Reorganization and Suppression of Store-Operated Calcium Entry in Podocytes of Type 2 Diabetic Rats
Abstract
:1. Introduction
2. Results
2.1. TRPC6 Channels and Store-Operated Ca2+ Entry in Human Podocyte Cell Line Ab8/13
2.2. Type 2 Diabetes Induction with High-Fat Diet and Low-Dose Streptozotocin
2.3. Decrease of Tg-Induced TRPC6 Single Channel Activity in Podocytes of Type 2 Diabetic Rats
2.4. DM2 Developments Result in Reorganization of Store Depletion-Induced Ca2+ Entry in Podocytes of Type 2 Diabetic Rats
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Animals and the Type 2 Diabetes Induction
4.3. The Determination of Blood Levels of Glucose, HbA1c, Insulin, Leptin, Total Cholesterol and Triglycerides
4.4. Intraperitoneal Glucose Tolerance Test
4.5. The Rat Glomeruli Isolation
4.6. Real-Time Quantitative PCR
4.7. Histological Analysis
4.8. Electrophysiology
4.9. Ca2+ Imaging
4.10. Data Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Spires, D.; Manis, A.D.; Staruschenko, A. Ion Channels and Transporters in Diabetic Kidney Disease, 1st ed.; Elsevier Inc.: Amsterdam, the Netherlands, 2019; Volume 83, ISBN 9780128177648. [Google Scholar]
- Tervaert, T.W.C.; Mooyaart, A.L.; Amann, K.; Cohen, A.H.; TerenceCook, H.; Drachenberg, C.B.; Ferrario, F.; Fogo, A.B.; Haas, M.; De Heer, E.; et al. Pathologic Classification of Diabetic Nephropathy. J. Am. Soc. Nephrol. 2010, 21, 556–563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaur, M.; Bedi, O.; Sachdeva, S.; Reddy, B.V.K.K.; Kumar, P. Rodent Animal Models: From Mild to Advanced Stages of Diabetic Nephropathy. Inflammopharmacology 2014, 22, 279–293. [Google Scholar] [CrossRef]
- Lee, S.H.; Moon, S.J.; Paeng, J.; Kang, H.Y.; Nam, B.Y.; Kim, S.; Kim, C.H.; Lee, M.J.; Oh, H.J.; Park, J.T.; et al. Podocyte Hypertrophy Precedes Apoptosis under Experimental Diabetic Conditions. Apoptosis 2015, 20, 1056–1071. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.M.W.; Nissaisorakarn, P.; Husain, I.; Jim, B. Proteinuric Kidney Diseases: A Podocyte’s Slit Diaphragm and Cytoskeleton Approach. Front. Med. 2018, 5, 1–15. [Google Scholar] [CrossRef]
- D’Agati, V.D.; Kaskel, F.J.; Falk, R.J. Focal Segmental Glomerulosclerosis. N. Engl. J. Med. 2011, 365, 2398–2411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, X.; Ishibe, S. Targeting the Podocyte Cytoskeleton: From Pathogenesis to Therapy in Proteinuric Kidney Disease. Nephrol. Dial. Transplant. 2016, 31, 1577–1583. [Google Scholar] [CrossRef] [Green Version]
- Binz-Lotter, J.; Jüngst, C.; Rinschen, M.M.; Koehler, S.; Zentis, P.; Schauss, A.; Schermer, B.; Benzing, T.; Hackl, M.J. Injured Podocytes Are Sensitized to Angiotensin II–Induced Calcium Signaling. J. Am. Soc. Nephrol. 2020, 31, 532–542. [Google Scholar] [CrossRef]
- Shalygin, A.; Shuyskiy, L.S.; Bohovyk, R.; Palygin, O.; Staruschenko, A.; Kaznacheyeva, E. Cytoskeleton Rearrangements Modulate TRPC6 Channel Activity in Podocytes. Int. J. Mol. Sci. 2021, 22, 4396. [Google Scholar] [CrossRef]
- Spires, D.; Ilatovskaya, D.V.; Levchenko, V.; North, P.E.; Geurts, A.M.; Palygin, O.; Staruschenko, A. Protective Role of Trpc6 Knockout in the Progression of Diabetic Kidney Disease. Am. J. Physiol. Ren. Physiol. 2018, 315, F1091–F1097. [Google Scholar] [CrossRef] [Green Version]
- Ilatovskaya, D.V.; Levchenko, V.; Lowing, A.; Shuyskiy, L.S.; Palygin, O.; Staruschenko, A. Podocyte Injury in Diabetic Nephropathy: Implications of Angiotensin II—Dependent Activation of TRPC Channels. Sci. Rep. 2015, 5, 17637. [Google Scholar] [CrossRef] [Green Version]
- Tian, D.; Jacobo, S.M.P.; Billing, D.; Rozkalne, A.; Gage, S.D.; Anagnostou, T.; Pavenstaedt, H.; Hsu, H.H.; Schlondorff, J.; Ramos, A.; et al. Antagonistic Regulation of Actin Dynamics and Cell Motility by TRPC5 and TRPC6 Channels (Science Signaling (2010)). Sci. Signal. 2010, 3, er11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Staruschenko, A.; Ma, R.; Palygin, O.; Dryer, S.E. Ion Channels and Channelopathies in Glomeruli. Physiol. Rev. 2023, 103, 787–854. [Google Scholar] [CrossRef]
- Hofmann, T.; Obukhov, A.G.; Schaefer, M.; Harteneck, C.; Gudermann, T.; Schultz, G. Direct Activation of Human TRPC6 and TRPC3 Channels by Diacylglycerol. Nature 1999, 397, 259–263. [Google Scholar] [CrossRef]
- Estacion, M.; Sinkins, W.G.; Jones, S.W.; Applegate, M.A.B.; Schilling, W.P. Human TRPC6 Expressed in HEK 293 Cells Forms Non-Selective Cation Channels with Limited Ca2+ Permeability. J. Physiol. 2006, 572, 359–377. [Google Scholar] [CrossRef]
- Ilatovskaya, D.V.; Palygin, O.; Chubinskiy-Nadezhdin, V.; Negulyaev, Y.A.; Ma, R.; Birnbaumer, L.; Staruschenko, A. Angiotensin II Has Acute Effects on TRPC6 Channels in Podocytes of Freshly Isolated Glomeruli. Kidney Int. 2014, 86, 506–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, J.; Ju, M.; Saleh, S.N.; Albert, A.P.; Large, W.A. TRPC6 Channels Stimulated by Angiotensin II Are Inhibited by TRPC1/C5 Channel Activity through a Ca2+ and PKC-Dependent Mechanism in Native Vascular Myocytes. J. Physiol. 2010, 588, 3671–3682. [Google Scholar] [CrossRef]
- Dryer, S.E.; Kim, E.Y. The Effects of TRPC6 Knockout in Animal Models of Kidney Disease. Biomolecules 2022, 12, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Staruschenko, A.; Spires, D.; Palygin, O. Role of TRPC6 in Progression of Diabetic Kidney Disease. Curr. Hypertens. Rep. 2019, 21, 48. [Google Scholar] [CrossRef]
- Hassanzadeh Khayyat, N.; Kim, E.Y.; Dryer, S.E. TRPC6 Inactivation Does Not Protect against Diabetic Kidney Disease in Streptozotocin (STZ)-Treated Sprague-Dawley Rats. FASEB BioAdvances 2019, 1, 773–782. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Dande, R.R.; Yu, H.; Samelko, B.; Miller, R.E.; Altintas, M.M.; Reiser, J. TRPC5 Does Not Cause or Aggravate Glomerular Disease. J. Am. Soc. Nephrol. 2018, 29, 409–415. [Google Scholar] [CrossRef] [Green Version]
- Polat, O.K.; Isaeva, E.; Sudhini, Y.R.; Knott, B.; Zhu, K.; Noben, M.; Kumar, V.S.; Endlich, N.; Mangos, S.; Reddy, T.V.; et al. The Small GTPase Regulatory Protein Rac1 Drives Podocyte Injury Independent of Cationic Channel Protein TRPC5. Kidney Int. 2023. [Google Scholar] [CrossRef]
- Tedeschi, V.; Sisalli, M.J.; Pannaccione, A.; Piccialli, I.; Molinaro, P.; Annunziato, L.; Secondo, A. Na+/Ca2+ Exchanger Isoform 1 (NCX1) and Canonical Transient Receptor Potential Channel 6 (TRPC6) Are Recruited by STIM1 to Mediate Store-Operated Calcium Entry in Primary Cortical Neurons. Cell Calcium 2022, 101, 102525. [Google Scholar] [CrossRef] [PubMed]
- Blaustein, M.P.; Lederer, W.J. Sodium/Calcium Exchange: Its Physiological Implications. Physiol. Rev. 1999, 79, 763–854. [Google Scholar] [CrossRef] [PubMed]
- Arakawa, N.; Sakaue, M.; Yokoyama, I.; Hashimoto, H.; Koyama, Y.; Baba, A.; Matsuda, T. KB-R7943 Inhibits Store-Operated Ca2+ Entry in Cultured Neurons and Astrocytes. Biochem. Biophys. Res. Commun. 2000, 279, 354–357. [Google Scholar] [CrossRef]
- Arnon, A.; Hamlyn, J.M.; Blaustein, M.P. Na+ Entry via Store-Operated Channels Modulates Ca2+ Signaling in Arterial Myocytes. Am. J. Physiol. Cell Physiol. 2000, 278, C163–C173. [Google Scholar] [CrossRef] [Green Version]
- Rosker, C.; Graziani, A.; Lukas, M.; Eder, P.; Zhu, M.X.; Romanin, C.; Groschner, K. Ca2+ Signaling by TRPC3 Involves Na+ Entry and Local Coupling to the Na+/Ca2+ Exchanger. J. Biol. Chem. 2004, 279, 13696–13704. [Google Scholar] [CrossRef] [Green Version]
- Lemos, V.S.; Poburko, D.; Liao, C.-H.; Cole, W.C.; Breemen, C. van Na+ Entry via TRPC6 Causes Ca2+ Entry via NCX Reversal in ATP Stimulated Smooth Muscle Cells. Biochem. Biophys. Res. Commun. 2007, 352, 130–134. [Google Scholar] [CrossRef]
- Zhang, B.; Liu, B.; Roos, C.M.; Thompson, M.A.; Prakash, Y.S.; Miller, J.D.; Guo, R.W. TRPC6 and TRPC4 Heteromultimerization Mediates Store Depletion-Activated NCX1 Reversal in Proliferative Vascular Smooth Muscle Cells. Channels 2018, 12, 119–125. [Google Scholar] [CrossRef]
- Soboloff, J.; Spassova, M.; Xu, W.; He, L.P.; Cuesta, N.; Gill, D.L. Role of Endogenous TRPC6 Channels in Ca2+ Signal Generation in A7r5 Smooth Muscle Cells. J. Biol. Chem. 2005, 280, 39786–39794. [Google Scholar] [CrossRef] [Green Version]
- Poburko, D.; Liao, C.H.; Lemos, V.S.; Lin, E.; Maruyama, Y.; Cole, W.C.; Van Breemen, C. Transient Receptor Potential Channel 6-Mediated, Localized Cytosolic [Na+] Transients Drive Na+/Ca2+ Exchanger-Mediated Ca2+ Entry in Purinergically Stimulated Aorta Smooth Muscle Cells. Circ. Res. 2007, 101, 1030–1038. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, K.T.; Liu, X.; Ong, H.L.; Swaim, W.; Ambudkar, I.S. Local Ca2+ Entry via Orai1 Regulates Plasma Membrane Recruitment of TRPC1 and Controls Cytosolic Ca2+ Signals Required for Specific Cell Functions. PLoS Biol. 2011, 9, 26–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shalygin, A.; Kolesnikov, D.; Glushankova, L.; Gusev, K.; Skopin, A.; Skobeleva, K.; Kaznacheyeva, E.V. Role of STIM2 and Orai Proteins in Regulating TRPC1 Channel Activity upon Calcium Store Depletion. Cell Calcium 2021, 97, 102432. [Google Scholar] [CrossRef]
- Saul, S.; Stanisz, H.; Backes, C.S.; Schwarz, E.C.; Hoth, M. How ORAI and TRP Channels Interfere with Each Other: Interaction Models and Examples from the Immune System and the Skin. Eur. J. Pharmacol. 2014, 739, 49–59. [Google Scholar] [CrossRef]
- Chen, W.; Thielmann, I.; Gupta, S.; Subramanian, H.; Stegner, D.; van Kruchten, R.; Dietrich, A.; Gambaryan, S.; Heemskerk, J.W.M.; Hermanns, H.M.; et al. Orai1-Induced Store-Operated Ca2+ Entry Enhances Phospholipase Activity and Modulates Canonical Transient Receptor Potential Channel 6 Function in Murine Platelets. J. Thromb. Haemost. 2014, 12, 528–539. [Google Scholar] [CrossRef] [PubMed]
- Miao, L.; Wei, D.; Zhang, Y.; Liu, J.; Lu, S.; Zhang, A.; Huang, S. Effects of Stromal Interaction Molecule 1 or Orai1 Overexpression on the Associated Proteins and Permeability of Podocytes. Nephrology 2016, 21, 959–967. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.; Chaudhari, S.; Shotorbani, P.Y.; Ding, Y.; Chen, Z.; Kasetti, R.; Zode, G.; Ma, R. Enhanced Orai1-Mediated Store-Operated Ca2+ Channel/Calpain Signaling Contributes to High Glucose-Induced Podocyte Injury. J. Biol. Chem. 2022, 298, 101990. [Google Scholar] [CrossRef]
- Kim, J.; Hwang, K.; Dang, B.T.N.; Eom, M.; Kong, I.D.; Gwack, Y.; Yu, S.; Gee, H.Y.; Birnbaumer, L.; Park, K.; et al. Insulin-Activated Store-Operated Ca2+ Entry via Orai1 Induces Podocyte Actin Remodeling and Causes Proteinuria. Nat. Commun. 2021, 12, 6537. [Google Scholar] [CrossRef] [PubMed]
- Estacion, M.; Li, S.; Sinkins, W.G.; Gosling, M.; Bahra, P.; Poll, C.; Westwick, J.; Schilling, W.P. Activation of Human TRPC6 Channels by Receptor Stimulation. J. Biol. Chem. 2004, 279, 22047–22056. [Google Scholar] [CrossRef] [Green Version]
- Inoue, R.; Okada, T.; Onoue, H.; Hara, Y.; Shimizu, S.; Naitoh, S.; Ito, Y.; Mori, Y. The Transient Receptor Potential Protein Homologue TRP6 Is the Essential Component of Vascular Alpha;1-Adrenoceptor-Activated Ca2+-Permeable Cation Channel. Circ. Res. 2001, 88, 325–332. [Google Scholar] [CrossRef] [Green Version]
- Boulay, G.; Zhu, X.; Peyton, M.; Jiang, M.; Hurst, R.; Stefani, E.; Birnbaumer, L. Cloning and Expression of a Novel Mammalian Homolog of Drosophila Transient Receptor Potential (Trp) Involved in Calcium Entry Secondary to Activation of Receptors Coupled by the G(q) Class of g Protein. J. Biol. Chem. 1997, 272, 29672–29680. [Google Scholar] [CrossRef] [Green Version]
- Liao, Y.; Erxleben, C.; Yildirim, E.; Abramowitz, J.; Armstrong, D.L.; Birnbaumer, L. Orai Proteins Interact with TRPC Channels and Confer Responsiveness to Store Depletion. Proc. Natl. Acad. Sci. USA 2007, 104, 4682–4687. [Google Scholar] [CrossRef] [Green Version]
- Jardin, I.; Diez-Bello, R.; Lopez, J.; Redondo, P.; Salido, G.; Smani, T.; Rosado, J. TRPC6 Channels Are Required for Proliferation, Migration and Invasion of Breast Cancer Cell Lines by Modulation of Orai1 and Orai3 Surface Exposure. Cancers 2018, 10, 331. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Sun, S.; Wu, L.; Pchitskaya, E.; Zakharova, O.; Fon Tacer, K.; Bezprozvanny, I. Store-Operated Calcium Channel Complex in Postsynaptic Spines: A New Therapeutic Target for Alzheimer’s Disease Treatment. J. Neurosci. 2016, 36, 11837–11850. [Google Scholar] [CrossRef] [Green Version]
- Jardin, I.; Gómez, L.J.; Salido, G.M.; Rosado, J.A. Dynamic Interaction of HTRPC6 with the Orai1–STIM1 Complex or HTRPC3 Mediates Its Role in Capacitative or Non-Capacitative Ca2+ Entry Pathways. Biochem. J. 2009, 420, 267–277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Preguiça, I.; Alves, A.; Nunes, S.; Gomes, P.; Fernandes, R.; Viana, S.D.; Reis, F. Diet-Induced Rodent Models of Diabetic Peripheral Neuropathy, Retinopathy and Nephropathy. Nutrients 2020, 12, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kitada, M.; Ogura, Y.; Koya, D. Rodent Models of Diabetic Nephropathy: Their Utility and Limitations. Int. J. Nephrol. Renovasc. Dis. 2016, 9, 279–290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaudhari, S.; Ma, R. Store-Operated Calcium Entry and Diabetic Complications. Exp. Biol. Med. 2016, 241, 343–352. [Google Scholar] [CrossRef] [Green Version]
- Leuner, K.; Kazanski, V.; Muller, M.; Essin, K.; Henke, B.; Gollasch, M.; Harteneck, C.; Müller, W.E. Hyperforin—A Key Constituent of St. John’s Wort Specifically Activates TRPC6 Channels. FASEB J. 2007, 21, 4101–4111. [Google Scholar] [CrossRef] [Green Version]
- Sugano, M.; Yamato, H.; Hayashi, T.; Ochiai, H.; Kakuchi, J.; Goto, S.; Nishijima, F.; Iino, N.; Kazama, J.J.; Takeuchi, T.; et al. High-Fat Diet in Low-Dose-Streptozotocin-Treated Heminephrectomized Rats Induces All Features of Human Type 2 Diabetic Nephropathy: A New Rat Model of Diabetic Nephropathy. Nutr. Metab. Cardiovasc. Dis. 2006, 16, 477–484. [Google Scholar] [CrossRef]
- Ilatovskaya, D.V.; Staruschenko, A. Single-Channel Analysis of TRPC Channels in the Podocytes of Freshly Isolated Glomeruli. Methods Mol. Biol. 2013, 998, 355–369. [Google Scholar] [CrossRef] [Green Version]
- Guo, X.X.; Wang, Y.; Wang, K.; Ji, B.P.; Zhou, F. Stability of a Type 2 Diabetes Rat Model Induced by High-Fat Diet Feeding with Low-Dose Streptozotocin Injection. J. Zhejiang Univ. Sci. B 2018, 19, 559–569. [Google Scholar] [CrossRef]
- Giralt-López, A.; Den Bosch, M.M.V.; Vergara, A.; García-Carro, C.; Seron, D.; Jacobs-Cachá, C.; Soler, M.J. Revisiting Experimental Models of Diabetic Nephropathy. Int. J. Mol. Sci. 2020, 21, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Derkach, K.V.; Bondareva, V.M.; Chistyakova, O.V.; Berstein, L.M.; Shpakov, A.O. The Effect of Long-Term Intranasal Serotonin Treatment on Metabolic Parameters and Hormonal Signaling in Rats with High-Fat Diet/Low-Dose Streptozotocin-Induced Type 2 Diabetes. Int. J. Endocrinol. 2015, 2015, 255459. [Google Scholar] [CrossRef] [Green Version]
- Fischer, M. Renin Angiotensin System and Gender Differences in the Cardiovascular System. Cardiovasc. Res. 2002, 53, 672–677. [Google Scholar] [CrossRef] [Green Version]
- Komukai, K.; Mochizuki, S.; Yoshimura, M. Gender and the Renin-Angiotensin-Aldosterone System. Fundam. Clin. Pharmacol. 2010, 24, 687–698. [Google Scholar] [CrossRef] [PubMed]
- de Alencar Franco Costa, D.; Todiras, M.; Campos, L.A.; Cipolla-Neto, J.; Bader, M.; Baltatu, O.C. Sex-dependent Differences in Renal Angiotensinogen as an Early Marker of Diabetic Nephropathy. Acta Physiol. 2015, 213, 740–746. [Google Scholar] [CrossRef] [Green Version]
- Piani, F.; Melena, I.; Tommerdahl, K.L.; Nokoff, N.; Nelson, R.G.; Pavkov, M.E.; van Raalte, D.H.; Cherney, D.Z.; Johnson, R.J.; Nadeau, K.J.; et al. Sex-Related Differences in Diabetic Kidney Disease: A Review on the Mechanisms and Potential Therapeutic Implications. J. Diabetes Complicat. 2021, 35, 107841. [Google Scholar] [CrossRef] [PubMed]
- Clotet-Freixas, S.; Soler, M.J.; Palau, V.; Anguiano, L.; Gimeno, J.; Konvalinka, A.; Pascual, J.; Riera, M. Sex Dimorphism in ANGII-Mediated Crosstalk between ACE2 and ACE in Diabetic Nephropathy. Lab. Investig. 2018, 98, 1237–1249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cantillon, D.J.; Stein, K.M.; Markowitz, S.M.; Mittal, S.; Shah, B.K.; Morin, D.P.; Zacks, E.S.; Janik, M.; Ageno, S.; Mauer, A.C.; et al. Predictive Value of Microvolt T-Wave Alternans in Patients with Left Ventricular Dysfunction. J. Am. Coll. Cardiol. 2007, 50, 166–173. [Google Scholar] [CrossRef] [Green Version]
- Abbate, R.; Mannucci, E.; Cioni, G.; Fatini, C.; Marcucci, R. Diabetes and Sex: From Pathophysiology to Personalized Medicine. Intern. Emerg. Med. 2012, 7, 215–219. [Google Scholar] [CrossRef]
- Clotet, S.; Riera, M.; Pascual, J.; Soler, M.J. RAS and Sex Differences in Diabetic Nephropathy. Am. J. Physiol. Physiol. 2016, 310, F945–F957. [Google Scholar] [CrossRef] [Green Version]
- Clotet, S.; Soler, M.J.; Rebull, M.; Gimeno, J.; Gurley, S.B.; Pascual, J.; Riera, M. Gonadectomy Prevents the Increase in Blood Pressure and Glomerular Injury in Angiotensin-Converting Enzyme 2 Knockout Diabetic Male Mice. Effects on Renin–Angiotensin System. J. Hypertens. 2016, 34, 1752–1765. [Google Scholar] [CrossRef] [Green Version]
- Cayouette, S.; Lussier, M.P.; Mathieu, E.L.; Bousquet, S.M.; Boulay, G. Exocytotic Insertion of TRPC6 Channel into the Plasma Membrane upon G q Protein-Coupled Receptor Activation. J. Biol. Chem. 2004, 279, 7241–7246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roshanravan, H.; Kim, E.Y.; Dryer, S.E. 20-Hydroxyeicosatetraenoic Acid (20-HETE) Modulates Canonical Transient Receptor Potential-6 (TRPC6) Channels in Podocytes. Front. Physiol. 2016, 7, 351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, E.Y.; Anderson, M.; Dryer, S.E. Insulin Increases Surface Expression of TRPC6 Channels in Podocytes: Role of NADPH Oxidases and Reactive Oxygen Species. Am. J. Physiol. Ren. Physiol. 2012, 302, 298–307. [Google Scholar] [CrossRef] [Green Version]
- Liu, B.C.; Song, X.; Lu, X.Y.; Li, D.T.; Eaton, D.C.; Shen, B.Z.; Li, X.Q.; Ma, H.P. High Glucose Induces Podocyte Apoptosis by Stimulating TRPC6 via Elevation of Reactive Oxygen Species. Biochim. Biophys. Acta Mol. Cell Res. 2013, 1833, 1434–1442. [Google Scholar] [CrossRef] [Green Version]
- Gloy, J.; Henger, A.; Fischer, K.G.; Nitschke, R.; Bleich, M.; Mundel, P.; Schollmeyer, P.; Greger, R.; Pavenstadt, H. Angiotensin II Modulates Cellular Functions of Podocytes. Kidney Int. Suppl. 1998, 54, 168–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, J.; Mori, E.; Mori, Y.; Mori, M.; Li, J.; Ito, Y.; Inoue, R. Multiple Regulation by Calcium of Murine Homologues of Transient Receptor Potential Proteins TRPC6 and TRPC7 Expressed in HEK293 Cells. J. Physiol. 2004, 561, 415–432. [Google Scholar] [CrossRef]
- Groschner, K.; Romanin, C.; Graier, W.F. Store-Operated Ca2+ Entry (SOCE) Pathways; Groschner, K., Graier, W.F., Romanin, C., Eds.; Springer: Vienna, Austria, 2012; ISBN 978-3-7091-0961-8. [Google Scholar]
- Szrejder, M.; Rachubik, P.; Rogacka, D.; Audzeyenka, I.; Rychłowski, M.; Kreft, E.; Angielski, S.; Piwkowska, A. Metformin Reduces TRPC6 Expression through AMPK Activation and Modulates Cytoskeleton Dynamics in Podocytes under Diabetic Conditions. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165610. [Google Scholar] [CrossRef]
- Wang, Q.; Tian, X.; Wang, Y.; Wang, Y.; Li, J.; Zhao, T.; Li, P. Role of Transient Receptor Potential Canonical Channel 6 (TRPC6) in Diabetic Kidney Disease by Regulating Podocyte Actin Cytoskeleton Rearrangement. J. Diabetes Res. 2020, 2020, 6897390. [Google Scholar] [CrossRef]
- Goel, M.; Sinkins, W.; Keightley, A.; Kinter, M.; Schilling, W.P. Proteomic Analysis of TRPC5- and TRPC6-Binding Partners Reveals Interaction with the Plasmalemmal Na+/K+-ATPase. Pflügers Arch. Eur. J. Physiol. 2005, 451, 87–98. [Google Scholar] [CrossRef] [PubMed]
- Saleem, M.A.; O’Hare, M.J.; Reiser, J.; Coward, R.J.; Inward, C.D.; Farren, T.; Chang, Y.X.; Ni, L.; Mathieson, P.W.; Mundel, P. A Conditionally Immortalized Human Podocyte Cell Line Demonstrating Nephrin and Podocin Expression. J. Am. Soc. Nephrol. 2002, 13, 630–638. [Google Scholar] [CrossRef] [PubMed]
- Derkach, K.V.; Bakhtyukov, A.A.; Romanova, I.V.; Zorina, I.I.; Bayunova, L.V.; Bondareva, V.M.; Morina, I.Y.; Kumar Roy, V.; Shpakov, A.O. The Effect of Metformin Treatment on the Basal and Gonadotropin-Stimulated Steroidogenesis in Male Rats with Type 2 Diabetes Mellitus. Andrologia 2020, 52, 1–13. [Google Scholar] [CrossRef]
- Ilatovskaya, D.V.; Palygin, O.; Levchenko, V.; Staruschenko, A. Single-Channel Analysis and Calcium Imaging in the Podocytes of the Freshly Isolated Glomeruli. J. Vis. Exp. 2015, 2015, 52850. [Google Scholar] [CrossRef] [Green Version]
Parameters | Ctr | DM2 | p |
---|---|---|---|
Body Weight, g | 354.3 ± 8.8 (n = 18) | 416.0 ± 6.6 (n = 18) | <0.001 |
Kidneys weight, g | 2.2 ± 0.2 (n = 18) | 2.8 ± 0.1 (n = 18) | <0.01 |
Glucose (fasting), mM | 5.21 ± 0.14 (n = 18) | 6.18 ± 0.23 (n = 18) | <0.001 |
Glucose (120 min after glucose load in IGTT), mM | 6.13 ± 0.28 (n = 18) | 8.61 ± 0.39 (n = 18) | <0.001 |
AUC0-120, rel. units | 1207 ± 44 (n = 18) | 1779 ± 71 (n = 18) | <0.001 |
Insulin (basal), ng/mL | 0.70 ± 0.07 (n = 8) | 1.13 ± 0.13 (n = 8) | <0.01 |
Insulin (30 min after glucose load in IGTT), ng/mL | 2.38 ± 0.15 (n = 8) | 3.28 ± 0.51 (n = 8) | >0.05 |
Insulin (120 min after glucose load in IGTT), ng/mL | 1.22 ± 0.14 (n = 8) | 2.31 ± 0.19 (n = 8) | <0.001 |
Index IR (basal), rel. units | 3.53 ± 0.46 (n = 8) | 7.61 ± 0.88 (n = 8) | <0.005 |
Index IR (120 min after load in IGTT), rel. units | 6.38 ± 0.95 (n = 8) | 20.76 ± 1.58 (n = 8) | <0.001 |
Leptin (basal), ng/mL | 3.35 ± 0.26 (n = 8) | 5.48 ± 0.60 (n = 8) | <0.01 |
Leptin (120 min after glucose load in IGTT), ng/mL | 4.50 ± 0.55 (n = 8) | 9.52 ± 0.82 (n = 8) | <0.001 |
HbA1c, % | 4.00 ± 0.08 (n = 8) | 5.20 ± 0.10 (n = 8) | <0.001 |
Total triglycerides | 1.04 ± 0.04 (n = 8) | 1.28 ± 0.09 (n = 8) | <0.05 |
Total Cholesterol | 4.11 ± 0.10 (n = 8) | 5.18 ± 0.34 (n = 8) | <0.05 |
Water consumption, mL/day | 33.9 ± 1.7 (n = 18) | 23.7 ± 1.9 (n = 18) | <0.05 |
Urine volume, mL/day | 10.8 ± 1.2 (n = 18) | 6.4 ± 1.4 (n = 18) | <0.001 |
Creatinine, blood, μmol/L | 68.9 ± 2.1 (n = 18) | 100.5 ± 3.8 (n = 18) | <0.001 |
Creatinine, urea, μmol/L | 12.6 ± 1.0 (n = 18) | 25.2 ± 2.1 (n = 18) | <0.001 |
Creatinine clearance, mL/min | 1312 ± 56 (n = 18) | 769 ± 43 (n = 18) | <0.001 |
Urea protein, mg/mL | 0.39 ± 0.03 (n = 18) | 0.69 ± 0.06 (n = 18) | <0.01 |
Genes | Forward/Reverse Sequence | Product Size (bp) | Annealing Temperature (°C) | Genbank |
---|---|---|---|---|
TRPC6 | (For) TACTGGTGTGCTCCTTGCAG | 141 | 55 | NM_053559.1 |
(Rev) GAGCTTGGTGCCTTCAAATC | ||||
Nphs1 | (For) AAGTACGAATGGACCCCTATGAC | 176 | 56 | XM_008759187.2 |
(Rev) CAGGGCTGTAGGAAACGGGTG | ||||
Stim1 | (For) ACTCTCCGGAAGCAGCTAGA | 124 | 55 | NM_001108496.2 |
(Rev) CCTTCGACAACCGAAGGTCA | ||||
Stim2 | (For) TGGGGATTCAGGCACTTGTT | 126 | 55 | XM_008770187.2 |
(Rev) CAAAAGTCAGCACAGTCCCAC | ||||
Orai1 | (For) TGATGAGCCTCAACGAGCAC | 234 | 56 | NM_001013982.1 |
(Rev) TGATCATGAGGGCGAACAGG | ||||
18S | (For) GGACACGGACAGGATTGACA | 50 | 56 | NR_046237 |
(Rev) ACCCACGGAATCGAGAAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gusev, K.; Shalygin, A.; Kolesnikov, D.; Shuyskiy, L.; Makeenok, S.; Glushankova, L.; Sivak, K.; Yakovlev, K.; Orshanskaya, Y.; Wang, G.; et al. Reorganization and Suppression of Store-Operated Calcium Entry in Podocytes of Type 2 Diabetic Rats. Int. J. Mol. Sci. 2023, 24, 7259. https://doi.org/10.3390/ijms24087259
Gusev K, Shalygin A, Kolesnikov D, Shuyskiy L, Makeenok S, Glushankova L, Sivak K, Yakovlev K, Orshanskaya Y, Wang G, et al. Reorganization and Suppression of Store-Operated Calcium Entry in Podocytes of Type 2 Diabetic Rats. International Journal of Molecular Sciences. 2023; 24(8):7259. https://doi.org/10.3390/ijms24087259
Chicago/Turabian StyleGusev, Konstantin, Alexey Shalygin, Dmitrii Kolesnikov, Leonid Shuyskiy, Sofia Makeenok, Lyubov Glushankova, Konstantin Sivak, Kirill Yakovlev, Yana Orshanskaya, Guanghui Wang, and et al. 2023. "Reorganization and Suppression of Store-Operated Calcium Entry in Podocytes of Type 2 Diabetic Rats" International Journal of Molecular Sciences 24, no. 8: 7259. https://doi.org/10.3390/ijms24087259