Next Article in Journal
Ketogenic Diet Affects Sleep Architecture in C57BL/6J Wild Type and Fragile X Mice
Next Article in Special Issue
Germline CSF3R Variant in Chronic Myelomonocytic Leukemia: Linking Genetic Predisposition to Uncommon Hemorrhagic Symptoms
Previous Article in Journal
DNA Damage Induced by T-2 Mycotoxin in Human Skin Fibroblast Cell Line—Hs68
Previous Article in Special Issue
Defining the Basal and Immunomodulatory Mediator-Induced Phosphoprotein Signature in Pediatric B Cell Acute Lymphoblastic Leukemia (B-ALL) Diagnostic Samples
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 19
10.3390/ijms241914451
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Unusual Presentation of SET::NUP214-Associated Concomitant Hematological Neoplasm in a Child—Diagnostic and Treatment Struggle

by
Yaroslav Menchits
1,
Tatiana Salimova
1,
Alexander Komkov
2,
Dmitry Abramov
1,
Tatiana Konyukhova
1,
Ruslan Abasov
1,
Elena Raykina
1,
Albert Itov
1,
Marina Gaskova
1,
Aleksandra Borkovskaia
1,
Anna Kazakova
1,
Olga Soldatkina
1,
Svetlana Kashpor
1,
Alexandra Semchenkova
1,
Alexander Popov
1,
Galina Novichkova
1,
Yulia Olshanskaya
1,
Alexey Maschan
1 and
Elena Zerkalenkova
1,*
1
Dmitry Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology, Samora Maschela Str., 1, 117998 Moscow, Russia
2
Abu Dhabi Stem Cells Center, Mahdar Qutouf Str., 25, Abu Dhabi 22404, United Arab Emirates
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(19), 14451; https://doi.org/10.3390/ijms241914451
Submission received: 12 August 2023 / Revised: 15 September 2023 / Accepted: 16 September 2023 / Published: 22 September 2023
(This article belongs to the Special Issue Molecular Aspects of Hematological Malignancies and Benign Hematological Disorders 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Simultaneous multilineage hematologic malignancies are uncommon and associated with poorer prognosis than single-lineage leukemia or lymphoma. Here, we describe a concomitant malignant neoplasm in a 4-year-old boy. The child presented with massive lymphoproliferative syndrome, nasal breathing difficulties, and snoring. Morphological, immunocytochemical, and flow cytometry diagnostics showed coexistence of acute myeloid leukemia (AML) and peripheral T-cell lymphoma (PTCL). Molecular examination revealed a rare t(9;9)(q34;q34)/SET::NUP214 translocation as well as common TCR clonal rearrangements in both the bone marrow and lymph nodes. The disease showed primary refractoriness to both lymphoid and myeloid high-dose chemotherapy as well as combined targeted therapy (trametinib + ruxolitinib). Hence, HSCT was performed, and the patient has since been in complete remission for over a year. This observation highlights the importance of molecular techniques for determining the united nature of complex SET::NUP214-positive malignant neoplasms arising from precursor cells with high lineage plasticity.

1. Introduction

Acute myeloid leukemia (AML) is a heterogeneous group of neoplasms originating from transformed hematopoietic stem cells (HSCs) or more committed myeloid progenitors. It is classified according to the disease’s molecular genetics and the lineages involved in oncogenesis. In children, AML accounts for approximately 20% of acute leukemia cases [1]. In general, children with AML have worse prognoses than those with acute lymphoblastic leukemia, though overall survival has improved significantly over the last 30 years [2].
Peripheral T-cell lymphoma (PTCL) is a heterogeneous group of non-Hodgkin’s lymphomas (NHLs). PTCL accounts for 5% to 15% of NHL cases [3,4]. It develops from post-thymic T and natural killer (NK) cells due to dysregulation of TCR-related, costimulatory, and cytokine signaling pathways [5,6]. The 5th edition of the World Health Organization Classification of Hematolymphoid Tumors includes nine groups of mature T- and NK-cell neoplasms based on their cell of origin/differentiation stage, clinical scenario, primary disease localization, and cytomorphology, among which anaplastic large cell lymphoma (ALCL), nodal lymphoma of follicular-helper T-cell (TFH) origin, and peripheral T-cell lymphoma, not otherwise specified (PTCL-NOS) are the three most common subtypes [7]. Mature T-/NK-cell lymphoid proliferations and lymphomas have aggressive clinical courses and inferior outcomes [4].
Thus, AML and PTCL are diverse malignant neoplasms that arise from two distinct lineages and have distinct cytogenetic properties, cellular phenotypes, and leukemogenic events. They can occur in one patient but usually in the scenario of therapy-related acute leukemia in NHL survivors [8,9,10]. In contrast, the simultaneous development of AML and lymphoma in patients without prior exposure to chemotherapy, radiotherapy, or hematopoietic stem cell transplantation is a rare event. Single cases have been described for NHL occurring concurrently with either AML, chronic myeloid leukemia, or PDGFRB-positive hypereosinophilia; despite their different morphological and immunophenotypic natures, the common origin of cells in the bone marrow (BM) and lymph node was shown, but only in approximately half of cases [11,12,13,14]. The molecular background of such events is poorly understood but is of great fundamental interest. In the current study, we describe a case of SET::NUP214-positive malignant neoplasm in a pediatric patient presenting in a form of simultaneous occurrence of AML and PTCL and verify the common nature of cells in the BM and lymph node using several molecular techniques.

2. Results

2.1. Case Description

A 4-year-old boy was admitted to the hospital with enlargement of neck lymph nodes, snoring, nose breathing difficulty, sweating, weight loss, and frequent respiratory infections. Physical examination revealed massive lymphoproliferative syndrome with hypertrophy of adenoid tissue and tonsils, generalized lymphadenopathy, and hepatosplenomegaly.
Blood testing showed a white blood cell (WBC) count of 22.9 × 109/L, platelet count of 131 × 109/L, and hemoglobin level of 10.2 g/L. A blood differential analysis revealed 15% blasts, 18% segmented neutrophils, 46% lymphocytes, and 21% monocytes. Lactate dehydrogenase was increased to 551 U/l.

2.1.1. BM Aspirate Examination

A myelogram revealed 23% anaplastic blast cells (Figure 1a) positive for myeloperoxidase (MPO) (Figure 1b) and Sudan Black (Figure 1c), with a weakly diffuse periodic acid–Schiff (PAS) reaction in some blast cells (Figure 1d). Nonspecific esterase was negative in most blast cells (Figure 1e). This pattern was consistent with acute myelomonocytic leukemia. The cerebrospinal fluid was intact.
However, BM immunophenotyping revealed a relatively complicated cell distribution. In addition to mature neutrophils (CD66b+), B-lymphocytes (CD19+CD45bright), T-lymphocytes (CD3+CD45highTCRαβ+), and NK cells (CD56+CD45bright), there were several cell populations that warranted focused attention (Figure 2). Early myeloid blasts (2.5% of nucleated cells (NCs)) with CD45dim expression were also characterized by bright CD7, heterogeneous CD33, CD34, and CD117 positivity, and expression of CD2, CD5, CD99, HLA-DR, and CD15. Based on the lymphoid coexpression and general immunophenotypic patterns, the cells were recognized as definitely leukemic. In addition, granulocytic maturation was found to arise from these blasts. At the same time, lymphoid and monocytic compartments also did not appear to be definitely normal although they lacked clear immunophenotypic aberrations (Figure 2). Thirty-four percent of NCs belonged to different stages of monocytic differentiation and were clearly ascribable to immature and mature fractions, as deemed by CD14 expression (Figure 2). In addition to the high proportion of monocytic cells in the BM, partial CD7dim expression in the more immature part of the population was considered a feature of the leukemic origin of this compartment. Additionally, two populations of γδ-T cells were detected (Figure 2). The first population demonstrated high expression of surface CD3, CD5, CD7, and CD2. As expected, these cells were CD4/CD8-negative and displayed high expression of γδ-type TCR. These lymphocytes comprised 11% of NCs and were considered normal. The second population (3.5% of NCs) expressed all T-lineage markers (CD7, CD2, CD5, CD3, TCRγδ) at lower levels than “normal” γδ-T lymphocytes. These cells also had CD45dim and CD99high expression; they were CD4/8-negative and CD48-negative. Although the two described populations of γδ-T cells did not have distinct borders on dot plots (Figure 2), they were considered different (first—normal, second—leukemic) and were isolated separately using flow cell sorting. Simultaneously, immature and mature monocytes were sorted for further molecular investigation.

2.1.2. BM Trephine Biopsy

A BM trephine biopsy showed that intertrabecular spaces were uniformly filled with hypercellular hematopoietic tissue. The cellular component was represented mainly by immature elements of granulopoiesis, a large number of promyelocytes, and myeloblasts located predominantly in the centers of intertrabecular spaces, as determined by MPO expression. The erythropoietic lineage was represented by single spectrin- and glycophorin-positive cells not forming erythron islets. Megakaryocytes were represented by small cells and megakaryoblasts that expressed CD61. Lymphoid clusters positive for CD3, weakly and irregularly positive for CD5 and CD2, and negative for CD20/Pax5, TdT, and CD30 were present. A small number of CD8-positive cells were also found.

2.1.3. Lymph Node Examination

The patient underwent biopsy of a cervical lymph node. The morphological data showed a complete loss of topographic structure of the lymphoid tissue of the lymph node due to a monomorphic population of moderately atypical medium-sized lymphocytes infiltration (Figure 3a,b). Mitotic activity was low. On immunohistochemical examination, the infiltrating cells were represented by two populations—CD3+/CD7+/CD5+ lymphocytes, with weak and uneven CD2 expression, negative for CD8, CD4, PAX5, TdT, CD68, CD14, CD56, and CD163, consistent with the diagnosis of peripheral T-cell lymphoma (Figure 3d), and MPO-positive cells (Figure 3c).
Considering the morphological, cytochemical, and immunological data, the coexistence of two neoplastic populations was suggested, as represented by a peripheral T-cell lymphoma, not otherwise specified, and an acute myelomonocytic leukemia. The diagnostic examinations are summarized in Table 1.

2.2. Cytogenetic and Molecular Findings

The BM aspirate was subjected to cytogenetic and FISH analyses. G-banded chromosome analysis revealed an abnormal male karyotype 46,XY,t(3;11)(q21;q23)/46,XY (Figure 4). FISH analysis was negative for KMT2A, PDGFRB, ETV6, FGFR1, JAK2, IGH, BCL6, and PDGFRA rearrangements. T(9;22)(q34;q11)/BCR::ABL1 and ATM loss were not found. The FISH results are summarized in Table A1.
Sanger sequencing of the BM aspirate revealed a pathogenic CBL mutation (c.1186T>C NM_005188.3, p.Cys396Arg NP_005179.2). The mutation was also found in the lymph node biopsy material but was absent in DNA isolated from the nails, which confirmed its somatic status (Figure 5).
The targeted next-generation sequencing (NGS) approach did not reveal any mutations in genes associated with immunodeficiencies. However, deletions at 3q13.11 and 11q14.2 were found (210.412 kb and 2.091 Mb, respectively). Targeted NGS also detected a 9q34.12-13 deletion (2.270 Mb).
Based on whole-transcriptome analysis, no fusion transcripts corresponding to the t(3;11)(q21;q23) translocation were found. However, the SET::NUP214 chimeric transcript was detected (Figure 6a), which is in line with the 9q34 deletion found using DNA-based NGS. The SET::NUP214 fusion transcript was confirmed via direct Sanger sequencing of the BM sample (Figure 6b). The SET::NUP214 fusion gene was also amplified using direct genomic DNA PCR (for primers, see Table A2) and validated using amplicon NGS (Table A3). A patient-specific primer pair was designed for the DNA breakpoint junction region (Table A2) and used for detection using the lymph node biopsy material and isolated BM population DNA. The SET::NUP214 fusion gene was detected in both the lymph node and BM aspirate, as well as in all BM flow-sorted cell populations, but it was absent in the nail DNA (Figure A1).
For further confirmation, NUP214 status was assessed using break-apart FISH which revealed 5′-partial deletion in 90% of BM nuclei (Figure 6c), confirming SET::NUP214 fusion formation due to del(9)(q34.11q34.13) interstitial deletion.

2.3. TCR/BCR Repertoire

The spectrum of TCR/BCR loci rearrangements was assessed in whole BM, lymph node biopsy samples, and isolated BM populations. Major detected clonal rearrangements (VAF > 5% in the BM) included three TRB DJ-junctions, two TRD VDJ-junctions, and one nonfunctional IGH DJ-junction (Table A3). According to the distribution of TRB clonal rearrangements in single cells, one of the alleles of the TRB locus simultaneously exhibited two rearrangements, which was rather nontrivial (Figure A2). All rearrangements were present in each analyzed sample, indicating their common origin. However, some variations were observed in fractions of the detected rearrangements between the samples (Figure 7).
Considering the molecular findings, the final World Health Organization (WHO) diagnosis of a peripheral T-cell lymphoma, not otherwise specified, and an acute myeloid leukemia with other defined genetic alterations was made.

2.4. Treatment and Outcome

Considering the massive lymphoproliferative syndrome and high risk of upper respiratory tract obstruction, cytoreduction with prednisolone 30 mg/m2/day (1 day) and 60 mg/m2/day (2–4 days) was initiated, followed by CHOP chemotherapy: prednisolone 100 mg/m2/day (1–5 days), vincristine 1.5 mg/m2 (1 day), cyclophosphamide 750 mg/m2 (1 day), and doxorubicin 50 mg/m2 (1 day). Improved speech and nasal breathing were noted as well as decreased hepatosplenomegaly and lymphadenopathy.
On Day 12 after CHOP, rapid inguinal lymph node enlargement and hepatomegaly were again noted, and lactate dehydrogenase levels increased. Therefore, high-dose chemotherapy potentially active against both lymphoid and myelomonocytic lineages was initiated: dexamethasone 20 mg/m2/day (1–4 days), cytarabine 1000 mg/m2 twice a day (1–2 days), cisplatin 100 mg/m2/day (1 day), and etoposide 150 mg/m2/day (1–2 days). The patient tolerated the chemotherapy well. After the block, a decrease in leukocytosis and monocytosis, as well as a decrease in the number of blast cells, was observed in the peripheral blood. There were no control BM punctures, as lymphadenopathy and hepatomegaly persisted.
The patient was scheduled for hematopoietic stem cell transplantation (HSCT) as the only possible treatment option for the underlying disease. Given the ineffectiveness of standard high-dose chemotherapy and CBL mutation presence, combined targeted therapy was started on Day 46 after diagnosis (trametinib 0.25 mg/day + ruxolitinib 15 mg/day) in an attempt to target the hyperactivated pathways normally inhibited by CBL and to reduce the tumor mass before HSCT. However, no response was achieved, and on Day 13, peripheral lymph node enlargement and hepatosplenomegaly worsened, hyperleukocytosis with blast cells appeared, and lactate dehydrogenase increased.
Thus, salvage therapy was initiated with fludarabine 30 mg/m2/day (1–5 days), high dose cytarabine 2000 mg/m2/day (1–5 days), and idarubicin 10 mg/m2/day (1–2 days). This chemotherapy was well tolerated, and a significant reduction in the size of the tonsils and lymphadenopathy (clinically and radiologically) was achieved. Blasts disappeared from the peripheral blood, but hepatosplenomegaly persisted.
On Day 74 after diagnosis, the patient underwent allogeneic HSCT with TCR αβ/CD19 depletion from a haploidentical mother after conditioning, comprising total marrow and lymphoid irradiation and melphalan. The post-transplant period was uneventful, engraftment occurred on day +14, and complete remission was achieved. On Day 180 after HSCT, no lymphadenopathy or organomegaly persisted according to CT scans (Figure 8). The patient has remained in CR for 16 months after HSCT.

3. Discussion

As a general rule, AML and lymphoma arise from different malignant progenitors and rarely occur simultaneously. There have been many reports of therapy-related AML after previous exposure to cytotoxic drugs or radiotherapy used in the treatment of other malignancies or autoimmune disorders; the incidence of therapy-related AML in patients with breast cancer, non-Hodgkin’s lymphomas, and Hodgkin’s lymphoma is noticeable [15,16,17]. In addition to previous toxic therapeutic or environmental exposure, specific inherited conditions such as Li-Fraumeni and BRCA syndromes may result in the co-occurrence of several tumors in one patient in the form of multiple primary tumors. However, acute leukemias are uncommon in multiple-primary-tumor patients [6], and concurrent hematologic malignancies are extremely rare [11]. Here, we present a case of simultaneous PTCL and acute myelomonocytic leukemia.
The patient presented with lymphoproliferative syndrome, hyperleukocytosis with monocytosis and peripheral blastosis, and increased lactate dehydrogenase levels. Autoimmune lymphoproliferative syndrome (ALPS), transformed juvenile myelomonocytic leukemia (JMML), AML, and peripheral T-cell lymphoma were considered in the differential diagnosis.
As lymphoproliferation was the leading symptom, the primary diagnostic search began with ALPS. ALPS is a disease characterized by immune dysregulation caused by an inability to regulate lymphocyte homeostasis via abnormalities in lymphocyte apoptosis or programmed cell death. This deficiency causes a lymphoproliferative disease with clinical manifestations such as lymphadenopathy, hepatomegaly, splenomegaly, an increased risk of lymphoma, and autoimmune diseases (typically involving hematopoietic cell lines). ALPS is characterized by an increase in TCRα/β+CD4−CD8− cells in the peripheral blood and tissues [18]. Despite the clinical presentation of lymphadenopathy and hepatosplenomegaly, double-negative T lymphocytes were at normal levels, and the diagnosis of ALPS was excluded.
JMML is a rare aggressive childhood myeloid tumor affecting 1.2 people per million [19,20] and exhibiting various clinical signs. It typically affects infants and young children and presents with fever, splenomegaly, a high WBC count, and peripheral monocytosis, though these nonspecific symptoms can all be due to bacterial or viral infections [21]. Another typical JMML sign is an increase in fetal hemoglobin synthesis. Deregulation of the intracellular Ras signal transduction pathway, which is induced in >90% of patients by mutations in one (or, rarely, more than one) of five primordial genes (PTPN11, NRAS, KRAS, NF1, or CBL), is the shared molecular characteristic of JMML [22]. Our patient carried a somatic CBL mutation (NM_005188.3 c.1186T>C) described once previously as germline pathogenic in JMML and Noonan-like syndrome [23]. However, only germline CBL mutations are listed in the WHO 2016 JMML criteria [24], and the vast majority of described somatic CBL mutations in JMML are homozygous due to acquired uniparental disomy [25], which was excluded in our case. In addition, no fetal hemoglobin increase was detected. Therefore, the diagnosis of JMML was excluded as well. Although T-cell neoplasms have been described in patients with JMML, a concomitant presentation would be extremely unusual [26].
The diagnosis of AML was supported by the morphological and cytochemical assessment of BM smears [27,28,29]. MPO was positive in 17% and Sudan black staining in 27% of blast cells. This morphological and cytochemical pattern was consistent with the diagnosis of acute myelomonocytic leukemia. However, the results of BM immunophenotyping did not correlate with those of cytomorphology. Although myeloid blasts were detected using flow cytometry, several other tumor populations were found. Two subpopulations of mature γδ-T lymphocytes with different immunophenotypes were present, one of which was considered leukemic by its antigen expression profile. However, the same molecular aberrations were demonstrated in both sorted γδ-T subpopulations, confirming that they belonged to one malignant clone. Similarly, morphologically normal granulocytes and monocytes clearly originated from leukemic myeloid progenitors, and according to clonality studies, they shared the same progenitor with γδ-T cells. Although myeloid blasts had several immunophenotypic aberrations, maturing and mature myeloid cells had very slight immunophenotypic deviations. Nevertheless, a direct link between myeloid and T-lineage compartments in the BM was clearly visible (Figure 9).
The RNA sequencing data revealed a SET::NUP214 rearrangement, which occurred due to 9q34 deletion, and that was also visible in the targeted DNA NGS data. The NUP214 gene is located in the 9q34.13 chromosomal region. It contains 37 exons and spans 109,078 bp. Its longest transcript is 7568 bp long and encodes a protein consisting of 2090 amino acids. NUP214 belongs to a family of nucleoporins, proteins that form a nuclear pore complex (NPC) for the selective transfer of molecules between the nucleus and the cytoplasm [30]. NUP214 consists of an N-terminal β-propeller domain, a central domain containing two helical motifs responsible for interaction with other nucleoporins and anchoring of the protein in the NPC, and a C-terminal domain containing multiple nuclear transport receptor binding sites [31,32]. NUP214 shows high affinity for the nuclear export receptor CRM1, thus mediating the export of various cargo through the NPC. Wild-type NUP214 deficiency leads to a significant decrease in the efficiency of nuclear proteins and mRNA export [33,34].
Several chromosomal rearrangements involving the NUP214 gene have been found in hematological malignancies; the most studied is t(6;9)(p23;q34)/DEK::NUP214 in AML [35], followed by NUP214::ABL1 in T-ALL [36,37,38,39,40], BCP-ALL [41,42,43], and AML [44], and t(9;9)(q34.11;q32.13)/del(9)(q34.11q32.13)/SET::NUP214 in acute undifferentiated leukemia [45,46], T-ALL [47,48,49], AML [48,50], MPAL [51], and CML [52]. The latter rearrangement was also extensively studied in vitro in various hematopoietic and leukemia-derived cell lines [48,53].
SET::NUP214 is a rarer NUP214 gene rearrangement [37]. The SET gene encodes a multifunctional protein involved in apoptosis, transcription, nucleosome assembly, and histone binding. In eukaryotic cells, SET is expressed in two isoforms, TAF1-α and TAF1-β, which are generated by alternative splicing. Structurally, SET/TAF1-β consists of an N-terminal dimerization domain, a central “headphone”-like domain, and a negatively charged C-terminal acidic domain [54,55]. Both SET isoforms, together with the acid nuclear phosphoprotein pp32, constitute an acetyltransferase inhibitor complex (INHAT) that inhibits p300/CBP-mediated histone acetylation via a mechanism called histone masking. The INHAT SET requires both a “headphone”-like and an acid domain for activity [56]. In addition, SET/TAF1-β can regulate the acetylation of nonhistone proteins independently of the INHAT complex, binding directly to transcription factors such as p53 [57], FOXO1 [58], and the ligand-activated transcription factor glucocorticoid receptor (GR) and negatively regulating their activity [59]. Furthermore, SET suppresses p53-mediated transactivation by inhibiting p300/CBP-dependent H3K18 and H3K27 acetylation, thus blocking both p53-mediated cell-cycle arrest and apoptosis in response to cellular stress [60].
SET::NUP214 retains most of the SET coding sequence fused to the NUP214 3′-portion. In our patient, SET exon 7 was fused to NUP214 exon 18, which is in line with most previously described cases [47,49,50]. Thus, SET-NUP214 exhibits transforming activity via the disruption of both SET and NUP214 functions. First, SET-NUP214 does not interact with GR. Therefore, GR transcriptional activity is not initiated upon glucocorticoid signaling in SET::NUP214-positive cells [59], which contributes to resistance to glucocorticoid treatment [59,61,62]. Second, SET-NUP214 interferes with chromatin relaxation by inhibiting p300 histone acetyltransferases (HATs), CREB-binding protein (p300/CBP), and p300/CBP-related factor (PCAF; also known as acetyltransferase 2B/KAT2B). The inhibitory activity of SET on HATs is mediated by its acidic domains, which are retained in SET-NUP214. Abnormal histone hypoacetylation can lead to silencing of genes important for hematopoietic differentiation [63,64]. Third, SET-NUP214 disorganizes nuclear export due to the presence of a large NUP214 portion similar to DEK-NUP214 [65]. Finally, SET-NUP214 and DEK-NUP214 contribute to the upregulation of HOX genes, namely HOXA6-10 and the entire HOXB cluster, except for HOXB7 and HOXB13. It is possible that SET-NUP214 recruits DOT1L to the promoter of HOX genes, which mediates mono-, di-, and trimethylation of histone 3 lysine 79 (H3K79) [47]. SET::NUP214 knockdown inhibits elevated HOXA expression and reduces cell proliferation in a T-ALL cell line [47].
Overall, the data reported to date suggest that SET::NUP214 is one of the earliest leukemogenic events [46,47]. As additional evidence for the early origin and high lineage plasticity of SET::NUP214-positive malignant cells, we confirmed the common nature of the cells in both lymph nodes and BM using three ways: FISH, PCR, and TCR clonality. To the best of our knowledge, this is the first case report of such a rare fusion gene with detailed evidence of the common nature of concomitant hematologic neoplasm [12]. Notably, 90% of the nuclei in the BM carried the 9q34 deletion, as shown by FISH (Figure 6c), though this high percentage of definitely tumorous cells was not revealed using other methods. Direct genomic DNA PCR also identified SET::NUP214 as a common chromosomal rearrangement in both AML and PTCL. This result suggests that, despite variable morphological, cytochemical, and immunological features, the tumor was indeed an integral cell mass sharing a common fusion gene, CBL pathogenic mutation, and common TCR clonal rearrangements. Differences in TCR fractions may indicate further clonal evolution within the tumor (Figure 7).

4. Materials and Methods

Diagnostic procedures included BM morphology and cytochemistry as well as lymph node biopsy and trephine biopsy.

4.1. Immunophenotyping

Analysis of the immunophenotype of BM-derived cells was performed using 10-color combinations of monoclonal antibodies (mAbs) according to the diagnostic standards of the Moscow–Berlin group, as described previously [66]. All samples were processed according to the manufacturer’s recommendations. At least 30,000 nucleated cells were collected for each sample using a 3-laser Navios (Beckman Coulter [BC], Indianapolis, IN, USA) flow cytometer. The EuroFlow guidelines for machine performance monitoring were used [67]. Flow-Check Pro Fluorospheres (BC) were used for daily cytometer optimization. The results were analyzed using Kaluza Analysis 2.1 software (BC).

4.2. Cell Sorting

Diagnostic samples were processed for cell sorting. Target populations were purified using a BD FACS Aria III flow sorter (Becton Dickinson [BD], San Jose, CA, USA) as described previously [68]. A nonfixative lysis agent (PharmLyse, BD) was used, and the cells were diluted in phosphate-buffered saline (Cell Wash, BD). The cells were sorted in ‘Purity’ mode and collected in Eppendorf tubes containing relevant buffer. A total of 3 to 5 million cells were sorted in duplicate for clonality using NGS.

4.3. Cytogenetics and Molecular Genetics

Cytogenetics included conventional GTG-banded karyotyping [69] and fluorescence in situ hybridization (FISH; Table A1). The karyotype and FISH results are described according to ISCN2020 nomenclature [70].
Total DNA and RNA from BM aspirates were extracted using an InnuPrep DNA/RNA Mini Kit (Analytik Jena AG, Jena, Germany). DNA was subjected to Sanger sequencing for KRAS, NRAS, PTPN11, and CBL mutations [22] and subsequently to targeted NGS. The panel used contains 514 genes associated with primary immunodeficiencies (Table S1). A DNA library was prepared using a hybridization-based target enrichment method using a custom probe panel (Roche, Indianapolis, IN, USA) according to the manufacturer’s protocol and sequenced using an Illumina NextSeq (Illumina, San Diego, CA, USA). The average depth of target region coverage was 149 reads per bp, and 99% of the bases had a target coverage of at least 30×. The sequence reads were mapped to the human genome reference sequence (GRCh38) [71] and processed using a proprietary bioinformatics data analysis pipeline consistent with international standards [72]. The pathogenicity and clinical significance of the identified variants were assessed in accordance with the criteria of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology [73].
RNA was subjected to whole-transcriptome sequencing (Nextera UltraII Directional RNA kit, NEB, Ipswich, MA, USA) using the Illumina NextSeq (Illumina) platform. The GRCh38 version of the human genome preformatted for alignment pipelines, including the hard-masked PAR regions on chromosome Y, was downloaded from NCBI [71]. Sequenced reads were aligned to the human genome using STAR (ver. 2.10.7b) [74]. Fusion transcripts were detected using Arriba (ver. 2.4.0) [75] and confirmed using Sanger sequencing. The fusion gene breakpoint region was amplified using Q5 DNA polymerase (NEB) and Illumina MiSeq (Illumina) sequenced after NEBNext Ultra II (NEB) library preparation. The direct genomic DNA PCR and RT–PCR primers are listed in Table A2.

4.4. TCR/BCR Repertoire

The repertoire of clonal TCR/BCR rearrangements was assessed as previously described [76]. Briefly, target enrichment was carried out in the first PCR step using a multiplex primer set for the V, D, and J segments of all rearranged TCR and BCR genes: TRA, TRB, TRG, TRD, IGH, IGK, and IGL (MiLaboratory LLC., Sunnyvale, CA, USA, https://milaboratories.com/kits, accessed on 10 February 2022). Each PCR (25 ul) contained a MiLaboratory primer mix, 100 ng of genomic DNA, six units of HS Taq polymerase in 1× Turbo buffer, and dNTPs (0.125 mol/L each) (Evrogen, Moscow, Russia). The amplification profile was as follows: 94 °C for 3 min (initial denaturation), 94 °C for 20 s, 56 °C for 90 s, and 72 °C for 40 s for 10 cycles, followed by 94 °C for 20 s and 72 °C for 90 s for 15 cycles, all at a ramp rate of 0.5 °C/s. The amplicons were cleaned using one volume of magnetic AmPure XP beads (Beckman Coulter), as directed by the manufacturer. Next, Illumina UDI primers were used in PCR to attach sample indices and adapters to the libraries. The final libraries were cleaned as previously described, pooled, and sequenced using a MiSeq (Illumina, USA) instrument (paired-end 150 nt reads). TCR and BCR rearrangement repertoires were extracted from the sequencing data and converted to the VDJtools format [77] using modified MiXCR software (ver. 4.1.2) [78]. The VDJtools package’s Correct function was used to correct amplification errors. iROAR software [79] was used to correct multiplex-specific quantitative biases. A frequency of 5% was used as the cutoff for identifying leukemic clone-specific rearrangements.

5. Conclusions

The combined data of the differential diagnostic search, cytogenetics, molecular genetics, morphology, clinical presentation, and laboratory tests in this study pointed to a concomitant myeloid and lymphoid malignant neoplasm (acute myeloid leukemia, M4 variant + peripheral T-cell lymphoma), which is an extremely rare event. However, an in-depth molecular study carried out on both lymph node biopsy and BM samples with sorted populations of T and myeloid cells revealed the presence of the SET::NUP214 fusion gene, CBL pathogenic mutation, and common TCR clonal repertoire in all analyzed samples, thus pointing to a common origin of tumor cells. Therefore, our data reveal significant plasticity of SET::NUP214-positive hematological neoplasms, with the ability of BM malignant progenitors to diverge and differentiate in different cellular microenvironments. Our observation emphasizes a leading role for molecular biology research in this unusual presentation of the disease.

Supplementary Materials

The supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms241914451/s1.

Author Contributions

Conceptualization, A.M. and E.Z.; methodology, A.M., T.S. and E.Z.; case management, T.S.; morphology, T.K. and D.A.; immunophenotyping and cell sorting, S.K., A.S. and A.P.; cytogenetics, A.K. (Anna Kazakova) and O.S.; molecular studies, Y.M., A.K. (Alexander Komkov), A.I., M.G., A.B. and E.Z.; software, R.A., E.R. and E.Z.; validation, Y.M. and E.Z.; formal analysis, R.A. and E.Z.; data curation, E.Z.; writing—original draft preparation, Y.M. and T.S.; writing—review and editing, E.Z. and Y.O.; supervision, A.M. and G.N.; project administration, E.Z.; funding acquisition, A.M. and G.N. All authors have read and agreed to the published version of the manuscript.

Funding

Cytogenetics and high-throughput sequencing assessment were supported by the “Nauka—detiam” charity foundation.

Institutional Review Board Statement

This study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Ethics Committee of Dmitry Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology (protocol code 11/2018, 20 November 2018).

Informed Consent Statement

Written informed consent for the diagnostic work-up was obtained from the legal guardians of the patient.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to privacy restrictions.

Acknowledgments

The authors thank all of the doctors, nurses, and laboratory personnel in participating institutions who were involved in the patient’s diagnostics, management, and monitoring. Authors thank Maria Dubrovina for cytochemistry images.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. FISH probes.
Table A1. FISH probes.
ProbeResult
Kreatech 1 MLLnuc ish 11q23 (MLL × 2) [200/200]
Vysis 2 LSI BCL6nuc ish 3q27 (BCL6 × 2) [100/100]
Kreatech 1 ON PDGFRBnuc ish 5q32 (3′PDGFRB con 5′PDGFRB × 2) [100/100]
Kreatech 1 ON ETV6nuc ish 12p13 (ETV6 × 2) [200]
Vysis 2 LSI 4q12nuc ish 4q12 (FIP1L1, LNX, PDGFRA × 2) [200]
Kreatech 1 ON FGFR1 (8p12) Breaknuc ish 8p12 (FGFR1 × 2) [200]
Kreatech 1 ON JAK2 (9p24) Breaknuc ish 9p24 (JAK2 × 2) [100/100]
Kreatech 1 ON IGHnuc ish 14q32 (IGH × 2) [200]
Vysis 2 ATM1/CEP11nuc ish 11q22 (ATM1 × 2), cen 11 (CEP11 × 2) [200]
Kreatech 1 ON BCR/ABL DF t(9;22)nuc ish 9q34 (ABL1 × 2), 22q11 (BCR × 2) [200/200]
Cytocell 3 NUP214 Breakapartnuc ish 9q34 (5’ NUP214 con 3’NUP214 × 1) (3’NUP214 × 1) (5’ NUP214 × 0) [90/100]
1 Leica Biosystems, Deer Park, IL, USA. 2 Abbott Molecular, Des Plaines, IL, USA. 3 Cytocell, Cambridge, UK.
Table A2. Primers.
Table A2. Primers.
Target GeneOrientationDNA/RNASequence 5′ → 3′Implementation
SETsenseDNATTAGACTTATCACCACCCAAGCDirect DNA-based PCR, sequenced using NGS (2526 bp)
NUP214antisenseDNAAAGACTCTGTCTCTAATAATGTATAC
SETsenseDNATGCTCAGTCGCCCTGTTCTTGDirect DNA-based PCR
(175 bp)
NUP214antisenseDNATCACTTGAGCCCGAGTTCGAGGC
5q-controlsenseDNAAAAAGAGCCTCAACGACTCCDirect DNA-based PCR, control (130 bp)
5q-controlantisenseDNACACACCAGGGAGGTGACA
SETsenseRNAATGCAGGTGCTGATGAGTTAGGRT-PCR
(189 bp)
NUP214antisenseRNATTCCCGATATGGATGATGAAGAAGG
Table A3. SET::NUP214 fusion gene sequence assembled from DNA-amplicon NGS data.
Table A3. SET::NUP214 fusion gene sequence assembled from DNA-amplicon NGS data.
Gene NameSequence, 5′-3′
SETTCTTGAGGTCTCTTTTCTCTACTCCATGGTTCTCAATTTATTTGGGGGGAAATACCTTG
SET::NUP214TCTTGAGGTCTCTTTTCTCTACTCCATGGTTCTGTTTTTTTTTTTGTTTTGTTTTGTTTTTT
NUP214GTCTACAAGTGTACGCTACCACGTTTAGCTCTGTTTTTTTTTTTGTTTTGTTTTGTTTTTT
Table A4. Major detected clonal rearrangements (VAF > 5% in the BM) of TCR and IGH loci.
Table A4. Major detected clonal rearrangements (VAF > 5% in the BM) of TCR and IGH loci.
VDJCDR3 Region Partial Sequence, 5’-3’
TRD1TRDV2TRDD3TRDJ1TGTGCCTGTGACACAGGGATACTCACACCGATAAACTCATCTTT
TRD2TRDV1TRDD3TRDJ1TGTGCTCTTGGGGAACTTCCCCCATTATCTCCTACCG
GGGCTGGGAAAGCCAACACCGATAAACTCATCTTT
TRB1-TRBD2TRBJ2-1GGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAA
CATTGTGGGGACTAGTCGAAATGAGCAGTTCTTCGGGCC
TRB2-TRBD2TRBJ2-2GGACTAGCAGGGAGGAAACATTTTTGTATCATGGTGTAACATTGTGGGG
ACTAGCGGGAACCGTCACGAACACCGGGGAGCTGTTTTTTGGAGA
TRB3-TRBD1TRBJ1-2CTGTTTTTGTACAAAGCTGTAACATTGTGGGGAC
AGGGATTTCCGGTGCGGCTACACCTTCGGTTC
IGH1-IGHD1-26IGHJ4GCCCCAGAGCTCAGGGCGCCTGGGTGGATTCTGAACAGCCCCGAGTCACG
GTGGGTATAGTGGGAGCTACCTACGGTTTTGACTACTGGGGCCA
Ijms 24 14451 g0a1
Figure A1. Direct genomic DNA PCR for SET::NUP214 fusion. BM—bone marrow aspirate, LN—lymph node biopsy. BM populations are as follows: B—early myeloid blasts (CD45+CD33+CD14+), Mo—maturing and mature monocytes (CD45+CD33+CD14+), γδ-T 1—immature γδ-T lymphocytes considered leukemic (CD45dimCD3dim), γδ-T2—more mature γδ-T lymphocytes considered normal (CD45highCD3high) (color-coded as in Figure 2). For primers, see Table A2.
Figure A1. Direct genomic DNA PCR for SET::NUP214 fusion. BM—bone marrow aspirate, LN—lymph node biopsy. BM populations are as follows: B—early myeloid blasts (CD45+CD33+CD14+), Mo—maturing and mature monocytes (CD45+CD33+CD14+), γδ-T 1—immature γδ-T lymphocytes considered leukemic (CD45dimCD3dim), γδ-T2—more mature γδ-T lymphocytes considered normal (CD45highCD3high) (color-coded as in Figure 2). For primers, see Table A2.
Ijms 24 14451 g0a1
Ijms 24 14451 g0a2
Figure A2. TRB locus rearrangements in the reported patient according to the distribution of clonal rearrangements in single cells—allele 1 simultaneously carries two DJ rearrangements (TRBD1-TRBJ1-2 and TRBD2-TRBJ2-2), allele 2 carries one DJ rearrangement (TRBD2-TRBJ2-1). V genes are in red, D genes are in blue, J genes are in green, C genes are in orange.
Figure A2. TRB locus rearrangements in the reported patient according to the distribution of clonal rearrangements in single cells—allele 1 simultaneously carries two DJ rearrangements (TRBD1-TRBJ1-2 and TRBD2-TRBJ2-2), allele 2 carries one DJ rearrangement (TRBD2-TRBJ2-1). V genes are in red, D genes are in blue, J genes are in green, C genes are in orange.
Ijms 24 14451 g0a2

References

  1. Siegel, R.L.; Miller, K.D.; Wagle, N.S.; Jemal, A. Cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 17–48. [Google Scholar] [CrossRef] [PubMed]
  2. Noone, A.M.; Howlader, N.; Krapcho, M.; Miller, D.; Brest, A.; Yu, M.; Ruhl, J.; Tatalovich, Z.; Mariotto, A.; Lewis, D.R.; et al. SEER Cancer Statistics Review, 1975–2015; National Cancer Institute: Bethesda, MD, USA, 2018. Available online: https://seer.cancer.gov/csr/1975_2015/ (accessed on 10 January 2023).
  3. Phan, A.; Veldman, R.; Lechowicz, M.J. T-cell Lymphoma Epidemiology: The Known and Unknown. Curr. Hematol. Malig. Rep. 2016, 11, 492–503. [Google Scholar] [CrossRef] [PubMed]
  4. Vose, J.; Armitage, J.; Weisenburger, D.; International, T.C.L.P. International peripheral T-cell and natural killer/T-cell lymphoma study: Pathology findings and clinical outcomes. J. Clin. Oncol. 2008, 26, 4124–4130. [Google Scholar] [CrossRef] [PubMed]
  5. Hathuc, V.; Kreisel, F. Genetic Landscape of Peripheral T-Cell Lymphoma. Life 2022, 12, 410. [Google Scholar] [CrossRef]
  6. Rodriguez, M.; Alonso-Alonso, R.; Tomas-Roca, L.; Rodriguez-Pinilla, S.M.; Manso-Alonso, R.; Cereceda, L.; Borregon, J.; Villaescusa, T.; Cordoba, R.; Sanchez-Beato, M.; et al. Peripheral T-cell lymphoma: Molecular profiling recognizes subclasses and identifies prognostic markers. Blood Adv. 2021, 5, 5588–5598. [Google Scholar] [CrossRef]
  7. Alaggio, R.; Amador, C.; Anagnostopoulos, I.; Attygalle, A.D.; Araujo, I.B.O.; Berti, E.; Bhagat, G.; Borges, A.M.; Boyer, D.; Calaminici, M.; et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Lymphoid Neoplasms. Leukemia 2022, 36, 1720–1748. [Google Scholar] [CrossRef]
  8. Lam, C.J.; Curtis, R.E.; Dores, G.M.; Engels, E.A.; Caporaso, N.E.; Polliack, A.; Warren, J.L.; Young, H.A.; Levine, P.H.; Elmi, A.F.; et al. Risk factors for second acute myeloid leukemia/myelodysplastic syndrome among survivors of non-Hodgkin lymphoma. Leukemia 2016, 30, 1187–1190. [Google Scholar] [CrossRef]
  9. Bhatt, V.R.; Giri, S.; Verma, V.; Dahal, S.; Shah, B.K.; Pathak, R.; Bociek, R.G.; Vose, J.M.; Armitage, J.O. Secondary acute myeloid leukemia in survivors of Hodgkin lymphoma. Future Oncol. 2016, 12, 1565–1575. [Google Scholar] [CrossRef]
  10. Eichenauer, D.A.; Thielen, I.; Haverkamp, H.; Franklin, J.; Behringer, K.; Halbsguth, T.; Klimm, B.; Diehl, V.; Sasse, S.; Rothe, A.; et al. Therapy-related acute myeloid leukemia and myelodysplastic syndromes in patients with Hodgkin lymphoma: A report from the German Hodgkin Study Group. Blood 2014, 123, 1658–1664. [Google Scholar] [CrossRef]
  11. Fu, X.; Shang, Y.; Zhang, L.; Li, L.; Li, X.; Wang, X.; Sun, Z.; Zhang, M. Analyses and treatment of simultaneous bi-lineage malignancies of myeloid leukemia and lymphoma: Two case reports and a literature review. Oncol. Lett. 2018, 16, 6624–6632. [Google Scholar] [CrossRef]
  12. Shen, Z.L.; Yin, L.F.; Mao, W.W.; Liang, J.; Yang, L. Philadelphia chromosome-negative non-Hodgkin’s lymphoma occurring in Philadelphia chromosome-positive chronic myeloid leukemia: A case report and literature review. Oncol. Lett. 2016, 11, 2909–2912. [Google Scholar] [CrossRef] [PubMed]
  13. Zamecnikova, A.; Vranovsky, A.; Hlavcak, P. Coexistence of Philadelphia-positive chronic granulocytic leukemia and diffuse large B-cell lymphoma at initial diagnosis. Leuk. Lymphoma 2002, 43, 429–431. [Google Scholar] [CrossRef] [PubMed]
  14. Zarrabi, M.H.; Rosner, F.; Bennett, J.M. Non-Hodgkin’s lymphoma and acute myeloblastic leukemia: A report of 12 cases and review of the literature. Cancer 1979, 44, 1070–1080. [Google Scholar] [CrossRef] [PubMed]
  15. Granfeldt Ostgard, L.S.; Medeiros, B.C.; Sengelov, H.; Norgaard, M.; Andersen, M.K.; Dufva, I.H.; Friis, L.S.; Kjeldsen, E.; Marcher, C.W.; Preiss, B.; et al. Epidemiology and Clinical Significance of Secondary and Therapy-Related Acute Myeloid Leukemia: A National Population-Based Cohort Study. J. Clin. Oncol. 2015, 33, 3641–3649. [Google Scholar] [CrossRef] [PubMed]
  16. Leone, G.; Mele, L.; Pulsoni, A.; Equitani, F.; Pagano, L. The incidence of secondary leukemias. Haematologica 1999, 84, 937–945. [Google Scholar] [PubMed]
  17. Smith, S.M.; Le Beau, M.M.; Huo, D.; Karrison, T.; Sobecks, R.M.; Anastasi, J.; Vardiman, J.W.; Rowley, J.D.; Larson, R.A. Clinical-cytogenetic associations in 306 patients with therapy-related myelodysplasia and myeloid leukemia: The University of Chicago series. Blood 2003, 102, 43–52. [Google Scholar] [CrossRef]
  18. Shah, S.; Wu, E.; Rao, V.K.; Tarrant, T.K. Autoimmune lymphoproliferative syndrome: An update and review of the literature. Curr. Allergy Asthma Rep. 2014, 14, 462. [Google Scholar] [CrossRef]
  19. Chan, R.J.; Cooper, T.; Kratz, C.P.; Weiss, B.; Loh, M.L. Juvenile myelomonocytic leukemia: A report from the 2nd International JMML Symposium. Leuk. Res. 2009, 33, 355–362. [Google Scholar] [CrossRef]
  20. Emanuel, P.D. Juvenile myelomonocytic leukemia. Curr. Hematol. Rep. 2004, 3, 203–209. [Google Scholar]
  21. Mayerhofer, C.; Niemeyer, C.M.; Flotho, C. Current Treatment of Juvenile Myelomonocytic Leukemia. J. Clin. Med. 2021, 10, 3084. [Google Scholar] [CrossRef]
  22. Niemeyer, C.M.; Flotho, C. Juvenile myelomonocytic leukemia: Who’s the driver at the wheel? Blood 2019, 133, 1060–1070. [Google Scholar] [CrossRef]
  23. Niemeyer, C.M.; Kang, M.; Furlan, I.; Shin, D.; Sakai, D.S.; Heinzmann, A.; Archambeault, S.; Finklestein, J.Z.; Mehta, P.; Albert, M.H.; et al. Germline Mutations in CBL Cause a Predisposition to Juvenile Myelomonocytic Leukemia. Blood 2009, 114, 310. [Google Scholar] [CrossRef]
  24. Arber, D.A.; Orazi, A.; Hasserjian, R.; Thiele, J.; Borowitz, M.J.; Le Beau, M.M.; Bloomfield, C.D.; Cazzola, M.; Vardiman, J.W. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016, 127, 2391–2405. [Google Scholar] [CrossRef] [PubMed]
  25. Loh, M.L.; Sakai, D.S.; Flotho, C.; Kang, M.; Fliegauf, M.; Archambeault, S.; Mullighan, C.G.; Chen, L.; Bergstraesser, E.; Bueso-Ramos, C.E.; et al. Mutations in CBL occur frequently in juvenile myelomonocytic leukemia. Blood 2009, 114, 1859–1863. [Google Scholar] [CrossRef]
  26. Maschan, A.A.; Khachatrian, L.A.; Solopova, G.G.; Ossipova, E.Y.; Baidun, L.V.; Dmitrieva, S.V.; Maschan, M.A.; Resnik, I.B. Development of T-cell acute lymphoblastic leukemia in a patient in very long lasting complete remission of juvenile myelomonocytic leukemia. J. Pediatr. Hematol. Oncol. 2011, 33, e32–e34. [Google Scholar] [CrossRef] [PubMed]
  27. Swerdlow, S.H.; Campo, E.; Harris, N.L.; Jaffe, E.S.; Pileri, S.A.; Stein, H.; Thiele, J. WHO Classification of Tumors of Haematopoietic and Lymphoid Tissues, 4th ed.; WHO: Geneva, Switzerland, 2016. [Google Scholar]
  28. Le Beau, M.M.; Larson, R.A.; Bitter, M.A.; Vardiman, J.W.; Golomb, H.M.; Rowley, J.D. Association of an inversion of chromosome 16 with abnormal marrow eosinophils in acute myelomonocytic leukemia. A unique cytogenetic-clinicopathological association. N. Engl. J. Med. 1983, 309, 630–636. [Google Scholar] [CrossRef]
  29. Bain, B.J.; Bene, M.C. Morphological and Immunophenotypic Clues to the WHO Categories of Acute Myeloid Leukaemia. Acta Haematol. 2019, 141, 232–244. [Google Scholar] [CrossRef]
  30. Mendes, A.; Fahrenkrog, B. NUP214 in Leukemia: It’s More than Transport. Cells 2019, 8, 76. [Google Scholar] [CrossRef]
  31. Napetschnig, J.; Blobel, G.; Hoelz, A. Crystal structure of the N-terminal domain of the human protooncogene Nup214/CAN. Proc. Natl. Acad. Sci. USA 2007, 104, 1783–1788. [Google Scholar] [CrossRef]
  32. Port, S.A.; Monecke, T.; Dickmanns, A.; Spillner, C.; Hofele, R.; Urlaub, H.; Ficner, R.; Kehlenbach, R.H. Structural and Functional Characterization of CRM1-Nup214 Interactions Reveals Multiple FG-Binding Sites Involved in Nuclear Export. Cell Rep. 2015, 13, 690–702. [Google Scholar] [CrossRef]
  33. Hutten, S.; Kehlenbach, R.H. Nup214 is required for CRM1-dependent nuclear protein export in vivo. Mol. Cell Biol. 2006, 26, 6772–6785. [Google Scholar] [CrossRef] [PubMed]
  34. Roloff, S.; Spillner, C.; Kehlenbach, R.H. Several phenylalanine-glycine motives in the nucleoporin Nup214 are essential for binding of the nuclear export receptor CRM1. J. Biol. Chem. 2013, 288, 3952–3963. [Google Scholar] [CrossRef] [PubMed]
  35. von Lindern, M.; Fornerod, M.; Soekarman, N.; van Baal, S.; Jaegle, M.; Hagemeijer, A.; Bootsma, D.; Grosveld, G. Translocation t(6;9) in acute non-lymphocytic leukaemia results in the formation of a DEK-CAN fusion gene. Baillieres Clin. Haematol. 1992, 5, 857–879. [Google Scholar] [CrossRef]
  36. Graux, C.; Cools, J.; Melotte, C.; Quentmeier, H.; Ferrando, A.; Levine, R.; Vermeesch, J.R.; Stul, M.; Dutta, B.; Boeckx, N.; et al. Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia. Nat. Genet. 2004, 36, 1084–1089. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, Y.; Easton, J.; Shao, Y.; Maciaszek, J.; Wang, Z.; Wilkinson, M.R.; McCastlain, K.; Edmonson, M.; Pounds, S.B.; Shi, L.; et al. The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic leukemia. Nat. Genet. 2017, 49, 1211–1218. [Google Scholar] [CrossRef] [PubMed]
  38. Papenhausen, P.; Kelly, C.A.; Zhang, Z.; Tepperberg, J.; Burnside, R.D.; Schwartz, S. Multidisciplinary analysis of pediatric T-ALL: 9q34 gene fusions. Cancer Genet. 2019, 231–232, 1–13. [Google Scholar] [CrossRef] [PubMed]
  39. Burmeister, T.; Gokbuget, N.; Reinhardt, R.; Rieder, H.; Hoelzer, D.; Schwartz, S. NUP214-ABL1 in adult T-ALL: The GMALL study group experience. Blood 2006, 108, 3556–3559. [Google Scholar] [CrossRef]
  40. Ballerini, P.; Busson, M.; Fasola, S.; van den Akker, J.; Lapillonne, H.; Romana, S.P.; Marynen, P.; Bernard, O.A.; Landman-Parker, J.; Berger, R. NUP214-ABL1 amplification in t(5;14)/HOX11L2-positive ALL present with several forms and may have a prognostic significance. Leukemia 2005, 19, 468–470. [Google Scholar] [CrossRef]
  41. Roberts, K.G.; Li, Y.; Payne-Turner, D.; Harvey, R.C.; Yang, Y.L.; Pei, D.; McCastlain, K.; Ding, L.; Lu, C.; Song, G.; et al. Targetable kinase-activating lesions in Ph-like acute lymphoblastic leukemia. N. Engl. J. Med. 2014, 371, 1005–1015. [Google Scholar] [CrossRef]
  42. Roberts, K.G.; Morin, R.D.; Zhang, J.; Hirst, M.; Zhao, Y.; Su, X.; Chen, S.C.; Payne-Turner, D.; Churchman, M.L.; Harvey, R.C.; et al. Genetic alterations activating kinase and cytokine receptor signaling in high-risk acute lymphoblastic leukemia. Cancer Cell 2012, 22, 153–166. [Google Scholar] [CrossRef]
  43. Liu, Y.F.; Wang, B.Y.; Zhang, W.N.; Huang, J.Y.; Li, B.S.; Zhang, M.; Jiang, L.; Li, J.F.; Wang, M.J.; Dai, Y.J.; et al. Genomic Profiling of Adult and Pediatric B-cell Acute Lymphoblastic Leukemia. EBioMedicine 2016, 8, 173–183. [Google Scholar] [CrossRef] [PubMed]
  44. Kim, B.; Kim, E.; Lee, S.T.; Cheong, J.W.; Lyu, C.J.; Min, Y.H.; Choi, J.R. Detection of recurrent, rare, and novel gene fusions in patients with acute leukemia using next-generation sequencing approaches. Hematol. Oncol. 2020, 38, 82–88. [Google Scholar] [CrossRef]
  45. von Lindern, M.; van Baal, S.; Wiegant, J.; Raap, A.; Hagemeijer, A.; Grosveld, G. Can, a putative oncogene associated with myeloid leukemogenesis, may be activated by fusion of its 3’ half to different genes: Characterization of the set gene. Mol. Cell Biol. 1992, 12, 3346–3355. [Google Scholar] [CrossRef] [PubMed]
  46. Kim, J.; Lee, S.G.; Song, J.; Kim, S.J.; Rha, S.Y.; Lee, K.A.; Park, T.S.; Choi, J.R. Molecular characterization of alternative SET-NUP214 fusion transcripts in a case of acute undifferentiated leukemia. Cancer Genet. Cytogenet. 2010, 201, 73–80. [Google Scholar] [CrossRef] [PubMed]
  47. Van Vlierberghe, P.; van Grotel, M.; Tchinda, J.; Lee, C.; Beverloo, H.B.; van der Spek, P.J.; Stubbs, A.; Cools, J.; Nagata, K.; Fornerod, M.; et al. The recurrent SET-NUP214 fusion as a new HOXA activation mechanism in pediatric T-cell acute lymphoblastic leukemia. Blood 2008, 111, 4668–4680. [Google Scholar] [CrossRef] [PubMed]
  48. Quentmeier, H.; Schneider, B.; Rohrs, S.; Romani, J.; Zaborski, M.; Macleod, R.A.; Drexler, H.G. SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines. J. Hematol. Oncol. 2009, 2, 3. [Google Scholar] [CrossRef]
  49. Gorello, P.; La Starza, R.; Varasano, E.; Chiaretti, S.; Elia, L.; Pierini, V.; Barba, G.; Brandimarte, L.; Crescenzi, B.; Vitale, A.; et al. Combined interphase fluorescence in situ hybridization elucidates the genetic heterogeneity of T-cell acute lymphoblastic leukemia in adults. Haematologica 2010, 95, 79–86. [Google Scholar] [CrossRef]
  50. Rosati, R.; La Starza, R.; Barba, G.; Gorello, P.; Pierini, V.; Matteucci, C.; Roti, G.; Crescenzi, B.; Aloisi, T.; Aversa, F.; et al. Cryptic chromosome 9q34 deletion generates TAF-Ialpha/CAN and TAF-Ibeta/CAN fusion transcripts in acute myeloid leukemia. Haematologica 2007, 92, 232–235. [Google Scholar] [CrossRef]
  51. Li, W.J.; Cui, L.; Gao, C.; Zhao, X.X.; Liu, S.G.; Xing, Y.P.; Zhang, R.D.; Zhang, D.W.; Wang, B.; Li, Z.G.; et al. MRD analysis and treatment outcome in three children with SET-NUP214-positive hematological malignancies. Int. J. Lab. Hematol. 2011, 33, e25–e27. [Google Scholar] [CrossRef]
  52. Chen, Y.; Wang, Q.; Cen, J.; Xu, C.; Tao, T.T.; Xie, J.; Shen, W.; Gong, Y.; Pan, J.; Yao, L. Blast phase of chronic myeloid leukemia with concurrent BCR::ABL1 and SET::NUP214: A report of two cases. Mol. Carcinog. 2023, 62, 117–121. [Google Scholar] [CrossRef]
  53. Kandilci, A.; Mientjes, E.; Grosveld, G. Effects of SET and SET-CAN on the differentiation of the human promonocytic cell line U937. Leukemia 2004, 18, 337–340. [Google Scholar] [CrossRef] [PubMed]
  54. Li, M.; Makkinje, A.; Damuni, Z. The myeloid leukemia-associated protein SET is a potent inhibitor of protein phosphatase 2A. J. Biol. Chem. 1996, 271, 11059–11062. [Google Scholar] [CrossRef] [PubMed]
  55. Muto, S.; Senda, M.; Akai, Y.; Sato, L.; Suzuki, T.; Nagai, R.; Senda, T.; Horikoshi, M. Relationship between the structure of SET/TAF-Ibeta/INHAT and its histone chaperone activity. Proc. Natl. Acad. Sci. USA 2007, 104, 4285–4290. [Google Scholar] [CrossRef] [PubMed]
  56. Seo, S.B.; McNamara, P.; Heo, S.; Turner, A.; Lane, W.S.; Chakravarti, D. Regulation of histone acetylation and transcription by INHAT, a human cellular complex containing the set oncoprotein. Cell 2001, 104, 119–130. [Google Scholar] [CrossRef] [PubMed]
  57. Wang, D.; Kon, N.; Lasso, G.; Jiang, L.; Leng, W.; Zhu, W.G.; Qin, J.; Honig, B.; Gu, W. Acetylation-regulated interaction between p53 and SET reveals a widespread regulatory mode. Nature 2016, 538, 118–122. [Google Scholar] [CrossRef]
  58. Chae, Y.C.; Kim, K.B.; Kang, J.Y.; Kim, S.R.; Jung, H.S.; Seo, S.B. Inhibition of FoxO1 acetylation by INHAT subunit SET/TAF-Ibeta induces p21 transcription. FEBS Lett. 2014, 588, 2867–2873. [Google Scholar] [CrossRef]
  59. Ichijo, T.; Chrousos, G.P.; Kino, T. Activated glucocorticoid receptor interacts with the INHAT component Set/TAF-Ibeta and releases it from a glucocorticoid-responsive gene promoter, relieving repression: Implications for the pathogenesis of glucocorticoid resistance in acute undifferentiated leukemia with Set-Can translocation. Mol. Cell Endocrinol. 2008, 283, 19–31. [Google Scholar] [CrossRef]
  60. Kim, J.Y.; Lee, K.S.; Seol, J.E.; Yu, K.; Chakravarti, D.; Seo, S.B. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Ibeta represses p53 activity. Nucleic Acids Res. 2012, 40, 75–87. [Google Scholar] [CrossRef]
  61. Ben Abdelali, R.; Roggy, A.; Leguay, T.; Cieslak, A.; Renneville, A.; Touzart, A.; Banos, A.; Randriamalala, E.; Caillot, D.; Lioure, B.; et al. SET-NUP214 is a recurrent gammadelta lineage-specific fusion transcript associated with corticosteroid/chemotherapy resistance in adult T-ALL. Blood 2014, 123, 1860–1863. [Google Scholar] [CrossRef]
  62. Xu, X.; Zhai, Q.; Jin, H.; Yu, Y.; Han, D.; Zhang, H.; Fu, K.; Meng, B. SET-NUP214 Fusion Gene Involved Early T-Cell Precursor Acute Lymphoblastic Leukemia in Adult with B Marker Expression. Int. J. Gen. Med. 2021, 14, 659–664. [Google Scholar] [CrossRef]
  63. Almeida, L.O.; Neto, M.P.C.; Sousa, L.O.; Tannous, M.A.; Curti, C.; Leopoldino, A.M. SET oncoprotein accumulation regulates transcription through DNA demethylation and histone hypoacetylation. Oncotarget 2017, 8, 26802–26818. [Google Scholar] [CrossRef] [PubMed]
  64. Shvedunova, M.; Akhtar, A. Modulation of cellular processes by histone and non-histone protein acetylation. Nat. Rev. Mol. Cell Biol. 2022, 23, 329–349. [Google Scholar] [CrossRef] [PubMed]
  65. Saito, S.; Miyaji-Yamaguchi, M.; Nagata, K. Aberrant intracellular localization of SET-CAN fusion protein, associated with a leukemia, disorganizes nuclear export. Int. J. Cancer 2004, 111, 501–507. [Google Scholar] [CrossRef] [PubMed]
  66. Popov, A.M.; Verzhbitskaya, T.Y.; Movchan, L.V.; Demina, I.A.; Mikhailova, E.V.; Semchenkova, A.A.; Permikin, Z.V.; Shman, T.V.; Karachunskiy, A.I.; Novichkova, G.A. Flow cytometry in acute leukemia diagnostics. Guidelines of Russian-Belarusian multicenter group for pediatric leukemia studies. Pediatr. Hematol./Oncol. Immunopathol. 2023, 22, 165–177. (In Russian) [Google Scholar] [CrossRef]
  67. Kalina, T.; Flores-Montero, J.; Lecrevisse, Q.; Pedreira, C.E.; van der Velden, V.H.; Novakova, M.; Mejstrikova, E.; Hrusak, O.; Bottcher, S.; Karsch, D.; et al. Quality assessment program for EuroFlow protocols: Summary results of four-year (2010–2013) quality assurance rounds. Cytometry A 2015, 87, 145–156. [Google Scholar] [CrossRef]
  68. Semchenkova, A.; Zerkalenkova, E.; Demina, I.; Kashpor, S.; Volchkov, E.; Zakharova, E.; Larin, S.; Olshanskaya, Y.; Novichkova, G.; Maschan, A.; et al. Recognizing Minor Leukemic Populations with Monocytic Features in Mixed-Phenotype Acute Leukemia by Flow Cell Sorting Followed by Cytogenetic and Molecular Studies: Report of Five Exemplary Cases. Int. J. Mol. Sci. 2023, 24, 5260. [Google Scholar] [CrossRef]
  69. den Nijs, J.I.; Gonggrijp, H.S.; Augustinus, E.; Leeksma, C.H. Hot bands: A simple G-banding method for leukemic metaphases. Cancer Genet. Cytogenet. 1985, 15, 373–374. [Google Scholar] [CrossRef]
  70. McGowan-Jordan, J.; Hastings, R.J.; Moore, S. (Eds.) ISCN 2020 An International System for Human Cytogenomic Nomenclature; Karger Publishers: Basel, Switzerland, 2020. [Google Scholar]
  71. GRCh38 UCSC AnalysisSet Files. 2014. Available online: https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/ (accessed on 10 January 2023).
  72. GATK Team. GermlineCNVCaller, version 4.1.5.0. 2020. Available online: https://gatk.broadinstitute.org/hc/en-us/articles/360040097712-GermlineCNVCaller (accessed on 10 January 2023).
  73. Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef]
  74. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
  75. Uhrig, S.; Ellermann, J.; Walther, T.; Burkhardt, P.; Frohlich, M.; Hutter, B.; Toprak, U.H.; Neumann, O.; Stenzinger, A.; Scholl, C.; et al. Accurate and efficient detection of gene fusions from RNA sequencing data. Genome Res. 2021, 31, 448–460. [Google Scholar] [CrossRef]
  76. Komkov, A.; Miroshnichenkova, A.; Nugmanov, G.; Popov, A.; Pogorelyy, M.; Zapletalova, E.; Jelinkova, H.; Pospisilova, S.; Lebedev, Y.; Chudakov, D.; et al. High-throughput sequencing of T-cell receptor alpha chain clonal rearrangements at the DNA level in lymphoid malignancies. Br. J. Haematol. 2020, 188, 723–731. [Google Scholar] [CrossRef] [PubMed]
  77. Shugay, M.; Bagaev, D.V.; Turchaninova, M.A.; Bolotin, D.A.; Britanova, O.V.; Putintseva, E.V.; Pogorelyy, M.V.; Nazarov, V.I.; Zvyagin, I.V.; Kirgizova, V.I.; et al. VDJtools: Unifying Post-analysis of T Cell Receptor Repertoires. PLoS Comput. Biol. 2015, 11, e1004503. [Google Scholar] [CrossRef] [PubMed]
  78. Bolotin, D.A.; Poslavsky, S.; Mitrophanov, I.; Shugay, M.; Mamedov, I.Z.; Putintseva, E.V.; Chudakov, D.M. MiXCR: Software for comprehensive adaptive immunity profiling. Nat. Methods 2015, 12, 380–381. [Google Scholar] [CrossRef] [PubMed]
  79. Smirnova, A.O.; Miroshnichenkova, A.M.; Olshanskaya, Y.V.; Maschan, M.A.; Lebedev, Y.B.; Chudakov, D.M.; Mamedov, I.Z.; Komkov, A. The use of non-functional clonotypes as a natural calibrator for quantitative bias correction in adaptive immune receptor repertoire profiling. eLife 2023, 12, e69157. [Google Scholar] [CrossRef]
Ijms 24 14451 g001
Figure 1. Bone marrow (BM) morphological examination with Romanowsky–Giemsa staining (a) and cytochemical examination for MPO (b), lipids (Sudan black staining) (c), glycogen (PAS reaction) (d) and non-specific esterase (e). Identified cells are marked as follows: B—blast, E—eosinophil, L—lymphocyte, Me—metamyelocyte, Mo—monocyte, My—myelocyte, N—neutrophil, P—promonocyte, 100× magnification.
Figure 1. Bone marrow (BM) morphological examination with Romanowsky–Giemsa staining (a) and cytochemical examination for MPO (b), lipids (Sudan black staining) (c), glycogen (PAS reaction) (d) and non-specific esterase (e). Identified cells are marked as follows: B—blast, E—eosinophil, L—lymphocyte, Me—metamyelocyte, Mo—monocyte, My—myelocyte, N—neutrophil, P—promonocyte, 100× magnification.
Ijms 24 14451 g001
Ijms 24 14451 g002
Figure 2. Immunophenotypic description of the bone marrow (BM). A BM overview is presented in the “gray” panel; a brief description of early myeloid blasts is presented in the “red” panel; two populations of γδ-T lymphocytes are shown in blue and violet, while maturation of monocytic cells is shown in orange.
Figure 2. Immunophenotypic description of the bone marrow (BM). A BM overview is presented in the “gray” panel; a brief description of early myeloid blasts is presented in the “red” panel; two populations of γδ-T lymphocytes are shown in blue and violet, while maturation of monocytic cells is shown in orange.
Ijms 24 14451 g002
Ijms 24 14451 g003
Figure 3. Lymph node biopsy examination with hematoxylin-eosin staining at 100× (a) and 400× (b) magnification, and immunohistochemical examination at 400× for MPO (c) and CD3 (d).
Figure 3. Lymph node biopsy examination with hematoxylin-eosin staining at 100× (a) and 400× (b) magnification, and immunohistochemical examination at 400× for MPO (c) and CD3 (d).
Ijms 24 14451 g003
Ijms 24 14451 g004
Figure 4. Conventional G-banded karyotype analysis showing the t(3;11)(q21;q23) translocation in whole BM. Rearranged chromosomes are marked with arrows.
Figure 4. Conventional G-banded karyotype analysis showing the t(3;11)(q21;q23) translocation in whole BM. Rearranged chromosomes are marked with arrows.
Ijms 24 14451 g004
Ijms 24 14451 g005
Figure 5. CBL gene, exon 8 Sanger sequencing showing c.1186T>C, p.Cys396Arg missense variant (highlighted in yellow) in the BM (a), lymph node (b), and it’s absence in the nails (c).
Figure 5. CBL gene, exon 8 Sanger sequencing showing c.1186T>C, p.Cys396Arg missense variant (highlighted in yellow) in the BM (a), lymph node (b), and it’s absence in the nails (c).
Ijms 24 14451 g005
Ijms 24 14451 g006
Figure 6. Molecular findings on SET::NUP214 fusion in the BM: structure of SET::NUP214 fusion transcript in RNAseq data as depicted using the Arriba algorithm (a) and Sanger validation (SET::NUP214 exon 6—exon 18 junction is marked) (b); NUP214 gene rearrangement with 5′-partial deletion confirmed using FISH with NUP214 breakapart probe (CytoCell), 63× magnification, wild-type NUP214 is yellow, rearranged NUP214 3’-portion is green (c).
Figure 6. Molecular findings on SET::NUP214 fusion in the BM: structure of SET::NUP214 fusion transcript in RNAseq data as depicted using the Arriba algorithm (a) and Sanger validation (SET::NUP214 exon 6—exon 18 junction is marked) (b); NUP214 gene rearrangement with 5′-partial deletion confirmed using FISH with NUP214 breakapart probe (CytoCell), 63× magnification, wild-type NUP214 is yellow, rearranged NUP214 3’-portion is green (c).
Ijms 24 14451 g006
Ijms 24 14451 g007
Figure 7. TCR repertoire: fraction of TRB (a) and TRD (b) clonal rearrangements in lymph node. BM—bone marrow aspirate, LN—lymph node biopsy. BM populations are as follows: B—early myeloid blasts (CD45+CD33+CD14−), Mo—maturing and mature monocytes (CD45+CD33+CD14+), γδ-T1—immature γδ-T lymphocytes considered leukemic (CD45dimCD3dim), γδ-T2—more mature γδ-T lymphocytes considered normal (CD45highCD3high).
Figure 7. TCR repertoire: fraction of TRB (a) and TRD (b) clonal rearrangements in lymph node. BM—bone marrow aspirate, LN—lymph node biopsy. BM populations are as follows: B—early myeloid blasts (CD45+CD33+CD14−), Mo—maturing and mature monocytes (CD45+CD33+CD14+), γδ-T1—immature γδ-T lymphocytes considered leukemic (CD45dimCD3dim), γδ-T2—more mature γδ-T lymphocytes considered normal (CD45highCD3high).
Ijms 24 14451 g007
Ijms 24 14451 g008
Figure 8. CT scan data. (a) Initial CT scan on admission with massive lymphoproliferative syndrome. Red circles indicate lymph node conglomerates. (b) Computed tomography at 180 days after hematopoietic stem cell transplantation; no lymphadenopathy and recession of the lymphoproliferative syndrome are seen.
Figure 8. CT scan data. (a) Initial CT scan on admission with massive lymphoproliferative syndrome. Red circles indicate lymph node conglomerates. (b) Computed tomography at 180 days after hematopoietic stem cell transplantation; no lymphadenopathy and recession of the lymphoproliferative syndrome are seen.
Ijms 24 14451 g008
Ijms 24 14451 g009
Figure 9. Continuity of the flow cytometric pattern of myeloid and T-lineage cells in BM of described patient, density plot of CD7 and CD33 expression (represented by color scale from red to blue). Mature neutrophils, erythroid precursors, NK cells, and B lymphocytes are excluded.
Figure 9. Continuity of the flow cytometric pattern of myeloid and T-lineage cells in BM of described patient, density plot of CD7 and CD33 expression (represented by color scale from red to blue). Mature neutrophils, erythroid precursors, NK cells, and B lymphocytes are excluded.
Ijms 24 14451 g009
Table 1. Patient’s diagnostic examinations supportive of concomitant hematological neoplasm.
Table 1. Patient’s diagnostic examinations supportive of concomitant hematological neoplasm.
ExaminationAcute Myelomonocytic LeukemiaPTCL
BM aspirate morphology and cytochemistryA population of anaplastic blast cells positive for MPO and Sudan Black with a weakly diffuse PAS and negative for nonspecific esterase, 23% of BM NCs-
BM aspirate immunophenotyping1. A population of early myeloid blasts with CD45dim expression, bright CD7, heterogeneous CD33, CD34, and CD117 positivity, and expression of CD2, CD5, CD99, HLA-DR, and CD15, 2.5% of BM NCs;
2. Monocytic cells at various stages of differentiation, with partial CD7dim expression in the more immature population, 34% of BM NCs		A population of γδ-T cells with low CD7, CD2, CD5, CD3, and TCRγδ expression, CD45dim and CD99high expression, CD4/8-negative and CD48-negative, 3.5% of BM NCs
BM trephine biopsyMPO-positive promyelocytic and myeloblastic components located predominantly in the centers of intertrabecular spacesLymphoid clusters positive for CD3
Lymph node biopsyMPO-positive componentCD3-positive component
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Menchits, Y.; Salimova, T.; Komkov, A.; Abramov, D.; Konyukhova, T.; Abasov, R.; Raykina, E.; Itov, A.; Gaskova, M.; Borkovskaia, A.; et al. Unusual Presentation of SET::NUP214-Associated Concomitant Hematological Neoplasm in a Child—Diagnostic and Treatment Struggle. Int. J. Mol. Sci. 2023, 24, 14451. https://doi.org/10.3390/ijms241914451

AMA Style

Menchits Y, Salimova T, Komkov A, Abramov D, Konyukhova T, Abasov R, Raykina E, Itov A, Gaskova M, Borkovskaia A, et al. Unusual Presentation of SET::NUP214-Associated Concomitant Hematological Neoplasm in a Child—Diagnostic and Treatment Struggle. International Journal of Molecular Sciences. 2023; 24(19):14451. https://doi.org/10.3390/ijms241914451

Chicago/Turabian Style

Menchits, Yaroslav, Tatiana Salimova, Alexander Komkov, Dmitry Abramov, Tatiana Konyukhova, Ruslan Abasov, Elena Raykina, Albert Itov, Marina Gaskova, Aleksandra Borkovskaia, and et al. 2023. "Unusual Presentation of SET::NUP214-Associated Concomitant Hematological Neoplasm in a Child—Diagnostic and Treatment Struggle" International Journal of Molecular Sciences 24, no. 19: 14451. https://doi.org/10.3390/ijms241914451

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop