Next Article in Journal
Biosynthesis of the Inner Core of Bordetella pertussis Lipopolysaccharides: Effect of Mutations on LPS Structure, Cell Division, and Toll-like Receptor 4 Activation
Next Article in Special Issue
Network Analysis of Metabolome and Transcriptome Revealed Regulation of Different Nitrogen Concentrations on Hybrid Poplar Cambium Development
Previous Article in Journal
Altered Phenotypes of Breast Epithelial × Breast Cancer Hybrids after ZEB1 Knock-Out
Previous Article in Special Issue
Molecular Characterization of Local Walnut (Juglans regia) Genotypes in the North-East Parnon Mountain Region of Greece
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 24
10.3390/ijms242417312
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification, Characterization, and Expression Analysis of the Copper-Containing Amine Oxidase Gene Family in Mangrove Kandelia obovata

by
Quaid Hussain
1,2,
Ting Ye
1,
Chenjing Shang
1,*,
Sihui Li
1,
Jackson Nkoh Nkoh
1,2,
Wenyi Li
3 and
Zhangli Hu
1
1
Shenzhen Engineering Laboratory for Marine Algal Biotechnology, Shenzhen Public Service Platform for Collaborative Innovation of Marine Algae Industry, Guangdong Engineering Research Center for Marine Algal Biotechnology, College of Life Science and Oceanography, Shenzhen University, Shenzhen, 518060, China
2
College of Physics and Optoelectronic Engineering, Shenzhen University, Shenzhen 518060, China
3
Department of Biochemistry and Chemistry, La Trobe Institute for Molecular Science, La Trobe University, Bundoora, VIC 3086, Australia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(24), 17312; https://doi.org/10.3390/ijms242417312
Submission received: 9 November 2023 / Revised: 5 December 2023 / Accepted: 8 December 2023 / Published: 9 December 2023
(This article belongs to the Special Issue Advances in Forest Tree Physiology, Breeding and Genetic Research)
Browse Figures
Review Reports Versions Notes

Abstract

:
Copper-containing amine oxidases (CuAOs) are known to have significant involvement in the process of polyamine catabolism, as well as serving crucial functions in plant development and response to abiotic stress. A genome-wide investigation of the CuAO protein family was previously carried out in sweet orange (Citrus sinensis) and sweet cherry (Prunus avium L.). Six CuAO (KoCuAO1-KoCuAO6) genes were discovered for the first time in the Kandelia obovata (Ko) genome through a genome-wide analysis conducted to better understand the key roles of the CuAO gene family in Kandelia obovata. This study encompassed an investigation into various aspects of gene analysis, including gene characterization and identification, subcellular localization, chromosomal distributions, phylogenetic tree analysis, gene structure analysis, motif analysis, duplication analysis, cis-regulatory element identification, domain and 3D structural variation analysis, as well as expression profiling in leaves under five different treatments of copper (CuCl2). Phylogenetic analysis suggests that these KoCuAOs, like sweet cherry, may be subdivided into three subgroups. Examining the chromosomal location revealed an unequal distribution of the KoCuAO genes across four out of the 18 chromosomes in Kandelia obovata. Six KoCuAO genes have coding regions with 106 and 159 amino acids and exons with 4 and 12 amino acids. Additionally, we discovered that the 2.5 kb upstream promoter region of the KoCuAOs predicted many cis elements linked to phytohormones and stress responses. According to the expression investigations, CuCl2 treatments caused up- and downregulation of all six genes. In conclusion, our work provides a comprehensive overview of the expression pattern and functional variety of the Kandelia obovata CuAO gene family, which will facilitate future functional characterization of each KoCuAO gene.

1. Introduction

Polyamines (PAs) play a crucial role in various aspects of plant development as well as in their responses to both abiotic and biotic stressors. PAs are organic cations with a low molecular weight that are widely dispersed in various living organisms [1]. According to Galston and Kaur-Sawhney [2], putrescine (Put), spermidine (Spd), and spermine (Spm) are the three predominant polyamines found in higher plants. The catabolism of PA is a crucial factor in the maintenance of PA homeostasis. Two distinct categories of amine oxidases play a role in the catabolism of polyamines: FAD-binding polyamine oxidase (PAO) and Copper amine oxidases (CuAOs) [3]. CuAOs play a crucial role in the cellular regulation of polyamine levels. Copper (II) amine oxidases catalyze the oxidation of primary amines, resulting in the formation of their corresponding aldehydes and hydrogen peroxide. Aldehydes serve as intermediates in diverse biosynthetic routes of alkaloids within the plant kingdom. CuAOs are believed to selectively oxidize polyamines in a single main amino group, leading to the formation of monocyclic structures in many instances. The involvement of these oxidases in the production of pyrrolizidine alkaloids has been hypothesized [1]. The CuAO enzyme in plants can be categorized into two distinct groups based on their subcellular localization. The first group is found within peroxisomes, as shown by the presence of peroxisomal targeting signals. The second group is located outside of the cell, as indicated by the presence of N-terminal signal peptides [4,5]. Previous studies have demonstrated the presence of CuAO members in both peroxisomal and extracellular locations across many species, such as Arabidopsis [6], apple [7], and sweet orange [5]. In the majority of instances, the catabolism of Put is facilitated by CuAO [3]. However, in Arabidopsis, both Put and Spd can be catalyzed by CuAO [4,6]. The homodimeric nature of plant CuAOs is characterized by the presence of a copper ion and a 2, 4, 5-trihydroxyphenylalanine quinone cofactor (TPQ) site within each subunit [8,9]. Nevertheless, it has been revealed by Planas-Portell et al. [6] that the CuAOs of Arabidopsis (AtCuAO1–AtCuAO3) are capable of utilizing both Put and Spd as substrates.
In tropical and subtropical coastal wetlands, mangroves constitute the main kind of halophytic vegetation and are important from an ecological standpoint. Furthermore, these organisms have demonstrated a high level of adaptation to the demanding conditions found in intertidal environments [10,11]. Throughout East Asian and Southeast Asian tropical and subtropical climates, salt marshes are the primary habitat for a woody plant known as Kandelia obovata [12,13,14]. Kandelia obovata is able to adapt to transitional habitats where land and ocean meet by surviving cyclic and aperiodic tidal impacts, which cause high salinity, severe erosion, and anaerobic conditions [15]. The preservation of biodiversity and mitigation of erosion are contingent upon the vital role played by Kandelia obovata [16,17]. The plant species Kandelia obovata in China exhibit variations based on the age of the mangrove forest in which they are farmed and consumed. Since the 1960s, a number of mangrove plantings, predominantly consisting of the Kandelia obovata species, have been effectively implemented with the aim of protecting the coastal environment. Consequently, mangrove forests of different ages containing Kandelia obovata have been planted [18].
Based on the findings of Wang et al. [19], it has been observed that Kandelia obovata mangroves exhibit a higher level of resilience towards waterlogging and display distinct responses to varying levels of light irradiance. Copper (Cu), lead (Pb), and zinc (Zn) are widely recognized as the predominant heavy metal contaminants, with mangroves playing a crucial role in their accumulation [20,21,22]. The growth of Kandelia obovata seedlings was found to be reduced with exposure to Cu [23,24,25]. The co-occurrence of multiple heavy metal stressors can lead to a notable degradation of chlorophyll in the leaves of Kandelia obovata [26]. Shen et al. [25] documented a reduction in the total chlorophyll concentration of Kandelia obovata when exposed to a composite synthetic wastewater solution containing several heavy metals. According to the findings of Zhao and Zheng [24], an increase in the concentration of Cu resulted in initial growth and subsequent fall in the amount of soluble sugar in the roots of Kandelia obovata seedlings. Conversely, the quantity of soluble sugar in the leaves exhibited a decrease [25]. Nevertheless, the impact of stress caused by Cu on CuAOs has not received sufficient consideration, as the majority of studies conducted on this species have mostly focused on examining physiological and molecular responses.
All living organisms require Cu, which is also a necessary protein cofactor for a variety of physiological processes [27]. Nevertheless, elevated levels of Cu have the potential to induce pollution, resulting in a deceleration of plant growth and hindered developmental processes [28]. Cano-Gauci and Sarkar [29] have reported that the reactivity of Cu can lead to notable oxidative damage in cells, hindered root growth, difficulties in flowering, and defects in germination. In response to both shortages and excesses of this vital element, eukaryotic organisms have developed a mechanism to efficiently manage the acquisition and distribution of Cu [30]. Cu is linked to several physiological functions in plants, including photosynthesis, mitochondrial respiration, superoxide scavenging, ethylene sensing, and cell wall metabolism [31]. Insufficient levels of Cu in plants lead to a multitude of abnormal phenotypes, including diminished water transport, distorted young leaves, and impaired growth and reproductive development [32]. In the investigation conducted by Shen et al. [25], it was noted that this particular species exhibited variable levels of tolerance towards different heavy metals. Notably, it showed the ability to withstand Cu stress up to a concentration of 400 mg/L. Consequently, the study encompassed a range of Cu solution concentrations spanning from 0 to 400 mg/L.
The CuAO gene family has not been found in Kandelia obovata as far as the current state of knowledge is concerned. Hence, this investigation represents the initial occurrence of a comprehensive genome-wide research aimed at identifying the presence of CuAO genes inside the genome of Kandelia obovata. The primary objective of this study was to find and characterize the six CuAO genes, followed by an examination of their expression levels in relation to five distinct CuCl2 treatments. Bioinformatics approaches were employed to investigate several elements pertaining to the evolution of CuAO genes in Kandelia obovata, with the aim of attaining a more comprehensive knowledge. The aforementioned aspects encompassed the examination of gene structures, physicochemical characteristics, chromosomal arrangement, duplication analysis, conserved motifs, cis elements, phylogenetic connections, subcellular localization, and the expression patterns of CuAO homologs. The current work aims to examine the characterization and expression analysis of the CuAO family in Kandelia obovata. The objective of this study is to develop a theoretical framework for future investigations into the response of the CuAO family to CuCl2 treatment in Kandelia obovata plants.

2. Results

2.1. Identification of CuAO Family Members in Kandelia obovata

Kandelia obovata contains a total of six CuAO genes in its genome, a notably higher count compared to other plant species like Arabidopsis thaliana, Prunus avium L., Malus domestica, Heliotropium indicum, Glycine max, and Citrous sinensis. The CuAO family demonstrated a molecular weight range of 11.78 to 17.09, with a mean value of 14.71 kilodaltons (kDa). The protein KoCuAO1 demonstrated the greatest isoelectric point (pI) value of 9.72, while KoCuAO3 revealed the lowest pI value of 6.82. The isoelectric point (pI) of the CuAO family displayed a mean range of 6.82 to 9.72, with a mean value of 8.62. The hydrophobic properties of six CuAOs were illustrated by the variability in their grand average hydropathy index (GRAVY) values, which ranged from 0.309 to 0.805.
The determination of the subcellular location of CuAO proteins can facilitate a deeper understanding of their molecular functionality. Based on the subcellular localization prediction of CuAO proteins (Table 1), it is likely that six CuAOs were distributed throughout several locations. The CuAO family demonstrated a mean amino acid length ranging from 133 to 159. The identified CuAO genes in Kandelia obovata were mapped to the correct chromosomes using the MapGene2Chromosome (MG2C) web tool, which was used to determine their relative chromosomal locations. The chromosomal positions of the six CuAO genes, specifically KoCuAO1, KoCuAO2, KoCuAO3, KoCuAO4, KoCuAO5, and KoCuAO6, were determined to be located on chromosome 04 (Chr04), chromosome 09 (Chr09), chromosome 13 (Chr13), and chromosome 15 (Chr15) (Figure 1 and Table 1).

2.2. Diversity within the CuAO Family in Relation to Domain and Three-Dimensional Structure

After aligning all KoCuAOs, the NCBI’s BLAST search showed that 60–100% of their amino acid sequences are identical. Additionally, these proteins exhibit sequence identity and similarity, with black representing 100%, green 80%, and grey 60% (Figure 2). The discovery of CuAOs in Kandelia obovata was made through domain analysis (PF01179), which revealed their presence in three transmembrane domains (Figure 2). The protein structures of KoCuAOs were verified utilizing the SWISS-MODEL workspace and SOPMA/prabi tool, as illustrated in Figure 3. The KoCuAO proteins were accurately simulated using the templates 5m94.1.A, as depicted in Figure 3. The range of sequence identity observed in this study varied from 71.3% to 81.66%. The values of GMQE ranged from 0.94 to 0.92, while the sequence coverage ranged from 0.93 to 1.00. The data presented in this study indicate that the 3D model predictions for KoCuAO proteins exhibit a high level of accuracy and demonstrate the presence of helix and strand structures. The CuAO proteins found in Kandelia obovata demonstrate secondary structures that are comparable to those observed in CuAO proteins of other species, as illustrated in Figure 4 and Figure S1.

2.3. CuAO Protein Phylogenetic Relationships

An unrooted neighbor-joining (NJ) tree was generated by aligning a total of 43 CuAO sequences from various plant species, including six from Kandelia obovata (Ko), 10 from Arabidopsis thaliana (At), four from Prunus avium L. (Pav), nine from Malus domestica (Md), five from Heliotropium indicum (Hi), one from Glycine max (Gm), and eight from Citrous sinensis (Cs). This facilitated the determination of the evolutionary relationships among the CuAO proteins derived from the seven species under investigation. Based on the evolutionary tree, it is possible to identify three distinct groups (I, II, and III) of CuAO proteins. Group I had a total of 31 CuAO proteins, which were categorized into several groups based on their species-specific characteristics. This subgroup was composed of the following proteins: four KoCuAO proteins (KoCuAO1/2/3/4), five AtCuAO proteins (AtCuAO2/3/4/5/10), three PavCuAO proteins (PavCuAO1/2/3), seven MdCuAO proteins (MdCuAO1/3/4/5/6/7/8), four HiCuAO proteins (HiCuAO1/2/3/5), one GmCuAO protein (GmCuAO1), and seven CsCuAO proteins (CsCuAO1/3/6/4/5/7/8). Group II consisted of a collective of eight CuAO proteins, encompassing one KoCuAO protein (KoCuAO6), two AtCuAO proteins (AtCuAO7/9), one PavCuAO protein (PavCuAO4), two MdCuAO proteins (MdCuAO2/9), one HiCuAO protein (HiCuAO4), and one CsCuAO protein (CsCuAO2). Group III consisted of three CuAO proteins, including one KoCuAO protein (KoCuAO5) and two AtCuAO proteins (AtCuAO1/6). Therefore, it is evident from the data shown in Figure 5 that Group I exhibited a greater abundance of CuAO members in comparison to Group II and III. It is observed that the KoCuAOs exhibit a higher degree of similarity with their counterparts found in Arabidopsis thaliana, Malus domestica, and Citrous sinensis, compared to other plant species such as Prunus avium L., Heliotropium indicum, and Glycine max.

2.4. Investigation of the Genetic Structure and Conserved Features of CuAO Genes

The investigation focused on the examination of the exon–intron patterns of the CuAO genes to explore the gene expansion of the Kandelia obovata family. In order to further our understanding of the structural attributes of CuAO genes, we examined the exon–intron structures and conserved motifs, as depicted in Figure 6. The number of CuAO exons ranged from 4 to 12, while the number of introns ranged from 1 to 2 (Figure 6). The gene family known as CuAOs exhibits a diverse range of gene structures, with the majority of CuAO genes containing one to two UTR/introns. However, specific members of the CuAO gene family, namely KoCuAO1, KoCuAO2, and KoCuAO3, possess only one intron. The highest count of exons identified in KoCuAO3 and KoCuAO4 was 12 and 11, respectively. The results of this study revealed that a group of individuals with CuAOs shared a gene structure that exhibited a high degree of similarity to that of their evolutionary relatives.
Furthermore, the MEME web servers were employed to elucidate the conserved motifs of the CuAO genes. In addition, six genes encoding KoCuAOs were found to contain six conserved motifs, as depicted in Figure 6. Motifs one, two, three, and six are present in all KoCuAO proteins, as indicated by the prediction. KoCuAO1/2/5/6 identified motif four and motif five. The results of this study indicate that there is a notable level of similarity in the gene structure and amino acid sequence across individuals belonging to the same subfamily of KoCuAOs.

2.5. Cis-Regulatory Elements in the Promoters of Six CuAO Genes

Upon reviewing the existing literature on cis elements, which have the potential to shed light on the mechanisms involved in regulating gene expression, we proceeded to examine the promoter sequences located 2500 base pairs upstream of CuAO genes. Regarding the CuAO genes, it is worth mentioning that the light-responsiveness gene demonstrates a significant abundance of cis-elements. Additionally, it was observed that the promoter sequences of CuAOs1-6 genes exhibit variations in the presence of cis elements linked with phytohormones such as Abscisic acid (ABA), Gibberellin (GA), Auxin, Salicylic acid (SA), and Methyl jasmonate (MeJA). Furthermore, other cis elements associated with defense and stress responses, including low temperature (Low Temp), drought, Zein metabolism, and anaerobic responses, were also detected (Figure 7). The presence of diversity in the response components serves as evidence-based proof for the regulatory functions of CuAO genes in a diverse array of physiological and biological processes.

2.6. Duplication Analysis of CuAO Gene Family

Segmental and tandem duplication processes play a pivotal role in facilitating the formation of novel gene families within plant genomes. Improved comprehension of the duplication events related to the CuAO gene in Kandelia obovata; an investigation was undertaken to analyze both segmental and tandem duplications within the gene family of KoCuAOs. The chromosomal distributions of six KoCuAO genes were assessed. The results of this investigation suggest that there was a solitary occurrence of segmental duplication involving the gene pairs KoCuAO3 and KoCuAO4 on chromosomes A09 and A14. This observation is illustrated in Figure 8. Tandem repeats of paralogous genes were seen in KoCuAO1 and KoCuAO2, as well as KoCuAO5 and KoCuAO6. Each of these pairs of genes was found to be present as a single gene, regardless of the chromosome on which they were located (Table 2). The findings of this study have demonstrated the significance of duplication events in the proliferation of the KoCuAO family genes.
In order to improve understanding of the evolutionary constraints affecting the KoCuAO gene family, a comprehensive analysis was undertaken to ascertain the Ka (non-synonymous substitution rate), Ks (synonymous substitution rate), and the Ka/Ks ratio for Kandelia obovata. The duplicated gene pairs of KoCuAOs exhibited Ka/Ks ratios of 0.86, 0.97, and 0.99, suggesting that the CuAO gene family in Kandelia obovata might have undergone selective pressures or a discriminatory load throughout their evolutionary history (Table 2).

2.7. Expression Analysis of KoCuAO Genes under Copper Treatment

The quantitative real-time polymerase chain reaction (qRT-PCR) technique was employed to do expression profiling of six genes, namely KoCuAO1, KoCuAO2, KoCuAO3, KoCuAO4, KoCuAO5, and KoCuAO6. The present analysis was conducted with the inclusion of five separate CuCl2 treatments, specifically referred to as Cu0, Cu50, Cu100, Cu200, and Cu400 mg/L, as illustrated in Figure 9. In the current study, it was observed that the expression levels of KoCuAO2 were decreased when exposed to a CuCl2 treatment of Cu200; however, they were increased under CuCl2 treatments of Cu50, Cu100, and Cu400 in comparison to the control treatment of Cu0. The KoCuAO5 gene exhibited a decrease in expression levels following exposure to the Cu50, Cu200, and Cu400 treatments, while it showed an increase in expression in response to the Cu100 treatment, as compared to the control group (Cu0). The expression levels of the other two genes, namely KoCuAO1 and KoCuAO4, exhibited considerable upregulation under all CuCl2 stress conditions as compared to the control condition without CuCl2. There were no significant differences found in the expression level of KoCuAO3 between the Cu100 and Cu200 conditions.
Similarly, KoCuAO6 did not reveal any significant differences in expression level between the Cu400 and Cu0 conditions. The expression levels of the four genes, KoCuAO1-4, were found to be greater in the Cu100 treatment, but the expression levels of KoCuAO5 and KoCuAO6 were higher in the Cu200 treatment compared to the other CuCl2 treatments. The observation above can be ascribed to the augmented expression levels of KoCuAOs in the leaf under conditions of restricted CuCl2 supply. Nevertheless, in the presence of substantial Cu, the transcript levels of these genes exhibited a decrease when compared to both the Cu0 condition and other Cu levels.

3. Discussion

Kandelia obovata, a member of the Rhizophoraceae family, is a crucial arboreal species found in tropical and subtropical regions of East and Southeast Asia. It serves as a vital coastal shelterbelt and contributes to the overall ecosystem [12]. Kandelia obovata exhibits adaptive characteristics in transitional habitats characterized by the interface between land and water. This adaptation enables the species to effectively cope with both periodic and aperiodic tidal influences, resulting in the presence of high salinity, severe erosion, and anaerobic conditions [15]. The species Kandelia obovata plays a vital role in the preservation of biodiversity and the mitigation of erosion [16,17]. Heavy metals are a prominent class of anthropogenic toxic substances found in mangrove ecosystems [23,26]. Among them, copper (Cu), zinc (Zn), and lead (Pb) are often observed as contaminants [33,34]. Cu is a vital micronutrient for the survival of living things. The process of Cu absorption across the cell membrane plays a vital role in the regulation of Cu homeostasis. Multiple variants of transporter proteins have been documented to facilitate the absorption of Cu [27,30]. In our recently published study by Hussain et al. [30], we discovered that various treatments of copper had a significant impact on the width and length of the leaves of Kandelia obovata plants. However, there were no noticeable differences in the height of the plants between the four copper treatments (Cu50, Cu100, Cu200, and Cu400 mg/L) and the control group without any heavy metals (Cu0). These data support a previous study by Chai et al. [35], which hypothesized that Kandelia obovata would devote more energy to leaf growth in response to many heavy metal stressors. These results corroborate those of previous studies by Cheng et al. [23], who discovered that throughout the 120-day experiment, certain heavy metal stressors had no discernible effect on plant growth.
The process of polyamine catabolism is of extreme significance in the context of plant development and the response to stress. Currently, the predominant emphasis in research is placed on investigating the involvement of polyamine oxidases (PAOs) in the degradation of polyamines (PAs) [5,36]. In contrast, the understanding of CuAOs remains limited despite the existence of several studies that have investigated their roles in polyamine catabolism and stress response [3,6]. Nevertheless, the response of CuAO genes in Kandelia obovata, a common woody mangrove species, to Cu stress (CuCl2) remains largely unexplored. In the present study, a genome-wide analysis was employed to identify a contracted gene family known as CuAOs, consisting of six members, within the genome of Kandelia obovata. The number of CuAO genes identified in various plant species is lower, comparatively. For instance, Arabidopsis thaliana has 10 CuAO genes [6], Malus domestica has nine [7], Citrus sinensis has eight [5], Heliotropium indicum has five [1], Prunus avium L. has four [4], and Glycine max has only one [37]. Based on the findings of published investigations, it has been observed that various plant species possess a range of one to 10 CuAO genes. Our research outcome aligns with a prior investigation in this regard.
The comprehension of the subcellular location of KoCuAO is of most importance in elucidating its functional role. The localization of KoCuAOs in Kandelia obovata has been demonstrated to occur in the peroxisome, cytoplasm, and chloroplast. This finding aligns with a prior study conducted on apple, which investigated the localization of the MdAO1 protein and found similarities [7]. Our findings align with a prior work conducted on Arabidopsis, where we observed similarities between our results and the localization of AtCuAO2 and AtCuAO3 in peroxisomes [6]. The presence of a PTS1 in CsCuAO1 and CsCuAO3, as determined by amino acid sequence analysis, indicates that these proteins may be localized in peroxisomes [5]. This observation is supported by the fact that PTS1 is a critical motif for peroxisomal localization, as reported by Planas-Portell et al. [6]. Furthermore, the presence of an N-terminal signal peptide was detected in CsCuAO4, CsCuAO5, and CsCuAO6, suggesting their potential localization as extracellular proteins. A study conducted by Wang et al. [5] demonstrated that five CsCuAOs, specifically CsCuAO4–8, were found to be situated on the same chromosome and displayed identical transcriptional orientation. This observation suggests that these CsCuAOs may have originated from a gene duplication event.
The phylogenetic analysis demonstrated that the CuAO genes derived from Kandelia obovata and six other plant species, namely Arabidopsis thaliana (At), Prunus avium L. (Pav), Malus domestica (Md), Heliotropium indicum (Hi), Glycine max (Gm), and Citrus sinensis (Cs), were categorized into two primary groups. The present study involved the identification of six KoCuAO genes from the Kandelia obovata genome. A phylogenetic analysis was conducted, which indicated that KoCuAOs and sweet cherry (PavCuAOs) had the closest relationship [4]. The findings of this study indicate a potential evolutionary trend within the KoCuAO gene family. The allocation of CuAO proteins in Kandelia obovata was divided between the three categories based on the previously established classifications, specifically those pertaining to sweet cherries [4]. Tandemly duplicated genes have a higher likelihood of being conserved throughout the process of evolution when they are involved in the response to environmental stimuli [38,39]. The gene structure of KoCuAO was subjected to analysis, which resulted in the identification of three distinct patterns. The number of exons in the CuAO gene ranged from 4 to 12, while the number of introns ranged from 1 to 2. The gene structure pattern seen in the study, as mentioned earlier, aligns with the gene structure patterns found in sweet cherry and sweet orange, as reported by previous research [4,5]. The rise in the number of exons and introns can be attributed to alterations in gene structure resulting from evolutionary processes. It has been observed that genes possessing a lower number of introns tend to undergo editing and exit the nucleus at an earlier stage in a general context [40,41]. Cis-regulatory motifs and elements found in promoter sequences are utilized to obtain a deeper understanding of how KoCuAO genes respond to various environmental stimuli. Cis elements, such as phytohormones (auxin, salicylic acid, gibberellin), zein metabolism, stress (low temperature, drought, defense, and stress), and meristem and endosperm expression, were included in this group. Prior studies have demonstrated that cis elements have a role in enhancing plant stress responses. The outcome of our study aligns with a prior discovery indicating that promoter cis elements have a significant impact on the regulation of gene transcription in plants, particularly in the context of tissue-specific or stress-induced expression patterns, as observed in [4].
Multiple investigations have established that CuAOs are implicated in many physiological responses to heavy metal exposure. The primary objective of this study was to examine the impact of Cu stress on the expression of KoCuAO, a specific gene. The results revealed that the expression levels of KoCuAO2 were found to be downregulated when exposed to a Cu concentration of 200 mg/L, while they were upregulated in response to Cu treatments of 50, 100, and 400 mg/L, as compared to the control group (Cu0) [30]. The findings of our study align with previous research conducted on sweet cherry and sweet orange [5], suggesting that PavCuAOs may have diverse functional roles across various tissues. The expression of PavCuAO1 and PavCuAO3 was found to be significantly elevated in flowers and young leaves [4]. Conversely, PavCuAO2 and PavCuAO4 exhibited high levels of transcription in fruits, flowers, and young leaves. These findings imply that PavCuAOs may play a regulatory role in the development of several organs in sweet cherry [4]. The findings of our study are consistent with previous research conducted on the CuAO genes of Arabidopsis [6], sweet cherry [4], and sweet orange [5]. These collective findings indicate that the CuAO genes might play a role in the regulation of tissue development. The KoCuAO genes have the potential to serve as valuable genetic modifiers in enhancing the tolerance of crops and plants toward elevated levels of CuCl2.

4. Materials and Methods

4.1. Characterization and Identification of the CuAO Genes in Kandelia obovata

The genome sequences of Kandelia obovata were acquired from the NCBI database (https://www.ncbi.nlm.nih.gov/; accessed on 15 October 2023, BioProject/GWH, accession codes: PRJCA002330/GWHACBH00000000) and the Kandelia obovata protein database (https://www.omicsclass.com/article/310; accessed on 15 October 2023) [12]. Two databases confirm hypothetical proteins: Pfam: http://pfam.xfam.org/ (accessed on 15 October 2023) and NCBI CDD (https://www.omicsclass.com/article/310, with an E-value of 1.2 × 10−28). The protein sequence analysis of copper amine oxidases (CuAOs) associated with the domain profile was performed using the Pfam database (http://pfam.xfam.org). The researchers utilized the Kandelia obovata genome database (https://www.omicsclass.com/article/310) and the National Center for Biotechnology Information (NCBI) database: https://www.ncbi.nlm.nih.gov/ (accessed on 15 October 2023) to ascertain and authenticate six CuAO family genes, specifically identified as KoCuAO1, KoCuAO2, KoCuAO3, KoCuAO4, KoCuAO5, and KoCuAO6. The Protparam tool, available at http://web.expasy.org/protparam/ (accessed on 15 October 2023), was employed to acquire physicochemical properties [42].

4.2. Chromosomal Distribution

Using the NCBI database and the web resource https://www.omicsclass.com/article/310, both accessed on 15 October 2023, the chromosomal locations and protein sequences of all CuAO genes in Kandelia obovata were discovered. The chromosomal locations of CuAO genes were also assessed on 15 October 2023. The researchers employed the MapGene2Chromosome (MG2C) method to ascertain the chromosomal positions of CuAO genes in Kandelia obovata. The MG2C utility, namely version 2.0, was accessed on 15 October 2023, via the following URL: http://mg2c.iask.in/mg2c [43].

4.3. Phylogenetic Tree Construction

The protein sequences of CuAO genes from the species Kandelia obovata (Ko), Arabidopsis thaliana (At), Prunus avium L. (Pav), Malus domestica (Md), Heliotropium indicum (Hi), Glycine max (Gm), and Citrus sinensis (Cs) were utilized in the phylogenetic analysis. The MEGA11 (V 6.06) software, which can be accessed at www.megasoftware.net (accessed on 15 October 2023), was frequently utilized for the purpose of aligning protein sequences [44]. The construction of the phylogenetic tree was performed utilizing the neighbor-joining (NJ) method, employing 1000 bootstrap iterations. The phylogenetic tree was analyzed and edited using Evolview (https://evolgenius.info//evolview-v2/#login) on 15 October 2023 [45].

4.4. Gene Structure and Significant Motif Analyses

The genomic composition of Kandelia obovata has been elucidated, revealing the presence of six genes that are classified within the CuAO gene family. The exon/intron arrangements of the six CuAO genes were presented, along with the structural studies of the genes, using web software (http://gsds.cbi.pku.edu.cn, accessed on 15 October 2023) [45]. The web program MEME v5.4.1 was utilized on 15 October 2023, to identify further conserved strings or regions within the protein sequences of the six CuAOs proteins. This information can be accessible at https://meme-suite.org/meme/tools/glam2scan (accessed on 15 October 2023). The application utilized the subsequent configurations: alphabet sequencing including DNA, RNA, or protein; site distribution restricted to either zero or one occurrence per sequence (zoops); motif discovery mode established as classic mode; and a total of 10 motifs. The TBtools software (v1.106, http://www.tbtools.com/) was utilized to visualize the MEME results after obtaining the corresponding mast file [46].

4.5. Duplication Analysis

The analysis and visualization of the presence and duplication events of the CuAO family members in mangrove species were conducted using MCScanX: http://chibba.pgml.uga.edu/mcscan2/ (accessed on 15 October 2023), a software tool developed by the University of Georgia in Athens, GA, USA. The source was accessed online on 15 October 2023. The present study employed Circos visualization to identify duplications in the Kandelia obovata species. Furthermore, MCscanX was utilized to conduct a comprehensive search for CuAO genes in Ko. The KaKs Calculator 2.0 (https://sourceforge.net/projects/kakscalculator2/, accessed on 15 October 2023) was utilized to calculate the synonymous (Ks), non-synonymous (Ka), and Ka/Ks ratios for the purpose of investigating the evolutionary constraints of the CuAO gene pairs [47].

4.6. Cis-Regulatory Elements (CREs)

The upstream sequences, including 2500 base pairs, of the CuAO family members were collected from the genome assembly database of Kandelia obovata. The PlantCARE tool, accessible at http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 15 October 2023), was utilized for the identification of CREs within the acquired sequences. The generation of Figure 6 in TBtools (v1.106) involved the utilization of the most commonly occurring CREs that were identified for the CuAO genes. This was accomplished through a thorough investigation of the frequency of each CRE motif [30].

4.7. Three-Dimensional Structure and Subcellular Localization

The estimation of the three-dimensional (3D) structure can be conducted by the utilization of SWISS-MODEL, an online resource accessible at https://swissmodel.expasy.org/interactive, which was accessed on 15 October 2023 [45]. In this study, the TMHMM-2.0 tool: https://services.healthtech.dtu.dk/service.php?TMHMM-2.0 (accessed on 15 October 2023) was employed for the prediction of transmembrane helices in proteins. Additionally, the secondary structure was determined using the SOPMA/prabi method: https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html (accessed on 15 October 2023) [38]. Two online techniques were utilized to estimate the subcellular localization of the CuAO family genes.
ProtComp 9.0: http://linux1.softberry.com/berry.phtml?topic=protcomppl&group=programs&subgroup=proloc (accessed on 15 October 2023), is a software application utilized for the purpose of analysis. The CELLO server located at cello.life.nctu.edu.tw was accessed on 15 October 2023 [30].

4.8. Plant Material and Environmental Conditions

The study utilized seedlings of Kandelia obovata that were one year old and used three plots per treatment, 10–12 plants per plot, and three replications. These seedlings were planted in the mangrove conservation site located in Golden Bay Mangrove Reserve, situated in Beihai, Guangxi Province. The geographical coordinates of the site are 109.22° N and 21.42° E. The soil was irrigated with CuCl2 irrigation and received daily morning and evening watering with seawater from the adjacent vicinity, as a component of semi-natural agriculture practices. Throughout a two-year period, five distinct concentrations of CuCl2 were employed for the treatments, namely Cu0, Cu50, Cu100, Cu200, and Cu400, corresponding to concentrations of 0, 50, 100, 200, and 400 mg/L, respectively. The control treatment utilized local seawater as the starting concentration, with a Cu0 content of 0 mg/L. Different CuCl2 concentrations (Cu0, Cu50, Cu100, Cu200, and Cu400 mg/L) affect leaf morphology and plant growth, and their photographs depicting which are already discussed in our recently published article by Hussain et al. [30]. The soil sample used for this experiment had a background Cu concentration of <1.0%, which was classified as non-polluted [48]. Following a two-year period of treatment, plant samples were collected in order to assess the various criteria [30].

4.9. Quantitative Real-Time PCR Assays

The extraction of total RNA from the aforementioned leaves was performed using TRIzol reagent (Invitrogen, Carlsbad, CA, USA, http://www.invitrogen.com; accessed on 15 October 2023). The ABI PRISM 7500 Real-time PCR Systems, manufactured by Applied Biosystems in Waltham, MA, USA, were employed to conduct quantitative real-time PCR (qRT-PCR) assays. The 2−∆∆CT approach, as previously outlined by Hussain et al. [30] was utilized for these experiments. The reference gene for Kandelia obovata (KoActin) was selected based on the sequence supplied by Sun et al. [13]. The forward primer used was CAATGCAGCAGTTGAAGGAA, and the reverse primer used was CTGCTGGAAGGAACCAAGAG. The exact KoCuAO gene primers utilized for real-time PCR are presented in Table 3. These primers were produced using the primer-designing tool provided by the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 8 April 2023).

4.10. Statistical Analysis

Statistix 8.1, an analytical program created by a Tallahassee, Florida, USA-based Corporation, was utilized to analyze the data. The analysis utilized a one-way analysis of variance (ANOVA), and the findings were reported in terms of the mean and standard deviation (SD) of the three biological replicates. The primary objective of this study was to investigate the variations in leaf structure among plants exposed to five distinct levels of copper stress (Cu0, Cu50, Cu100, Cu200, and Cu400 mg/L), which are already discussed in our recently published article by Hussain et al. [30]. A least significant difference (LSD) test was conducted at a significance level of p < 0.05. The graphs were produced using GraphPad Prism version 9.0.0, a statistical software for Windows developed by GraphPad Software in San Diego, California, USA (https://www.graphpad.com; accessed on 25 October 2023).

5. Conclusions

A total of six putative CuAO genes (designated as KoCuAO1-6) were discovered in the species Kandelia obovata. The presence of KoCuAO genes was detected on the four chromosomes of Kandelia obovata. The expression patterns of KoCuAO genes exhibited variations within Ko leaves, suggesting that KoCuAOs are involved in tissue-specific processes. Based on the examination of gene expression in response to CuCl2 treatment, it was noted that a majority of genes exhibited considerable upregulation when the CuCl2 concentration was reduced. Conversely, when the CuCl2 concentration was increased, the expression level of CuAO genes was found to be downregulated. These findings will also facilitate the identification of potential genes that enhance plant architecture in response to stressful situations and enable potential genetic enhancements and breeding of KoCuAO genes in other crops. This may include techniques such as CRISPR/Cas-mediated deletion, overexpression, and other genetic modifications.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms242417312/s1.

Author Contributions

Conceptualization, Q.H., and C.S.; software, T.Y.; formal analysis, T.Y. and S.L.; writing—original draft preparation, Q.H.; writing—review and editing, Q.H., J.N.N., W.L., Z.H. and C.S.; supervision, C.S.; funding acquisition, C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (2018YFA0902500), the National Natural Science Foundation of China (42376219, 41706137), the CAS Key Laboratory of Science and Technology on Operational Oceanography (No. OOST2021-07), the Graduate Education Innovation Project (Guangdong Province, 2020JGXM094).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article or supplementary material.

Acknowledgments

We thank the Instrument Analysis Center of Shenzhen University. We are also grateful for the support from the public service platform of instruments and equipment at the College of Life Sciences and Oceanography at Shenzhen University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zakaria, M.M.; Stegemann, T.; Sievert, C.; Kruse, L.H.; Kaltenegger, E.; Girreser, U.; Serhat, S.C. Insights into Polyamine Metabolism: Homospermidine Is Double-Oxidized in Two Discrete Steps by a Single Copper-Containing Amine Oxidase in Pyrrolizidine Alkaloid Biosynthesis. Plant Cell 2022, 34, 2364–2382. [Google Scholar] [CrossRef]
  2. Galston, A.W.; Sawhney, R.K. Polyamines in Plant Physiology. Plant Physiol. 1990, 94, 406–410. [Google Scholar] [CrossRef] [PubMed]
  3. Cona, A.; Rea, G.; Angelini, R.; Federico, R.; Tavladoraki, P. Functions of Amine Oxidases in Plant Development and Defence. Trends Plant Sci. 2006, 11, 80–88. [Google Scholar] [CrossRef] [PubMed]
  4. Cao, X.; Wen, Z.; Shang, C.; Cai, X.; Hou, Q.; Qiao, G. Copper Amine Oxidase (CuAO)-Mediated Polyamine Catabolism Plays Potential Roles in Sweet Cherry (Prunus Avium L.) Fruit Development and Ripening. Int. J. Mol. Sci. 2022, 23, 12112. [Google Scholar] [CrossRef]
  5. Wang, W.; Wu, H.; Liu, J.H. Genome-Wide Identification and Expression Profiling of Copper-Containing Amine Oxidase Genes in Sweet Orange (Citrus Sinensis). Tree Genet. Genomes 2017, 13, 31. [Google Scholar] [CrossRef]
  6. Planas-Portell, J.; Gallart, M.; Tiburcio, A.F.; Altabella, T. Copper-Containing Amine Oxidases Contribute to Terminal Polyamine Oxidation in Peroxisomes and Apoplast of Arabidopsis Thaliana. BMC Plant Biol. 2013, 13, 109. [Google Scholar] [CrossRef]
  7. Zarei, A.; Trobacher, C.P.; Cooke, A.R.; Meyers, A.J.; Hall, J.C.; Shelp, B.J. Apple Fruit Copper Amine Oxidase Isoforms: Peroxisomal MdAO1 Prefers Diamines as Substrates, Whereas Extracellular MdAO2 Exclusively Utilizes Monoamines. Plant Cell Physiol. 2015, 56, 137–147. [Google Scholar] [CrossRef] [PubMed]
  8. Medda, R.; Padiglia, A.; Floris, G. Plant Copper-Amine Oxidases. Phytochemistry 1995, 39, 1–9. [Google Scholar] [CrossRef]
  9. Di Paolo, M.L.; Lunelli, M.; Fuxreiter, M.; Rigo, A.; Simon, I.; Scarpa, M. Active Site Residue Involvement in Monoamine or Diamine Oxidation Catalysed by Pea Seedling Amine Oxidase. FEBS J. 2011, 278, 1232–1243. [Google Scholar] [CrossRef]
  10. Nizam, A.; Meera, S.P.; Kumar, A. Genetic and Molecular Mechanisms Underlying Mangrove Adaptations to Intertidal Environments. iScience 2022, 25, 103547. [Google Scholar] [CrossRef]
  11. Krauss, K.W.; Mckee, K.L.; Lovelock, C.E.; Cahoon, D.R.; Saintilan, N.; Reef, R.; Chen, L. How Mangrove Forests Adjust to Rising Sea Level. New Phytol. 2014, 202, 19–34. [Google Scholar] [CrossRef] [PubMed]
  12. Hu, M.J.; Sun, W.H.; Tsai, W.C.; Xiang, S.; Lai, X.K.; Chen, D.Q.; Liu, X.D.; Wang, Y.F.; Le, Y.X.; Chen, S.M.; et al. Chromosome-Scale Assembly of the Kandelia Obovata Genome. Hortic. Res. 2020, 7, 75. [Google Scholar] [CrossRef] [PubMed]
  13. Sun, M.M.; Liu, X.; Huang, X.J.; Yang, J.J.; Qin, P.T.; Zhou, H.; Jiang, M.G.; Liao, H.Z. Genome-Wide Identification and Expression Analysis of the NAC Gene Family in Kandelia Obovata, a Typical Mangrove Plant. Curr. Issues Mol. Biol. 2022, 44, 5622–5637. [Google Scholar] [CrossRef] [PubMed]
  14. Sheue, C.R.; Liu, H.Y.; Yong, J.W.H. Kandelia Obovata (Rhizophoraceae), a New Mangrove Species from Eastern Asia. Taxon 2003, 52, 287–294. [Google Scholar] [CrossRef]
  15. Giri, C.; Ochieng, E.; Tieszen, L.L.; Zhu, Z.; Singh, A.; Loveland, T.; Masek, J.; Duke, N. Status and Distribution of Mangrove Forests of the World Using Earth Observation Satellite Data. Glob. Ecol. Biogeogr. 2011, 20, 154–159. [Google Scholar] [CrossRef]
  16. Wardiatno, Y.; Mardiansyah; Prartono, T.; Tsuchiya, M. Possible Food Sources of Macrozoobenthos in the Manko Mangrove Ecosystem, Okinawa (Japan): A Stable Isotope Analysis Approach. Trop. Life Sci. Res. 2015, 26, 53–65. [Google Scholar] [PubMed]
  17. Zhou, Q.; Tu, C.; Fu, C.; Li, Y.; Zhang, H.; Xiong, K.; Zhao, X.; Li, L.; Waniek, J.J.; Luo, Y. Characteristics and Distribution of Microplastics in the Coastal Mangrove Sediments of China. Sci. Total Environ. 2020, 703, 134807. [Google Scholar] [CrossRef]
  18. Li, T.; Ye, Y. Dynamics of Decomposition and Nutrient Release of Leaf Litter in Kandelia Obovata Mangrove Forests with Different Ages in Jiulongjiang Estuary, China. Ecol. Eng. 2014, 73, 454–460. [Google Scholar] [CrossRef]
  19. Wang, C.W.; Wong, S.L.; Liao, T.S.; Weng, J.H.; Chen, M.N.; Huang, M.Y.; Chen, C.I. Photosynthesis in Response to Salinity and Submergence in Two Rhizophoraceae Mangroves Adapted to Different Tidal Elevations. Tree Physiol. 2022, 42, 1016–1028. [Google Scholar] [CrossRef]
  20. Shen, X.; Li, R.; Chai, M.; Cheng, S.; Tam, N.F.Y.; Han, J. Does Combined Heavy Metal Stress Enhance Iron Plaque Formation and Heavy Metal Bioaccumulation in Kandelia Obovata? Environ. Exp. Bot. 2021, 186, 104463. [Google Scholar] [CrossRef]
  21. Bodin, N.; N’Gom-Kâ, R.; Kâ, S.; Thiaw, O.T.; Tito de Morais, L.; Le Loc’h, F.; Rozuel-Chartier, E.; Auger, D.; Chiffoleau, J.F. Assessment of Trace Metal Contamination in Mangrove Ecosystems from Senegal, West Africa. Chemosphere 2013, 90, 150–157. [Google Scholar] [CrossRef]
  22. Abubakar, U.S.; Zulkifli, S.Z.; Ismail, A. Heavy Metals Bioavailability and Pollution Indices Evaluation in the Mangrove Surface Sediment of Sungai Puloh, Malaysia. Environ. Earth Sci. 2018, 77, 225. [Google Scholar] [CrossRef]
  23. Cheng, S.; Tam, N.F.Y.; Li, R.; Shen, X.; Niu, Z.; Chai, M.; Qiu, G.Y. Temporal Variations in Physiological Responses of Kandelia Obovata Seedlings Exposed to Multiple Heavy Metals. Mar. Pollut. Bull. 2017, 124, 1089–1095. [Google Scholar] [CrossRef]
  24. Hu, Z.; Wenjiao, Z. Effects of Zinc Stress on Growth and Antioxidant Enzyme Responses of Kandelia Obovata Seedlings. Toxicol. Environ. Chem. 2015, 97, 1190–1201. [Google Scholar] [CrossRef]
  25. Shen, X.; Li, R.; Chai, M.; Cheng, S.; Niu, Z.; Qiu, G.Y. Interactive Effects of Single, Binary and Trinary Trace Metals (Lead, Zinc and Copper) on the Physiological Responses of Kandelia Obovata Seedlings. Environ. Geochem. Health 2019, 41, 135–148. [Google Scholar] [CrossRef] [PubMed]
  26. Huang, G.Y.; Wang, Y.S. Physiological and Biochemical Responses in the Leaves of Two Mangrove Plant Seedlings (Kandelia Candel and Bruguiera Gymnorrhiza) Exposed to Multiple Heavy Metals. J. Hazard. Mater. 2010, 182, 848–854. [Google Scholar] [CrossRef] [PubMed]
  27. Yuan, M.; Li, X.; Xiao, J.; Wang, S. Molecular and Functional Analyses of COPT/Ctr-Type Copper Transporter-like Gene Family in Rice. BMC Plant Biol. 2011, 11, 69. [Google Scholar] [CrossRef]
  28. Hu, Z.; Fu, Q.; Zheng, J.; Zhang, A.; Wang, H. Transcriptomic and Metabolomic Analyses Reveal That Melatonin Promotes Melon Root Development under Copper Stress by Inhibiting Jasmonic Acid Biosynthesis. Hortic. Res. 2020, 7, 79. [Google Scholar] [CrossRef]
  29. Cano-Gauci, D.F.; Sarkar, B. Reversible Zinc Exchange between Metallothionein and the Estrogen Receptor Zinc Finger. FEBS Lett. 1996, 386, 1–4. [Google Scholar] [CrossRef]
  30. Hussain, Q.; Ye, T.; Nkoh, N.J.; Zhou, Q.; Shang, C. Genome-Wide Identification and Expression Analysis of the Copper Transporter (COPT/Ctr) Gene Family in Kandelia Obovata, a Typical Mangrove Plant. Int. J. Mol. Sci. 2023, 24, 15579. [Google Scholar] [CrossRef]
  31. Peñarrubia, L.; Andrés-Colás, N.; Moreno, J.; Puig, S. Regulation of Copper Transport in Arabidopsis Thaliana: A Biochemical Oscillator? J. Biol. Inorg. Chem. 2010, 15, 29–36. [Google Scholar] [CrossRef] [PubMed]
  32. Burkhead, J.L.; Gogolin Reynolds, K.A.; Abdel-Ghany, S.E.; Cohu, C.M.; Pilon, M. Copper Homeostasis. New Phytol. 2009, 182, 799–816. [Google Scholar] [CrossRef] [PubMed]
  33. Qiu, Y.W.; Yu, K.F.; Zhang, G.; Wang, W.X. Accumulation and Partitioning of Seven Trace Metals in Mangroves and Sediment Cores from Three Estuarine Wetlands of Hainan Island, China. J. Hazard. Mater. 2011, 190, 631–638. [Google Scholar] [CrossRef] [PubMed]
  34. Li, R.; Li, R.; Chai, M.; Shen, X.; Xu, H.; Qiu, G. Heavy Metal Contamination and Ecological Risk in Futian Mangrove Forest Sediment in Shenzhen Bay, South China. Mar. Pollut. Bull. 2015, 101, 448–456. [Google Scholar] [CrossRef] [PubMed]
  35. Chai, M.; Li, R.; Shen, X.; Yu, L.; Han, J. Multiple Heavy Metals Affect Root Response, Iron Plaque Formation, and Metal Bioaccumulation of Kandelia Obovata. Sci. Rep. 2022, 12, 14389. [Google Scholar] [CrossRef]
  36. Fraudentali, I.; Rodrigues-pousada, R.A.; Angelini, R.; Ghuge, S.A.; Cona, A. Plant Copper Amine Oxidases: Key Players in Hormone Signaling Leading to Stress-Induced Phenotypic Plasticity. Int. J. Mol. Sci. 2021, 22, 5136. [Google Scholar] [CrossRef] [PubMed]
  37. Delis, C.; Dimou, M.; Flemetakis, E.; Aivalakis, G.; Katinakis, P. A Root- and Hypocotyl-Specific Gene Coding for Copper-Containing Amine Oxidase Is Related to Cell Expansion in Soybean Seedlings. J. Exp. Bot. 2006, 57, 101–111. [Google Scholar] [CrossRef]
  38. Zhang, H.; Yang, J.; Wang, W.; Li, D.; Hu, X.; Wang, H.; Wei, M.; Liu, Q.; Wang, Z.; Li, C. Genome-Wide Identification and Expression Profiling of the Copper Transporter Gene Family in Populus Trichocarpa. Plant Physiol. Biochem. 2015, 97, 451–460. [Google Scholar] [CrossRef]
  39. Hanada, K.; Zou, C.; Lehti-Shiu, M.D.; Shinozaki, K.; Shiu, S.H. Importance of Lineage-Specific Expansion of Plant Tandem Duplicates in the Adaptive Response to Environmental Stimuli. Plant Physiol. 2008, 148, 993–1003. [Google Scholar] [CrossRef]
  40. Yaghobi, M.; Heidari, P. Genome-Wide Analysis of Aquaporin Gene Family in Triticum Turgidum and Its Expression Profile in Response to Salt Stress. Genes. 2023, 14, 202. [Google Scholar] [CrossRef]
  41. Hashemipetroudi, S.H.; Arab, M.; Heidari, P.; Kuhlmann, M. Genome-Wide Analysis of the Laccase (LAC) Gene Family in Aeluropus Littoralis: A Focus on Identi Fi Cation, Evolution and Expression Patterns in Response to Abiotic Stresses and ABA Treatment. Front. Plant Sci. 2023, 14, 1112354. [Google Scholar] [CrossRef] [PubMed]
  42. Si, X.; Lyu, S.; Hussain, Q.; Ye, H.; Huang, C.; Li, Y.; Huang, J.; Chen, J.; Wang, K. Analysis of Delta(9) Fatty Acid Desaturase Gene Family and Their Role in Oleic Acid Accumulation in Carya Cathayensis Kernel. Front. Plant Sci. 2023, 14, 1193063. [Google Scholar] [CrossRef] [PubMed]
  43. Hussain, Q.; Zheng, M.; Chang, W.; Ashraf, M.F.; Khan, R.; Asim, M.; Riaz, M.W.; Alwahibi, M.S.; Elshikh, M.S.; Zhang, R.; et al. Genome-Wide Identification and Expression Analysis of SnRK2 Gene Family in Dormant Vegetative Buds of Liriodendron Chinense in Response to Abscisic Acid, Chilling, and Photoperiod. Genes. 2022, 13, 1305. [Google Scholar] [CrossRef] [PubMed]
  44. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  45. Shang, C.; Ye, T.; Zhou, Q.; Chen, P.; Li, X.; Li, W.; Chen, S.; Hu, Z.; Zhang, W. Genome-Wide Identification and Bioinformatics Analyses of Host Defense Peptides Snakin/GASA in Mangrove Plants. Genes 2023, 14, 923. [Google Scholar] [CrossRef] [PubMed]
  46. Hussain, Q.; Zheng, M.; Furqan, M.; Khan, R.; Yasir, M.; Farooq, S.; Zhang, R.; Wu, J. Scientia Horticulturae Genome-Wide Identification, Characterization and Expression Analysis of the ABA Receptor PYL Gene Family in Response to ABA, Photoperiod, and Chilling in Vegetative Buds of Liriodendron Chinense. Sci. Hortic. 2022, 303, 111200. [Google Scholar] [CrossRef]
  47. Sajjad, M.; Ahmad, A.; Riaz, M.W.; Hussain, Q.; Yasir, M.; Lu, M. Recent Genome Resequencing Paraded COBRA-Like Gene Family Roles in Abiotic Stress and Wood Formation in Poplar. Front. Plant Sci. 2023, 14, 1242836. [Google Scholar] [CrossRef]
  48. Liao, J.; Xu, Y.; Zhang, Z.; Zeng, L.; Qiao, Y.; Guo, Z.; Chen, J.; Jia, B.; Shang, C.; Chen, S. Effect of Cu Addition on Sedimentary Bacterial Community Structure and Heavy Metal Resistance Gene Abundance in Mangrove Wetlands. Front. Mar. Sci. 2023, 10, 1157905. [Google Scholar] [CrossRef]
Ijms 24 17312 g001
Figure 1. Illustrates the schematic depiction of the spatial arrangement of the CuAO gene throughout the four chromosomes of Kandelia obovata. The gene’s name is denoted in bule color on the right-hand side. The chromosomal locations in which the CuAO genes are indicated are represented by black letters. The numerical designations of chromosomes, known as chromosomal numbers (Chr), are typically located in the topmost area of each chromosome.
Figure 1. Illustrates the schematic depiction of the spatial arrangement of the CuAO gene throughout the four chromosomes of Kandelia obovata. The gene’s name is denoted in bule color on the right-hand side. The chromosomal locations in which the CuAO genes are indicated are represented by black letters. The numerical designations of chromosomes, known as chromosomal numbers (Chr), are typically located in the topmost area of each chromosome.
Ijms 24 17312 g001
Ijms 24 17312 g002
Figure 2. The amino acid sequence was subjected to several alignments using data obtained from each KOCuAO gene. Sequence identity and similarity were displayed as 100% in black text, 80% in green text, and 60% in grey text. The symbols “*” that appear above the sequence indicate every 10 residues of amino acids.
Figure 2. The amino acid sequence was subjected to several alignments using data obtained from each KOCuAO gene. Sequence identity and similarity were displayed as 100% in black text, 80% in green text, and 60% in grey text. The symbols “*” that appear above the sequence indicate every 10 residues of amino acids.
Ijms 24 17312 g002
Ijms 24 17312 g003
Figure 3. The three-dimensional (3D) structures of KoCuAO1-6. The SWISS-MODEL software, an online resource accessible at https://swissmodel.expasy.org/interactive, which was accessed on 15 October 2023, was employed for the prediction of three-dimensional structural homology models. The blue color characterizes the helix, whereas the pink color distinguishes the strand.
Figure 3. The three-dimensional (3D) structures of KoCuAO1-6. The SWISS-MODEL software, an online resource accessible at https://swissmodel.expasy.org/interactive, which was accessed on 15 October 2023, was employed for the prediction of three-dimensional structural homology models. The blue color characterizes the helix, whereas the pink color distinguishes the strand.
Ijms 24 17312 g003
Ijms 24 17312 g004
Figure 4. The transmembrane structures of the KoCuAO1-6 proteins. The validity of the transmembrane structures was confirmed through the utilization of the SOPMA/prabi programme. Trans* indicated the transmembrane.
Figure 4. The transmembrane structures of the KoCuAO1-6 proteins. The validity of the transmembrane structures was confirmed through the utilization of the SOPMA/prabi programme. Trans* indicated the transmembrane.
Ijms 24 17312 g004
Ijms 24 17312 g005
Figure 5. The phylogenetic study of CuAO proteins from Kandelia obovata (Ko), Arabidopsis thaliana (At), Prunus avium L. (Pav), Malus domestica (Md), Heliotropium indicum (Hi), Glycine max (Gm), and Citrous sinensis (Cs) was conducted using the most significant likelihood technique. There are three distinct groups of CuAO proteins, namely Group I, Group II, and Group III, each characterized by a unique color. The presence of CuAO proteins in Kandelia obovata is indicated by the red color of the star symbol “*”.
Figure 5. The phylogenetic study of CuAO proteins from Kandelia obovata (Ko), Arabidopsis thaliana (At), Prunus avium L. (Pav), Malus domestica (Md), Heliotropium indicum (Hi), Glycine max (Gm), and Citrous sinensis (Cs) was conducted using the most significant likelihood technique. There are three distinct groups of CuAO proteins, namely Group I, Group II, and Group III, each characterized by a unique color. The presence of CuAO proteins in Kandelia obovata is indicated by the red color of the star symbol “*”.
Ijms 24 17312 g005
Ijms 24 17312 g006
Figure 6. The gene structure and motif composition of the CuAO family genes in Kandelia obovata were investigated. The CuAO genes present in both genomes were categorized into three distinct groups based on their evolutionary relationships, specifically focusing on the gene structure of the CuAOs. The color green characterizes the visual representation of the UTR sections, whereas the CDS or exons are shown in yellow. The presence of introns is indicated by a horizontal line that is colored black. Furthermore, the conserved motif structures that have been found in the CuAOs are designated by a specific letter. Different colored boxes exhibit unique motifs.
Figure 6. The gene structure and motif composition of the CuAO family genes in Kandelia obovata were investigated. The CuAO genes present in both genomes were categorized into three distinct groups based on their evolutionary relationships, specifically focusing on the gene structure of the CuAOs. The color green characterizes the visual representation of the UTR sections, whereas the CDS or exons are shown in yellow. The presence of introns is indicated by a horizontal line that is colored black. Furthermore, the conserved motif structures that have been found in the CuAOs are designated by a specific letter. Different colored boxes exhibit unique motifs.
Ijms 24 17312 g006
Ijms 24 17312 g007
Figure 7. Regulatory elements, commonly known as CREs, have been identified inside the promoters of the KoCuAO gene. The vertical bars illustrate the positional distribution of the predicted CREs on the promoters of KoCuAOs. The promoter sequences of six KoCuAO genes, each spanning 2500 base pairs, were subjected to analysis using the PlantCARE tool. Various colors were used in this legend to represent different cis elements symbolically.
Figure 7. Regulatory elements, commonly known as CREs, have been identified inside the promoters of the KoCuAO gene. The vertical bars illustrate the positional distribution of the predicted CREs on the promoters of KoCuAOs. The promoter sequences of six KoCuAO genes, each spanning 2500 base pairs, were subjected to analysis using the PlantCARE tool. Various colors were used in this legend to represent different cis elements symbolically.
Ijms 24 17312 g007
Ijms 24 17312 g008
Figure 8. Circles serve as a visual representation of the distribution of the KoCuAO gene chromosomes and the interchromosomal connections. The orange and green lines represent the gene pair of CuAOs, while the syntenic blocks in the genome of Kandelia obovata are depicted by the grey lines in the background. Chromosomes 1–18 are shown with different colors and in a circular form.
Figure 8. Circles serve as a visual representation of the distribution of the KoCuAO gene chromosomes and the interchromosomal connections. The orange and green lines represent the gene pair of CuAOs, while the syntenic blocks in the genome of Kandelia obovata are depicted by the grey lines in the background. Chromosomes 1–18 are shown with different colors and in a circular form.
Ijms 24 17312 g008
Ijms 24 17312 g009
Figure 9. Expression of KoCuAOs in the leaves of seedling-stage Kandelia obovata plants under Cu0, Cu50, Cu100, Cu200, and Cu400 mg/L CuCl2 stress conditions was found using qRT-PCR analysis. There is a statistically significant difference (p < 0.05) observed between the control group and all other circumstances, as determined by the least significant difference (LSD) test. The presence of an asterisk (*) indicates the existence of notable disparities, with * denoting a significance level of p < 0.05 and *** indicating a significance level of p < 0.001. The “ns” shows non-significant differences. The relative gene expression is represented on the vertical axis, while the CuAO1–6 genes are depicted on the horizontal axis.
Figure 9. Expression of KoCuAOs in the leaves of seedling-stage Kandelia obovata plants under Cu0, Cu50, Cu100, Cu200, and Cu400 mg/L CuCl2 stress conditions was found using qRT-PCR analysis. There is a statistically significant difference (p < 0.05) observed between the control group and all other circumstances, as determined by the least significant difference (LSD) test. The presence of an asterisk (*) indicates the existence of notable disparities, with * denoting a significance level of p < 0.05 and *** indicating a significance level of p < 0.001. The “ns” shows non-significant differences. The relative gene expression is represented on the vertical axis, while the CuAO1–6 genes are depicted on the horizontal axis.
Ijms 24 17312 g009
Table 1. Provides a detailed overview of the CuAO gene family identified in Kandelia obovata.
Table 1. Provides a detailed overview of the CuAO gene family identified in Kandelia obovata.
NameGene IDLocationAA 1Chains 2MW 3/kDdpI 4GRAVY 5Subcellular (WoLF PSORT)Subcellular (Plant-Ploc)
KoCuAO1geneMaker00012803Chr04
2370575-2373822		159+17.099.720.309ChloroplastCytoplasm
KoCuAO2geneMaker00012751Chr04
2377019-2381467		106-11.188.710.498CytoskeletonCytoplasm
KoCuAO3geneMaker00008448Chr09
2334407-2341281		145-15.646.820.566PeroxisomeChloroplast
KoCuAO4geneMaker00006577Chr13
1070360-1075782		133-14.788.820.805PeroxisomeChloroplast
KoCuAO5geneMaker00006577Chr15
1433543-1437433		133-14.788.820.805PeroxisomeChloroplast
KoCuAO6geneMaker00006577Chr15
1441486-1445331		133-14.788.820.805VacuoleChloroplast
AA 1: Number of amino acids; Chains 2: Positive or negative chains; MW 3: Molecular weight; pI 4: Isoelectric point; GRAVY 5: Grand average of hydropathicity; Ko: Kandelia obovata; Chr: Chromosome
Table 2. Comprehensive data regarding the Ka, Ks, and Ka/Ks ratio in Kandelia obovata.
Table 2. Comprehensive data regarding the Ka, Ks, and Ka/Ks ratio in Kandelia obovata.
NameMethodKaKsKa/KsDivergence-Time (MYA)Duplicated Type
KoCuAO1 and KoCuAO2MS0.971.130.8637.56tandem
KoCuAO5 and KoCuAO6MS0.991.030.9734.17tandem
KoCuAO3 and KoCuAO4MS1.001.010.9933.67segmental
MYA: million years ago.
Table 3. Lists the primers utilized in this study’s qRT-PCR gene expression investigation.
Table 3. Lists the primers utilized in this study’s qRT-PCR gene expression investigation.
Gene NamePrimer NameSequence (5’-3’)LengthTmGC%Product Length
KoCuAO11-FGTCAACCACAGCCCTACCTC2060.0460165
1-RGTGGCTGCTGTTTGCTCTTC2060.0455
KoCuAO22-FTCAGAACCCACCATCCAAGC2059.9655223
2-RTGCCTCTGTTTTCAGCCGAT2059.9650
KoCuAO33-FTGTCGCATCTCAACGAAGCA2060.3250143
3-FCAAGTCCCCAAGGCTGCATA2060.0355
KoCuAO44-FGTGTCTGTTTGCACGAAGAGG2259.454.5193
4-RTTCACCTCAACAACTGCCAT2259.559.1
KoCuAO55-FCACTCGTTGTCACTGGACGA2059.975592
5-RCCGATCACTTGGGCTTTCCT2060.0455
KoCuAO66-FTCACACGGACTCGTTCACAG2059.9755157
6-RAGACAATCGCTGCACTCACA2059.9750
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hussain, Q.; Ye, T.; Shang, C.; Li, S.; Nkoh, J.N.; Li, W.; Hu, Z. Genome-Wide Identification, Characterization, and Expression Analysis of the Copper-Containing Amine Oxidase Gene Family in Mangrove Kandelia obovata. Int. J. Mol. Sci. 2023, 24, 17312. https://doi.org/10.3390/ijms242417312

AMA Style

Hussain Q, Ye T, Shang C, Li S, Nkoh JN, Li W, Hu Z. Genome-Wide Identification, Characterization, and Expression Analysis of the Copper-Containing Amine Oxidase Gene Family in Mangrove Kandelia obovata. International Journal of Molecular Sciences. 2023; 24(24):17312. https://doi.org/10.3390/ijms242417312

Chicago/Turabian Style

Hussain, Quaid, Ting Ye, Chenjing Shang, Sihui Li, Jackson Nkoh Nkoh, Wenyi Li, and Zhangli Hu. 2023. "Genome-Wide Identification, Characterization, and Expression Analysis of the Copper-Containing Amine Oxidase Gene Family in Mangrove Kandelia obovata" International Journal of Molecular Sciences 24, no. 24: 17312. https://doi.org/10.3390/ijms242417312

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop