibrotic Change via Autophagy and Increase Risk of Lung Fibrosis in Human. Antioxidants 2023, 12, 532. [Google Scholar] [CrossRef]
- Zhang, X.; Yang, Q. Association between serum copper levels and lung cancer risk: A meta-analysis. J. Int. Med. Res. 2018, 46, 4863–4873. [Google Scholar] [CrossRef] [PubMed]
- Lai, X.; Zhao, H.; Zhang, Y.; Guo, K.; Xu, Y.; Chen, S.; Zhang, J. Intranasal Delivery of Copper Oxide Nanoparticles Induces Pulmonary Toxicity and Fibrosis in C57BL/6 mice. Sci. Rep. 2018, 8, 4499. [Google Scholar] [CrossRef]
- Liu, H.; Lai, W.; Liu, X.; Yang, H.; Fang, Y.; Tian, L.; Li, K.; Nie, H.; Zhang, W.; Shi, Y.; et al. Exposure to copper oxide nanoparticles triggers oxidative stress and endoplasmic reticulum (ER)-stress induced toxicology and apoptosis in male rat liver and BRL-3A cell. J. Hazard. Mater. 2021, 401, 123349. [Google Scholar] [CrossRef]
- Zhang, Z.; Weichenthal, S.; Kwong, J.C.; Burnett, R.T.; Hatzopoulou, M.; Jerrett, M.; van Donkelaar, A.; Bai, L.; Martin, R.V.; Copes, R.; et al. A Population-Based Cohort Study of Respiratory Disease and Long-Term Exposure to Iron and Copper in Fine Particulate Air Pollution and Their Combined Impact on Reactive Oxygen Species Generation in Human Lungs. Environ. Sci. Technol. 2021, 55, 3807–3818. [Google Scholar] [CrossRef]
- Yang, F.; Liao, J.; Yu, W.; Pei, R.; Qiao, N.; Han, Q.; Hu, L.; Li, Y.; Guo, J.; Pan, J.; et al. Copper induces oxidative stress with triggered NF-κB pathway leading to inflammatory responses in immune organs of chicken. Ecotoxicol. Environ. Saf. 2020, 200, 110715. [Google Scholar] [CrossRef] [PubMed]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. CB 2014, 24, R453–R462. [Google Scholar] [CrossRef] [PubMed]
- Patwa, J.; Flora, S.J.S. MiADMSA abrogates chronic copper-induced hepatic and immunological changes in Sprague Dawley rats. Food Chem. Toxicol. 2020, 145, 111692. [Google Scholar] [CrossRef] [PubMed]
- Saghir, S.; Alharbi, S.; Al-garadi, M.; Al-Gabri, N.; Rady, H.; Olama, N.; Abdulghani, M.; Alhroob, A.; Almaiman, A.; Bin-Jumah, M.; et al. Curcumin Prevents Cyclophosphamide-Induced Lung Injury in Rats by Suppressing Oxidative Stress and Apoptosis. Processes 2020, 8, 127. [Google Scholar] [CrossRef]
- Pizzo, P.; Scapin, C.; Vitadello, M.; Florean, C.; Gorza, L. Grp94 acts as a mediator of curcumin-induced antioxidant defence in myogenic cells. J. Cell Mol. Med. 2010, 14, 970–981. [Google Scholar] [CrossRef]
- Aggarwal, B.B.; Harikumar, K.B. Potential therapeutic effects of curcumin, the anti-inflammatory agent, against neurodegenerative, cardiovascular, pulmonary, metabolic, autoimmune and neoplastic diseases. Int. J. Biochem. Cell Biol. 2009, 41, 40–59. [Google Scholar] [CrossRef] [PubMed]
- Yonar, M.E.; Mişe Yonar, S.; İspir, Ü.; Ural, M. Effects of curcumin on haematological values, immunity, antioxidant status and resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas salmonicida subsp. achromogenes. Fish Shellfish Immunol. 2019, 89, 83–90. [Google Scholar] [CrossRef]
- Al-Dossari, M.H.; Fadda, L.M.; Attia, H.A.; Hasan, I.H.; Mahmoud, A.M. Curcumin and Selenium Prevent Lipopolysaccharide/Diclofenac-Induced Liver Injury by Suppressing Inflammation and Oxidative Stress. Biol. Trace Elem. Res. 2020, 196, 173–183. [Google Scholar] [CrossRef]
- Scazzocchio, B.; Minghetti, L.; D’Archivio, M. Interaction between Gut Microbiota and Curcumin: A New Key of Understanding for the Health Effects of Curcumin. Nutrients 2020, 12, 2499. [Google Scholar] [CrossRef]
- Venkatesan, N.; Punithavathi, D.; Babu, M. Protection from acute and chronic lung diseases by curcumin. Adv. Exp. Med. Biol. 2007, 595, 379–405. [Google Scholar] [CrossRef] [PubMed]
- Suresh, M.V.; Francis, S.; Aktay, S.; Kralovich, G.; Raghavendran, K. Therapeutic potential of curcumin in ARDS and COVID-19. Clin. Exp. Pharmacol. Physiol. 2023, 50, 267–276. [Google Scholar] [CrossRef]
- Avasarala, S.; Zhang, F.; Liu, G.; Wang, R.; London, S.D.; London, L. Curcumin modulates the inflammatory response and inhibits subsequent fibrosis in a mouse model of viral-induced acute respiratory distress syndrome. PLoS ONE 2013, 8, e57285. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; An, X.; Wang, X.; Bao, C.; Li, J.; Yang, D.; Bai, C. Curcumin ameliorated ventilator-induced lung injury in rats. Biomed. Pharmacother. 2018, 98, 754–761. [Google Scholar] [CrossRef] [PubMed]
- Vahedian-Azimi, A.; Abbasifard, M.; Rahimi-Bashar, F.; Guest, P.C.; Majeed, M.; Mohammadi, A.; Banach, M.; Jamialahmadi, T.; Sahebkar, A. Effectiveness of Curcumin on Outcomes of Hospitalized COVID-19 Patients: A Systematic Review of Clinical Trials. Nutrients 2022, 14. [Google Scholar] [CrossRef] [PubMed]
- Flora, G.; Gupta, D.; Tiwari, A. Nanocurcumin: A promising therapeutic advancement over native curcumin. Crit. Rev. Ther. Drug Carr. Syst. 2013, 30, 331–368. [Google Scholar] [CrossRef]
- Vázquez-Blanco, R.; Arias-Estévez, M.; Bååth, E.; Fernández-Calviño, D. Comparison of Cu salts and commercial Cu based fungicides on toxicity towards microorganisms in soil. Environ. Pollut. 2020, 257, 113585. [Google Scholar] [CrossRef]
- Janssen, R.; de Brouwer, B.; von der Thüsen, J.H.; Wouters, E.F.M. Copper as the most likely pathogenic divergence factor between lung fibrosis and emphysema. Med. Hypotheses 2018, 120, 49–54. [Google Scholar] [CrossRef]
- Gunther, M.R.; Hanna, P.M.; Mason, R.P.; Cohen, M.S. Hydroxyl Radical Formation from Cuprous Ion and Hydrogen Peroxide: A Spin-Trapping Study. Arch. Biochem. Biophys. 1995, 316, 515–522. [Google Scholar] [CrossRef]
- Husain, N.; Mahmood, R. Copper(II) generates ROS and RNS, impairs antioxidant system and damages membrane and DNA in human blood cells. Environ. Sci. Pollut. Res. Int. 2019, 26, 20654–20668. [Google Scholar] [CrossRef]
- Su, L.J.; Zhang, J.H.; Gomez, H.; Murugan, R.; Hong, X.; Xu, D.; Jiang, F.; Peng, Z.Y. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxidative Med. Cell. Longev. 2019, 2019, 5080843. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Pei, R.; Zhang, Z.; Liao, J.; Yu, W.; Qiao, N.; Han, Q.; Li, Y.; Hu, L.; Guo, J.; et al. Copper induces oxidative stress and apoptosis through mitochondria-mediated pathway in chicken hepatocytes. Toxicol. Vitr. 2019, 54, 310–316. [Google Scholar] [CrossRef] [PubMed]
- Sarawi, W.S.; Alhusaini, A.M.; Fadda, L.M.; Alomar, H.A.; Albaker, A.B.; Aljrboa, A.S.; Alotaibi, A.M.; Hasan, I.H.; Mahmoud, A.M. Curcumin and Nano-Curcumin Mitigate Copper Neurotoxicity by Modulating Oxidative Stress, Inflammation, and Akt/GSK-3β Signaling. Molecules 2021, 26, 5591. [Google Scholar] [CrossRef] [PubMed]
- Sarawi, W.S.; Alhusaini, A.M.; Fadda, L.M.; Alomar, H.A.; Albaker, A.B.; Aljrboa, A.S.; Alotaibi, A.M.; Hasan, I.H.; Mahmoud, A.M. Nano-Curcumin Prevents Cardiac Injury, Oxidative Stress and Inflammation, and Modulates TLR4/NF-kappaB and MAPK Signaling in Copper Sulfate-Intoxicated Rats. Antioxidants 2021, 10, 1414. [Google Scholar] [CrossRef] [PubMed]
- Sarawi, W.S.; Alhusaini, A.M.; Fadda, L.M.; Alomar, H.A.; Albaker, A.B.; Alghibiwi, H.K.; Aljrboa, A.S.; Alotaibi, A.M.; Hasan, I.H.; Mahmoud, A.M. Nano-Curcumin Prevents Copper Reproductive Toxicity by Attenuating Oxidative Stress and Inflammation and Improving Nrf2/HO-1 Signaling and Pituitary-Gonadal Axis in Male Rats. Toxics 2022, 10, 356. [Google Scholar] [CrossRef]
- Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxidative Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef]
- Averill-Bates, D.A. The antioxidant glutathione. Vitam. Horm. 2023, 121, 109–141. [Google Scholar] [CrossRef]
- Hufnagel, M.; Neuberger, R.; Wall, J.; Link, M.; Friesen, A.; Hartwig, A. Impact of Differentiated Macrophage-Like Cells on the Transcriptional Toxicity Profile of CuO Nanoparticles in Co-Cultured Lung Epithelial Cells. Int. J. Mol. Sci. 2021, 22, 5044. [Google Scholar] [CrossRef]
- Kwon, J.T.; Kim, Y.; Choi, S.; Yoon, B.L.; Kim, H.S.; Shim, I.; Sul, D. Pulmonary Toxicity and Proteomic Analysis in Bronchoalveolar Lavage Fluids and Lungs of Rats Exposed to Copper Oxide Nanoparticles. Int. J. Mol. Sci. 2022, 23, 13265. [Google Scholar] [CrossRef]
- Valko, M.; Jomova, K.; Rhodes, C.J.; Kuca, K.; Musilek, K. Redox- and non-redox-metal-induced formation of free radicals and their role in human disease. Arch. Toxicol. 2016, 90, 1–37. [Google Scholar] [CrossRef]
- Valko, M.; Morris, H.; Cronin, M.T. Metals, toxicity and oxidative stress. Curr. Med. Chem. 2005, 12, 1161–1208. [Google Scholar] [CrossRef] [PubMed]
- Witkowska, D.; Słowik, J.; Chilicka, K. Heavy Metals and Human Health: Possible Exposure Pathways and the Competition for Protein Binding Sites. Molecules 2021, 26, 6060. [Google Scholar] [CrossRef] [PubMed]
- Kalpana, C.; Menon, V.P. Curcumin ameliorates oxidative stress during nicotine-induced lung toxicity in Wistar rats. Ital. J. Biochem. 2004, 53, 82–86. [Google Scholar] [PubMed]
- Suzuki, M.; Betsuyaku, T.; Ito, Y.; Nagai, K.; Odajima, N.; Moriyama, C.; Nasuhara, Y.; Nishimura, M. Curcumin attenuates elastase- and cigarette smoke-induced pulmonary emphysema in mice. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2009, 296, L614–L623. [Google Scholar] [CrossRef]
- Zhang, D.; Huang, C.; Yang, C.; Liu, R.J.; Wang, J.; Niu, J.; Brömme, D. Antifibrotic effects of curcumin are associated with overexpression of cathepsins K and L in bleomycin treated mice and human fibroblasts. Respir. Res. 2011, 12, 154. [Google Scholar] [CrossRef]
- Lee, J.C.; Kinniry, P.A.; Arguiri, E.; Serota, M.; Kanterakis, S.; Chatterjee, S.; Solomides, C.C.; Javvadi, P.; Koumenis, C.; Cengel, K.A.; et al. Dietary curcumin increases antioxidant defenses in lung, ameliorates radiation-induced pulmonary fibrosis, and improves survival in mice. Radiat. Res. 2010, 173, 590–601. [Google Scholar] [CrossRef]
- Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef]
- Rangasamy, T.; Cho, C.Y.; Thimmulappa, R.K.; Zhen, L.; Srisuma, S.S.; Kensler, T.W.; Yamamoto, M.; Petrache, I.; Tuder, R.M.; Biswal, S. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J. Clin. Investig. 2004, 114, 1248–1259. [Google Scholar] [CrossRef]
- Cho, H.Y.; Jedlicka, A.E.; Reddy, S.P.; Kensler, T.W.; Yamamoto, M.; Zhang, L.Y.; Kleeberger, S.R. Role of NRF2 in protection against hyperoxic lung injury in mice. Am. J. Respir. Cell Mol. Biol. 2002, 26, 175–182. [Google Scholar] [CrossRef]
- Garcia-Nino, W.R.; Pedraza-Chaverri, J. Protective effect of curcumin against heavy metals-induced liver damage. Food Chem. Toxicol. 2014, 69, 182–201. [Google Scholar] [CrossRef]
- Jiang, W.D.; Liu, Y.; Hu, K.; Jiang, J.; Li, S.H.; Feng, L.; Zhou, X.Q. Copper exposure induces oxidative injury, disturbs the antioxidant system and changes the Nrf2/ARE (CuZnSOD) signaling in the fish brain: Protective effects of myo-inositol. Aquat. Toxicol. 2014, 155, 301–313. [Google Scholar] [CrossRef] [PubMed]
- Lu, Q.; Zhang, Y.; Zhao, C.; Zhang, H.; Pu, Y.; Yin, L. Copper induces oxidative stress and apoptosis of hippocampal neuron via pCREB/BDNF/and Nrf2/HO-1/NQO1 pathway. J. Appl. Toxicol. JAT 2022, 42, 694–705. [Google Scholar] [CrossRef] [PubMed]
- Ashrafizadeh, M.; Ahmadi, Z.; Mohammadinejad, R.; Farkhondeh, T.; Samarghandian, S. Curcumin Activates the Nrf2 Pathway and Induces Cellular Protection against Oxidative Injury. Curr. Mol. Med. 2020, 20, 116–133. [Google Scholar] [CrossRef] [PubMed]
- Shahcheraghi, S.H.; Salemi, F.; Peirovi, N.; Ayatollahi, J.; Alam, W.; Khan, H.; Saso, L. Nrf2 Regulation by Curcumin: Molecular Aspects for Therapeutic Prospects. Molecules 2021, 27, 167. [Google Scholar] [CrossRef] [PubMed]
- Satta, S.; Mahmoud, A.M.; Wilkinson, F.L.; Yvonne Alexander, M.; White, S.J. The Role of Nrf2 in Cardiovascular Function and Disease. Oxidative Med. Cell. Longev. 2017, 2017, 9237263. [Google Scholar] [CrossRef]
- Xiao, Y.; Xia, J.; Wu, S.; Lv, Z.; Huang, S.; Huang, H.; Su, X.; Cheng, J.; Ke, Y. Curcumin Inhibits Acute Vascular Inflammation through the Activation of Heme Oxygenase-1. Oxidative Med. Cell. Longev. 2018, 2018, 3295807. [Google Scholar] [CrossRef]
- Ke, S.; Zhang, Y.; Lan, Z.; Li, S.; Zhu, W.; Liu, L. Curcumin protects murine lung mesenchymal stem cells from H(2)O(2) by modulating the Akt/Nrf2/HO-1 pathway. J. Int. Med. Res. 2020, 48, 300060520910665. [Google Scholar] [CrossRef]
- Pietrofesa, R.A.; Park, K.; Mishra, O.P.; Johnson-McDaniel, D.; Myerson, J.W.; Shuvaev, V.V.; Arguiri, E.; Chatterjee, S.; Moorthy, G.S.; Zuppa, A.; et al. Copper Oxide Nanoparticle-Induced Acute Inflammatory Response and Injury in Murine Lung Is Ameliorated by Synthetic Secoisolariciresinol Diglucoside (LGM2605). Int. J. Mol. Sci. 2021, 22, 9477. [Google Scholar] [CrossRef]
- Kim, S.R.; Bae, Y.H.; Bae, S.K.; Choi, K.S.; Yoon, K.H.; Koo, T.H.; Jang, H.O.; Yun, I.; Kim, K.W.; Kwon, Y.G.; et al. Visfatin enhances ICAM-1 and VCAM-1 expression through ROS-dependent NF-kappaB activation in endothelial cells. Biochim. Biophys. Acta 2008, 1783, 886–895. [Google Scholar] [CrossRef]
- Gosens, I.; Costa, P.M.; Olsson, M.; Stone, V.; Costa, A.L.; Brunelli, A.; Badetti, E.; Bonetto, A.; Bokkers, B.G.H.; de Jong, W.H.; et al. Pulmonary toxicity and gene expression changes after short-term inhalation exposure to surface-modified copper oxide nanoparticles. NanoImpact 2021, 22, 100313. [Google Scholar] [CrossRef]
- Hubbard, A.K.; Rothlein, R. Intercellular adhesion molecule-1 (ICAM-1) expression and cell signaling cascades. Free Radic. Biol. Med. 2000, 28, 1379–1386. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Hwang, J.S.; Woo, C.H.; Kim, E.Y.; Kim, T.H.; Cho, K.J.; Kim, J.H.; Seo, J.M.; Lee, S.S. TNF-alpha-induced up-regulation of intercellular adhesion molecule-1 is regulated by a Rac-ROS-dependent cascade in human airway epithelial cells. Exp. Mol. Med. 2008, 40, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Nemmar, A.; Subramaniyan, D.; Ali, B.H. Protective effect of curcumin on pulmonary and cardiovascular effects induced by repeated exposure to diesel exhaust particles in mice. PLoS ONE 2012, 7, e39554. [Google Scholar] [CrossRef] [PubMed]
- Youn, H.; Jeong, J.C.; Jeong, Y.S.; Kim, E.J.; Um, S.J. Quercetin potentiates apoptosis by inhibiting nuclear factor-kappaB signaling in H460 lung cancer cells. Biol. Pharm. Bull. 2013, 36, 944–951. [Google Scholar] [CrossRef] [PubMed]
- Yen, F.L.; Tsai, M.H.; Yang, C.M.; Liang, C.J.; Lin, C.C.; Chiang, Y.C.; Lee, H.C.; Ko, H.H.; Lee, C.W. Curcumin nanoparticles ameliorate ICAM-1 expression in TNF-α-treated lung epithelial cells through p47 (phox) and MAPKs/AP-1 pathways. PLoS ONE 2013, 8, e63845. [Google Scholar] [CrossRef] [PubMed]
- Basnet, P.; Skalko-Basnet, N. Curcumin: An anti-inflammatory molecule from a curry spice on the path to cancer treatment. Molecules 2011, 16, 4567–4598. [Google Scholar] [CrossRef]
- Boyanapalli, S.S.; Paredes-Gonzalez, X.; Fuentes, F.; Zhang, C.; Guo, Y.; Pung, D.; Saw, C.L.; Kong, A.N. Nrf2 knockout attenuates the anti-inflammatory effects of phenethyl isothiocyanate and curcumin. Chem. Res. Toxicol. 2014, 27, 2036–2043. [Google Scholar] [CrossRef]
- Jin, H.; Ciechanowicz, A.K.; Kaplan, A.R.; Wang, L.; Zhang, P.X.; Lu, Y.C.; Tobin, R.E.; Tobin, B.A.; Cohn, L.; Zeiss, C.J.; et al. Surfactant protein C dampens inflammation by decreasing JAK/STAT activation during lung repair. Am. J. Physiology. Lung Cell. Mol. Physiol. 2018, 314, L882–L892. [Google Scholar] [CrossRef]
- Arias-Díaz, J.; Vara, E.; García, C.; Balibrea, J.L. Tumor necrosis factor-alpha-induced inhibition of phosphatidylcholine synthesis by human type II pneumocytes is partially mediated by prostaglandins. J. Clin. Investig. 1994, 94, 244–250. [Google Scholar] [CrossRef]
- Wispé, J.R.; Clark, J.C.; Warner, B.B.; Fajardo, D.; Hull, W.E.; Holtzman, R.B.; Whitsett, J.A. Tumor necrosis factor-alpha inhibits expression of pulmonary surfactant protein. J. Clin. Investig. 1990, 86, 1954–1960. [Google Scholar] [CrossRef]
- Pryhuber, G.S.; Khalak, R.; Zhao, Q. Regulation of surfactant proteins A and B by TNF-alpha and phorbol ester independent of NF-kappa B. Am. J. Physiol. 1998, 274, L289–L295. [Google Scholar] [CrossRef] [PubMed]
- Glasser, S.W.; Detmer, E.A.; Ikegami, M.; Na, C.L.; Stahlman, M.T.; Whitsett, J.A. Pneumonitis and emphysema in sp-C gene targeted mice. J. Biol. Chem. 2003, 278, 14291–14298. [Google Scholar] [CrossRef] [PubMed]
- Puthusseri, B.; Marudamuthu, A.; Tiwari, N.; Fu, J.; Idell, S.; Shetty, S. Regulation of p53-mediated changes in the uPA-fibrinolytic system and in lung injury by loss of surfactant protein C expression in alveolar epithelial cells. Am. J. Physiology. Lung Cell. Mol. Physiol. 2017, 312, L783–L796. [Google Scholar] [CrossRef] [PubMed]
- Guzel, A.; Kanter, M.; Guzel, A.; Yucel, A.F.; Erboga, M. Protective effect of curcumin on acute lung injury induced by intestinal ischaemia/reperfusion. Toxicol. Ind. Health 2013, 29, 633–642. [Google Scholar] [CrossRef] [PubMed]
- Joshi, S.; Kumar, S.; Bafna, S.; Rachagani, S.; Wagner, K.U.; Jain, M.; Batra, S.K. Genetically engineered mucin mouse models for inflammation and cancer. Cancer Metastasis Rev. 2015, 34, 593–609. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.C.; Lillehoj, E.P. MUC1 mucin: A peacemaker in the lung. Am. J. Respir. Cell Mol. Biol. 2008, 39, 644–647. [Google Scholar] [CrossRef]
- Lu, W.; Hisatsune, A.; Koga, T.; Kato, K.; Kuwahara, I.; Lillehoj, E.P.; Chen, W.; Cross, A.S.; Gendler, S.J.; Gewirtz, A.T.; et al. Cutting edge: Enhanced pulmonary clearance of Pseudomonas aeruginosa by Muc1 knockout mice. J. Immunol. 2006, 176, 3890–3894. [Google Scholar] [CrossRef]
- Koga, T.; Kuwahara, I.; Lillehoj, E.P.; Lu, W.; Miyata, T.; Isohama, Y.; Kim, K.C. TNF-alpha induces MUC1 gene transcription in lung epithelial cells: Its signaling pathway and biological implication. Am. J. Physiology. Lung Cell. Mol. Physiol. 2007, 293, L693–L701. [Google Scholar] [CrossRef]
- Kuwahara, I.; Lillehoj, E.P.; Hisatsune, A.; Lu, W.; Isohama, Y.; Miyata, T.; Kim, K.C. Neutrophil elastase stimulates MUC1 gene expression through increased Sp1 binding to the MUC1 promoter. Am. J. Physiology. Lung Cell. Mol. Physiol. 2005, 289, L355–L362. [Google Scholar] [CrossRef]
- Shi, Y.; Chen, J.; Weng, C.; Chen, R.; Zheng, Y.; Chen, Q.; Tang, H. Identification of the protein-protein contact site and interaction mode of human VDAC1 with Bcl-2 family proteins. Biochem. Biophys. Res. Commun. 2003, 305, 989–996. [Google Scholar] [CrossRef]
- Li, Y.; Chen, H.; Liao, J.; Chen, K.; Javed, M.T.; Qiao, N.; Zeng, Q.; Liu, B.; Yi, J.; Tang, Z.; et al. Long-term copper exposure promotes apoptosis and autophagy by inducing oxidative stress in pig testis. Environ. Sci. Pollut. Res. 2021, 28, 55140–55153. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, S.; Geng, J.X.; Hu, X.Y. Curcumin inhibits human non-small cell lung cancer A549 cell proliferation through regulation of Bcl-2/Bax and cytochrome C. Asian Pac. J. Cancer Prev. 2013, 14, 4599–4602. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Long, M.; Li, X.; Zhu, S.; Zhang, M.; Yang, Z. Curcumin activates autophagy and attenuates oxidative damage in EA.hy926 cells via the Akt/mTOR pathway. Mol. Med. Rep. 2016, 13, 2187–2193. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Kalita, J.; Misra, U.K.; Bora, H.K. A study of dose response and organ susceptibility of copper toxicity in a rat model. J. Trace Elem. Med. Biol. 2015, 29, 269–274. [Google Scholar] [CrossRef] [PubMed]
- Alhusaini, A.; Hasan, I.H.; Aldowsari, N.; Alsaadan, N. Prophylactic Administration of Nanocurcumin Abates the Incidence of Liver Toxicity Induced by an Overdose of Copper Sulfate: Role of CYP4502E1, NF-kappaB and Bax Expressions. Dose-Response A Publ. Int. Hormesis Soc. 2018, 16, 1559325818816284. [Google Scholar] [CrossRef]
- Alhusaini, A.; Fadda, L.; Hassan, I.; Ali, H.M.; Alsaadan, N.; Aldowsari, N.; Aldosari, A.; Alharbi, B. Liposomal Curcumin Attenuates the Incidence of Oxidative Stress, Inflammation, and DNA Damage Induced by Copper Sulfate in Rat Liver. Dose-Response A Publ. Int. Hormesis Soc. 2018, 16, 1559325818790869. [Google Scholar] [CrossRef]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef]
- Ellman, G.L. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 1959, 82, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Marklund, S.L. Superoxide dismutase isoenzymes in tissues and plasma from New Zealand black mice, nude mice and normal BALB/c mice. Mutat. Res. 1985, 148, 129–134. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, F.F.; Peng, W.; Sweeney, J.A.; Jia, Z.Y.; Gong, Q.Y. Brain structure alterations in depression: Psychoradiological evidence. CNS Neurosci. Ther. 2018, 24, 994–1003. [Google Scholar] [CrossRef] [PubMed]
Gene | GenBank Accession Number | Primers (5′–3′) | Amplicon Size (bp) |
---|---|---|---|
BAX | NM_017059.2 | F: AGGACGCATCCACCAAGAAG R: CAGTTGAAGTTGCCGTCTGC | 166 |
BCL-2 | NM_016993.1 | F: ACTCTTCAGGGATGGGGTGA R: TGACATCTCCCTGTTGACGC | 94 |
β-actin | NM_031144.3 | F: AGGAGTACGATGAGTCCGGC R: CGCAGCTCAGTAACAGTCCG | 71 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sarawi, W.S.; Alhusaini, A.M.; Alghibiwi, H.K.; Alsaab, J.S.; Hasan, I.H. Roles of Nrf2/HO-1 and ICAM-1 in the Protective Effect of Nano-Curcumin against Copper-Induced Lung Injury. Int. J. Mol. Sci. 2023, 24, 13975. https://doi.org/10.3390/ijms241813975
Sarawi WS, Alhusaini AM, Alghibiwi HK, Alsaab JS, Hasan IH. Roles of Nrf2/HO-1 and ICAM-1 in the Protective Effect of Nano-Curcumin against Copper-Induced Lung Injury. International Journal of Molecular Sciences. 2023; 24(18):13975. https://doi.org/10.3390/ijms241813975
Chicago/Turabian StyleSarawi, Wedad S., Ahlam M. Alhusaini, Hanan K. Alghibiwi, Juman S. Alsaab, and Iman H. Hasan. 2023. "Roles of Nrf2/HO-1 and ICAM-1 in the Protective Effect of Nano-Curcumin against Copper-Induced Lung Injury" International Journal of Molecular Sciences 24, no. 18: 13975. https://doi.org/10.3390/ijms241813975