Qualification of the Microsatellite Instability Analysis (MSA) for Bladder Cancer Detection: The Technical Challenges of Concordance Analysis
Abstract
:1. Introduction
2. Results
Development of Triplet Multiplex PCR
3. Discussion
4. Materials and Methods
4.1. Matched Blood and Urine Genomic DNA Samples
4.2. DNA Extraction and Quantification
4.3. STR Targets and PCR Primers
4.4. Multiplex PCR: Triplet (Three Tube) Multiplex PCR
4.5. Capillary Electrophoresis
4.6. Calculation of Loss of Heterozygosity
4.7. Data Analysis
4.8. ABI 3100 DNA Analyzer Acceptance Criteria
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Aaltonen, L.A.; Peltomäki, P.; Leach, F.S.; Sistonen, P.; Pylkkänen, L.; Mecklin, J.-P.; Järvinen, H.; Powell, S.M.; Jen, J.; Hamilton, S.R.; et al. Clues to the pathogenesis of familial colorectal cancer. Science 1993, 260, 812–816. [Google Scholar] [CrossRef] [PubMed]
- Ionov, Y.; Peinado, M.A.; Malkhosyan, S.; Shibata, D.; Perucho, M. Ubiquitous somatic mutations in simple repeated sequences reveal a new mechanism for colonic carcinogenesis. Nature 1993, 363, 558–561. [Google Scholar] [CrossRef] [PubMed]
- Thibodeau, S.N.; Bren, G.; Schaid, D. Microsatellite instability in cancer of the proximal colon. Science 1993, 260, 816–819. [Google Scholar] [CrossRef] [PubMed]
- Imai, K.; Yamamoto, H. Carcinogenesis and microsatellite instability: The interrelationship between genetics and epigenetics. Carcinogenesis 2008, 29, 673–680. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, H.; Adachi, Y.; Taniguchi, H.; Kunimoto, H.; Nosho, K.; Suzuki, H.; Shinomura, Y. Interrelationship between microsatellite instability and microRNA in gastrointestinal cancer. World J. Gastroenterol. 2012, 18, 2745–2755. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, H.; Watanabe, Y.; Maehata, T.; Morita, R.; Yoshida, Y.; Oikawa, R.; Ishigooka, S.; Ozawa, S.-I.; Matsuo, Y.; Hosoya, K.; et al. An updated review of gastric cancer in the next-generation sequencing era: Insights from bench to bedside and vice versa. World J. Gastroenterol. 2014, 20, 3927–3937. [Google Scholar] [CrossRef]
- Yamamoto, H.; Imai, K. Microsatellite instability: An update. Arch. Toxicol. 2015, 89, 899–921. [Google Scholar] [CrossRef] [PubMed]
- Gelsomino, F.; Barbolini, M.; Spallanzani, A.; Pugliese, G.; Cascinu, S. The evolving role of microsatellite instability in colorectal cancer: A review. Cancer Treat. Rev. 2016, 51, 19–26. [Google Scholar] [CrossRef]
- de la Chapelle, A.; Hampel, H. Clinical relevance of microsatellite instability in colorectal cancer. J. Clin. Oncol. 2010, 28, 3380–3387. [Google Scholar] [CrossRef]
- Bacher, J.W.; Flanagan, L.A.; Smalley, R.L.; Nassif, N.A.; Burgart, L.J.; Halberg, R.B.; Megid, W.M.A.; Thibodeau, S.N. Development of a fluorescent multiplex assay for detection of MSI-High tumors. Dis. Markers 2004, 20, 237–250. [Google Scholar] [CrossRef]
- Jemal, A.; Siegel, R.; Ward, E.; Hao, Y.; Xu, J.; Thun, M.J. Cancer statistics, 2009. CA Cancer J. Clin. 2009, 59, 225–249. [Google Scholar] [CrossRef] [PubMed]
- Botteman, M.F.; Pashos, C.L.; Redaelli, A.; Laskin, B.; Hauser, R. The health economics of bladder cancer: A comprehensive review of the published literature. Pharmacoeconomics 2003, 21, 1315–1330. [Google Scholar] [CrossRef] [PubMed]
- Lotan, Y.; Kamat, A.M.; Porter, M.P.; Robinson, V.L.; Shore, N.; Jewett, M.; Schelhammer, P.F.; White, R.d.; Quale, D.; Lee, C.T. Key concerns about the current state of bladder cancerr: A position paper from the Bladder Cancer Think Tank, the Bladder Cancer Advocacy Network, and the Society of Urologic Oncology. Cancer 2009, 115, 4096–4103. [Google Scholar] [CrossRef] [PubMed]
- Lotan, Y.; Svatek, R.S.; Malats, N. Screening for bladder cancer: A perspective. World J. Urol. 2008, 26, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Shariat, S.F.; Lotan, Y.; Vickers, A.; Karakiewicz, P.I.; Schmitz-Dräger, B.J.; Goebell, P.J.; Malats, N. Statistical consideration for clinical biomarker research in bladder cancer. Urol. Oncol. 2010, 28, 389–400. [Google Scholar] [CrossRef] [PubMed]
- Lotan, Y.; Roehrborn, C.G. Sensitivity and specificity of commonly available bladder tumor markers versus cytology: Results of a comprehensive literature review and meta-analyses. Urology 2003, 61, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Bensalah, K.; Montorsi, F.; Shariat, S.F. Challenges of cancer biomarker profiling. Eur. Urol. 2007, 52, 1601–1609. [Google Scholar] [CrossRef] [PubMed]
- Babjuk, M.; Burger, M.; Capoun, O.; Cohen, D.; Compérat, E.M.; Dominguez Escrig, J.L.; Gontero, P.; Liedberg, F.; Masson-Lecomte, A.; Mostafid, A.H.; et al. European Association of Urology Guidelines on Non-muscle-invasive Bladder Cancer (Ta, T1, and Carcinoma in Situ). Eur. Urol. 2022, 81, 75–94. [Google Scholar] [CrossRef]
- Chang, S.S.; Boorjian, S.A.; Chou, R.; Clark, P.E.; Daneshmand, S.; Konety, B.R.; Pruthi, R.; Quale, D.Z.; Ritch, C.R.; Seigne, J.D.; et al. Diagnosis and treatment of non-muscle invasive bladder cancer: AUA/SUO guideline. J. Urol. 2016, 196, 1021. [Google Scholar] [CrossRef]
- Mitra, A.P.; Datar, R.H.; Cote, R.J. Molecular pathways in invasive bladder cancer: New insights into mechanisms, progression, and target identification. J. Clin. Oncol. 2006, 24, 5552–5564. [Google Scholar] [CrossRef]
- Mitra, A.P.; Cote, R.J. Molecular pathogenesis and diagnostics of bladder cancer. Annu. Rev. Pathol. Mech. Dis. 2009, 4, 251–285. [Google Scholar] [CrossRef] [PubMed]
- Moon, J.J.; Lu, A.; Moon, C. Role of genomic instability in human carcinogenesis. Exp. Biol. Med. 2019, 244, 227–240. [Google Scholar] [CrossRef] [PubMed]
- Saran, K.K.; Gould, D.; Godec, C.J.; Verma, R.S. Genetics of bladder cancer. J. Mol. Med. 1996, 74, 441–445. [Google Scholar] [CrossRef] [PubMed]
- Ørntoft, T.F.; Wolf, H. Molecular alterations in bladder cancer. Urol. Res. 1998, 26, 223–233. [Google Scholar] [CrossRef] [PubMed]
- Skacel, M.; Pettay, J.D.; Tsiftsakis, E.K.; Procop, G.W.; Biscotti, C.V.; Tubbs, R.R. Validation of a multicolor interphase fluorescence in situ hybridization assay for detection of transitional cell carcinoma on fresh and archival thin-layer, liquid-based cytology slides. Anal. Quant. Cytol. Histol. 2001, 23, 381–387. [Google Scholar]
- Lopez-Beltran, A.; Amin, M.B.; Oliveira, P.S.; Montironi, R.; Algaba, F.; McKenney, J.K.; de Torres, I.; Mazerolles, C.; Wang, M.; Cheng, L. Urothelial carcinoma of the bladder, lipid cell variant: Clinicopathologic findings and LOH analysis. Am. J. Surg. Pathol. 2010, 34, 371–376. [Google Scholar] [CrossRef]
- Ploussard, G.; Dubosq, F.; Soliman, H.; Verine, J.; Desgrandchamps, F.; De Thé, H.; Mongiat-Artus, P. Prognostic value of loss of heterozygosity at chromosome 9p in non–muscle-invasive bladder cancer. Urology 2010, 76, 513.e13–513.e18. [Google Scholar] [CrossRef]
- Cai, T.; Nesi, G.; Canto, M.D.; Mondaini, N.; Piazzini, M.; Bartoletti, R. Prognostic role of loss of heterozygosity on chromosome 18 in patients with low-risk nonmuscle-invasive bladder cancer: Results from a prospective study. J. Surg. Res. 2010, 161, 89–94. [Google Scholar] [CrossRef]
- Sibley, K.; Cuthbert-Heavens, D.; Knowles, M.A. Loss of heterozygosity at 4p16.3 and mutation of FGFR3 in transitional cell carcinoma. Oncogene 2001, 20, 686–691. [Google Scholar] [CrossRef]
- Yoon, D.-S.; Li, L.; Zhang, R.-D.; Kram, A.; Ro, J.Y.; Johnston, D.; Grossman, H.B.; Scherer, S.; Czerniak, B. Genetic mapping and DNA sequence-based analysis of deleted regions on chromosome 16 involved in progression of bladder cancer from occult preneoplastic conditions to invasive disease. Oncogene 2001, 20, 5005–5014. [Google Scholar] [CrossRef]
- Docimo, S.G.; Chow, N.-H.; Steiner, G.; Silver, R.I.; Rodriguez, R.; Kinsman, S.; Sidransky, D.; Schoenberg, M. Detection of adenocarcinoma by urinary microsatellite analysis after augmentation cystoplasty. Urology 1999, 54, 561. [Google Scholar] [CrossRef] [PubMed]
- Szarvas, T. The diagnostic value of microsatellite LOH analysis and the prognostic relevance of angiogenic gene expression in urinary bladder cancer. Magy. Onkol. 2009, 53, 385–389. [Google Scholar] [CrossRef] [PubMed]
- Bartoletti, R.; Cai, T.; Nesi, G.; Roberta Girardi, L.; Baroni, G.; Dal Canto, M. Loss of P16 expression and chromosome 9p21 LOH in predicting outcome of patients affected by superficial bladder cancer. J. Surg. Res. 2007, 143, 422–427. [Google Scholar] [CrossRef] [PubMed]
- Mao, L.; Schoenberg, M.P.; Scicchitano, M.; Erozan, Y.S.; Merlo, A.; Schwab, D.; Sidransky, D. Molecular detection of primary bladder cancer by microsatellite analysis. Science 1996, 271, 659–662. [Google Scholar] [CrossRef]
- Ellegren, H. Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet. 2004, 5, 435–445. [Google Scholar] [CrossRef] [PubMed]
- Seripa, D.; Parrella, P.; Gallucci, M.; Gravina, C.; Papa, S.; Fortunato, P.; Alcini, A.; Flammia, G.; Lazzari, M.; Fazio, V.M. Sensitive detection of transitional cell carcinoma of the bladder by microsatellite analysis of cells exfoliated in urine. Int. J. Cancer 2001, 95, 364–369. [Google Scholar] [CrossRef] [PubMed]
- Frigerio, S.; Padberg, B.C.; Strebel, R.T.; Lenggenhager, D.M.; Messthaler, A.; Abdou, M.-T.; Moch, H.; Zimmermann, D.R. Improved detection of bladder carcinoma cells in voided urine by standardized microsatellite analysis. Int. J. Cancer 2007, 121, 329–338. [Google Scholar] [CrossRef] [PubMed]
- Hoque, M.O.; Lee, J.; Begum, S.; Yamashita, K.; Engles, J.M.; Schoenberg, M.; Westra, W.H.; Sidransky, D. High-throughput molecular analysis of urine sediment for the detection of bladder cancer by high-density single-nucleotide polymorphism array. Cancer Res. 2003, 63, 5723–5726. [Google Scholar]
- de Bekker-Grob, E.W.; van der Aa, M.N.M.; Zwarthoff, E.C.; Eijkemans, M.J.C.; van Rhijn, B.W.; van der Kwast, T.H.; Steyerberg, E.W. Non-muscle-invasive bladder cancer surveillance for which cystoscopy is partly replaced by microsatellite analysis of urine: A cost-effective alternative? BJU Int. 2009, 104, 41–47. [Google Scholar] [CrossRef]
- van der Aa, M.N.M.; Zwarthoff, E.C.; Steyerberg, E.W.; Boogaard, M.W.; Nijsen, Y.; van der Keur, K.A.; van Exsel, A.J.A.; Kirkels, W.J.; Bangma, C.; van der Kwast, T.H. Microsatellite analysis of voided-urine samples for surveillance of low-grade non-muscle-invasive urothelial carcinoma: Feasibility and clinical utility in a prospective multicenter study (cost-effectiveness of follow-up of urinary bladder cancer trial [CEFUB]). Eur. Urol. 2009, 55, 659–668. [Google Scholar] [CrossRef]
- Wild, P.J.; Fuchs, T.; Stoehr, R.; Zimmermann, D.; Frigerio, S.; Padberg, B.; Steiner, I.; Zwarthoff, E.C.; Burger, M.; Denzinger, S.; et al. Detection of urothelial bladder cancer cells in voided urine can be improved by a combination of cytology and standardized microsatellite analysis. Cancer Epidemiol. Biomark. Prev. 2009, 18, 1798–1806. [Google Scholar] [CrossRef] [PubMed]
- Steiner, G.; Schoenberg, M.P.; Linn, J.F.; Mao, L.; Sidransky, D. Detection of bladder cancer recurrence by microsatellite analysis of urine. Nat. Med. 1997, 3, 621–624. [Google Scholar] [CrossRef] [PubMed]
- van Rhijn, B.W.G.; Lurkin, I.; Kirkels, W.J.; van der Kwast, T.H.; Zwarthoff, E.C. Microsatellite analysis—DNA test in urine competes with cystoscopy in follow-up of superficial bladder carcinoma. Cancer 2001, 92, 768–775. [Google Scholar] [CrossRef] [PubMed]
- Amira, N.; Mourah, S.; Rozet, F.; Teillac, P.; Fiet, J.; Aubin, P.; Cortesse, A.; Desgrandchamps, F.; Le Duc, A.; Cussenot, O.; et al. Non-invasive molecular detection of bladder cancer recurrence. Int. J. Cancer 2002, 101, 293–297. [Google Scholar] [CrossRef] [PubMed]
- National Cancer Institute (NCI). Microsatellite Analysis of Urinary Sediment in Detecting Bladder Cancer. Available online: https://clinicaltrials.gov/ct2/show/NCT00095589 (accessed on 9 September 2023).
- OriginalRef48. Available online: https://edrn.nci.nih.gov/protocols/108-detection-of-bladder-ca-by-microsatellite-analysis (accessed on 9 September 2023).
- Linn, J.F.; Lango, M.; Halachmi, S.; Schoenberg, M.P.; Sidransky, D. Microsatellite analysis and telomerase activity in archived tissue and urine samples of bladder cancer patients. Int. J. Cancer 1997, 74, 625–629. [Google Scholar] [CrossRef]
- Schneider, A.; Borgnat, S.; Lang, H.; Régine, O.; Lindner, V.; Kassem, M.; Saussine, C.; Oudet, P.; Jacqmin, D.; Gaub, M.P. Evaluation of microsatellite analysis in urine sediment for diagnosis of bladder cancer. Cancer Res. 2000, 60, 4617–4622. [Google Scholar] [PubMed]
- Sourvinos, G.; Kazanis, I.; Delakas, D.; Cranidis, A.; Spandidos, D.A. Genetic detection of bladder cancer by microsatellite analysis of p16, RB1 and p53 tumor suppressor genes. J. Urol. 2001, 165, 249–252. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zheng, S.; Fan, Z.; Gao, Y.; Di, X.; Wang, D.; Xiao, Z.; Li, C.; An, Q.; Cheng, S. A comparison between microsatellite analysis and cytology of urine for the detection of bladder cancer. Cancer Lett. 2001, 172, 55–58. [Google Scholar] [CrossRef]
- Zhang, J.; Fan, Z.; Gao, Y.; Xiao, Z.; Li, C.; An, Q.; Cheng, S. Detecting bladder cancer in the Chinese by microsatellite analysis: Ethnic and etiologic considerations. J. Natl. Cancer Inst. 2001, 93, 45–50. [Google Scholar] [CrossRef]
- Stein, J.P.; Lieskovsky, G.; Cote, R.; Groshen, S.; Feng, A.-C.; Boyd, S.; Skinner, E.; Bochner, B.; Thangathurai, D.; Mikhail, M.; et al. Radical cystectomy in the treatment of invasive bladder cancer: Long-term results in 1054 patients. J. Clin. Oncol. 2001, 19, 666–675. [Google Scholar] [CrossRef]
- Foresman, W.H.; Messing, E.M. Bladder cancer: Natural history, tumor markers, and early detection strategies. Semin. Surg. Oncol. 1997, 13, 299–306. [Google Scholar] [CrossRef]
- Parekh, D.J.; Bochner, B.H.; Dalbagni, G. Superficial and muscle-invasive bladder cancer: Principles of management for outcomes assessments. J. Clin. Oncol. 2006, 24, 5519–5527. [Google Scholar] [CrossRef] [PubMed]
- Wakui, M.; Shiigai, T. Urinary tract cancer screening through analysis of urinary red blood cell volume distribution. Int. J. Urol. 2000, 7, 248–253. [Google Scholar] [CrossRef] [PubMed]
- Grossfeld, G.D.; Wolf, J.S., Jr.; Litwan, M.S.; Hricak, H.; Shuler, C.L.; Agerter, D.C.; Carroll, P.R. Asymptomatic microscopic hematuria in adults: Summary of the AUA best practice policy recommendations. Am. Fam. Physician 2001, 63, 1145–1154. [Google Scholar] [PubMed]
- Messing, E.M.; Young, T.B.; Hunt, V.B.; Wehbie, J.M.; Rust, P. Urinary tract cancers found by homescreening with hematuria dipsticks in healthy men over 50 years of age. Cancer 1989, 64, 2361–2367. [Google Scholar] [CrossRef] [PubMed]
- Messing, E.M.; Young, T.B.; Hunt, V.B.; Newton, M.A.; Bram, L.L.; Vaillancourt, A.; Hisgen, W.J.; Greenberg, E.B.; Kuglitsch, M.E.; Wegenke, J.D. Hematuria home screening: Repeat testing results. J. Urol. 1995, 154, 57–61. [Google Scholar] [CrossRef] [PubMed]
- Messing, E.M.; Young, T.B.; Hunt, V.B.; Roecker, E.B.; Vaillancourt, A.M.; Hisgen, W.J.; Greenberg, E.B.; Kuglitsch, M.E.; Wegenke, J.D. Home screening for hematuria: Results of a multi-clinic study. J. Urol. 1992, 148, 289–292. [Google Scholar] [CrossRef] [PubMed]
- OriginalRef46 EU Paper. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:42014X0808(02) (accessed on 9 September 2023).
- Mourah, S.; Cussenot, O.; Vimont, V.; Desgrandchamps, F.; Teillac, P.; Cochant-Priollet, B.; Le Duc, A.; Fiet, J.; Soliman, H. Assessment of microsatellite instability in urine in the detection of transitional-cell carcinoma of the bladder. Int. J. Cancer 1998, 79, 629–633. [Google Scholar] [CrossRef]
- Steiner, G.; Reinschmidt, G.; Müller, S.C. Molecular genetic diagnosis of de novo and recurrent bladder cancer. Electrophoresis 1999, 20, 280–282. [Google Scholar] [CrossRef]
- Baron, A.; Mastroeni, F.; Moore, P.S.; Bonetti, F.; Orlandini, S.; Manfrin, E.; Schiavone, D.; Migliorini, F.; Lusuardi, L.; Mobilio, G.; et al. Detection of bladder cancer by semi-automated microsatellite analysis of urine sediment. Adv. Clin. Path. 2000, 4, 19–24. [Google Scholar]
- Christensen, M.; Wolf, H.; Orntoft, T.F. Microsatellite alterations in urinary sediments from patients with cystitis and bladder cancer. Int. J. Cancer 2000, 85, 614–617. [Google Scholar] [CrossRef]
- van Rhijn, B.W.; Lurkin, I.; Chopin, D.K.; Kirkels, W.J.; Thiery, J.-P.; van der Kwast, T.H.; Radvanyi, F.; Zwarthoff, E.C. Combined microsatellite and FGFR3 mutation analysis enables a highly sensitive detection of urothelial cell carcinoma in voided urine. Clin. Cancer Res. 2003, 9, 257–263. [Google Scholar] [PubMed]
- Zeger, S.L.; Liang, K.-Y. An overview of methods for the analysis of longitudinal data. Stat. Med. 1992, 11, 1825–1839. [Google Scholar] [CrossRef] [PubMed]
- van Rhijn, B.W.G.; van der Poel, H.G.; van der Kwast, T.H. Urine markers for bladder cancer surveillance: A systematic review. Eur. Urol. 2005, 47, 736–748. [Google Scholar] [CrossRef] [PubMed]
- van Rhijn, B.W.; Smit, M.; van Geenen, D.; Wijnmaalen, A.; Kirkels, W.J.; van der Kwast, T.H.; Kuenen-Boumeester, V.; Zwarthoff, E.C. Surveillance with microsatellite analysis of urine in bladder cancer patients treated by radiotherapy. Eur. Urol. 2003, 43, 369–373. [Google Scholar] [CrossRef] [PubMed]
- Mian, C.; Maier, K.; Comploj, E.; Lodde, M.; Berner, L.; Lusuardi, L.; Palermo, S.; Vittadello, F.; Pycha, A. uCyt+/ImmunoCyt™ in the detection of recurrent urothelial carcinoma: An update on 1991 analyses. Cancer 2006, 108, 60–65. [Google Scholar] [CrossRef] [PubMed]
- Lodde, M.; Mian, C.; Comploj, E.; Palermo, S.; Longhi, E.; Marberger, M.; Pycha, A. uCyt+ test: Alternative to cystoscopy for less-invasive follow-up of patients with low risk of urothelial carcinoma. Urology 2006, 67, 950–954. [Google Scholar] [CrossRef]
- Kumar, A.; Kumar, R.; Gupta, N.P. Comparison of NMP22 BladderChek test and urine cytology for the detection of recurrent bladder cancer. Jpn. J. Clin. Oncol. 2006, 36, 172–175. [Google Scholar] [CrossRef]
- Kibar, Y.; Goktas, S.; Kilic, S.; Yaman, H.; Onguru, O.; Peker, A.F. Prognostic value of cytology, nuclear matrix protein 22 (NMP22) test, and urinary bladder cancer II (UBC II) test in early recurrent transitional cell carcinoma of the bladder. Ann. Clin. Lab. Sci. 2006, 36, 31–38. [Google Scholar]
- Mian, C.; Lodde, M.; Comploj, E.; Lusuardi, L.; Palermo, S.; Mian, M.; Maier, K.; Pycha, A. Multiprobe fluorescence in situ hybridisation: Prognostic perspectives in superficial bladder cancer. J. Clin. Pathol. 2006, 59, 984–987. [Google Scholar] [CrossRef]
- May, M.; Hakenberg, O.W.; Gunia, S.; Pohling, P.; Helke, C.; Lübbe, L.; Nowack, R.; Siegsmund, M.; Hoschke, B. Comparative diagnostic value of urine cytology, UBC-ELISA, and fluorescence in situ hybridization for detection of transitional cell carcinoma of urinary bladder in routine clinical practice. Urology 2007, 70, 449–453. [Google Scholar] [CrossRef] [PubMed]
- Bergman, J.; Reznichek, R.C.; Rajfer, J. Surveillance of patients with bladder carcinoma using fluorescent in-situ hybridization on bladder washings. BJU Int. 2008, 101, 26–29. [Google Scholar] [CrossRef] [PubMed]
- Raitanen, M.-P. The role of BTA stat Test in follow-up of patients with bladder cancer: Results from FinnBladder studies. World J. Urol. 2008, 26, 45–50. [Google Scholar] [CrossRef] [PubMed]
- Babjuk, M.; Böhle, A.; Burger, M.; Capoun, O.; Cohen, D.; Compérat, E.M.; Hernández, V.; Kaasinen, E.; Palou, J.; Rouprêt, M.; et al. EAU Guidelines on non–muscle-invasive urothelial carcinoma of the bladder: Update 2016. Eur. Urol. 2017, 71, 447–461. [Google Scholar] [CrossRef]
- Moon, C.; Gordon, M.; Moon, D.; Reynolds, T. Microsatellite instability analysis (MSA) for bladder cancer: Past history and future directions. Int. J. Mol. Sci. 2021, 22, 12864. [Google Scholar] [CrossRef]
- Reynolds, T.; Gordon, M.; Monar, G.V.F.; Moon, D.; Moon, C. Development of Multiplex Polymerase Chain Reaction (PCR)-Based MSA Assay for Bladder Cancer Detection. Int. J. Mol. Sci. 2023, 24, 13651. [Google Scholar] [CrossRef]
- Flores Monar, G.V.; Reynolds, T.; Gordon, M.; Moon, D.; Moon, C. Molecular Markers for Bladder Cancer Screening: An Insight into Bladder Cancer and FDA-Approved Biomarkers. Int. J. Mol. Sci. 2023, 24, 14374. [Google Scholar] [CrossRef]
Scheme. | No. of Cancers Detected by MSA | Sensitivity (%) | Healthy Controls with Neg MSA Result | Specificity (%) |
---|---|---|---|---|
Mao et al. [34] | 19/20 | 95 | 5 out of 5 | 100 |
Steiner et al. [42] | 10/11 | 91 | 10 out of 10 | 100 |
Linn et al. [47] | 13/15 | 87 | N/A | N/A |
Schneider et al. [48] | 87/103 | 84 | N/A | N/A |
Sourvinos et al. [49] | 26/28 | 93 | 10 out of 10 | 100 |
Zhang et al. [50] | 73/81 | 90 | 19/19 | 100 |
Seripa et al. [36] | 33/34 | 97 | 11 out of 11 | 100 |
Zhang et al. [51] | 22/23 | 96 | 17/17 | 100 |
Amira et al. [44] | 44/47 | 94 | N/A | N/A |
Overall | 327/362 | 90% | 72/72 | 100% |
2A | |||||
Locus | Repeat Type | Size Range | Channel | K562-Allele Sizes | |
Color | |||||
D4S243 | (ATAG)n | 165–192 bp | Blue | 169 bp | |
D4S243 | |||||
FGA | (TTTC)n | 299–361 bp | Green | 328 bp | |
D9S747 | (GATA)n | 179–201 bp | Green | 185 bp | |
Dl 7S654 | (CA)n | 194–218 bp | Yellow | 216 bp | |
D9S162 | (CA)n | 117–148 bp | Yellow | 143 bp | |
D17S695 | (AAAG)n | 170–220 bp | Red | 185, 200 bp | |
MBP & A | (ATGG)n | 200–242/119–151 | Blue | 207, 215, 119 bp | |
D21S1245 | (AAAG)n | 209–293 bp | Green | 236, 255 bp | |
D16S310 | (ATAG)n | 127–170 bp | Green | 155, 160 bp | |
D20S48 | (GT)n | 251–269 bp | Yellow | 261 bp | |
THOl | (TCAT)n | 174–209 bp | Yellow | 198 bp | |
D9Sl 71 | (CA)n | 109–129 bp | Yellow | 126 bp | |
D16S476 | (AAAG)n | 176–230 bp | Red | 187 209 bp | |
IFN-A | (GT)n | 132–152 bp | Red | no product | |
2B | |||||
Marker | Lower Limit | Upper Limit | |||
D4S243 | 0.68 | 1.33 | |||
FGA | 0.6 | 1.43 | |||
D9S747 | 0.63 | 1.42 | |||
Dl 7S654 | 0.71 | 1.36 | |||
DI 7S695 | 0.49 | 1.61 | |||
MBP | 0.63 | 1.45 | |||
MBPA | 0.71 | 1.37 | |||
D16S310 | 0.6 | 1.34 | |||
D9S162 | 0.51 | 1.53 | |||
THOl | 0.46 | 1.53 | |||
IFN-A | 0.68 | 1.43 | |||
D21Sl245 | 0.58 | 1.42 | |||
D20S48 | 0.62 | 1.46 | |||
D9Sl 71 | 0.72 | 1.36 | |||
D16S476 | 0.54 | 1.65 | |||
2C | |||||
Multiplex | Target | Chromosome | STR | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
MP1 | D4S243 | 4 | (ATAG)n | 6-FAM-TCAGTCTCTCTTTCTCCTTGCA | TAGGAGCCTGTGGTCCTGTT |
FGA | 4 | (TTTC)n | VIC-GACATCTTAACTGGCATTCATGG | CTTCTCAGATCCTCTGACACTCG | |
D9S747 | 9 | (GATA)n | VIC-GCCATTATTGACTCTGGAAAAGAC | CAGGCTCTCAAAATATGAACAAAAT | |
D17S654 | 17 | (CA)n | NED-ACCTAGGCCATGTTCACAGC | GAGCAGAATGAGAGGCCAAG | |
D17S695 | 16 | (AAAG)n | PET-CTGGGCAACAAGAGCAAAAT | TTTGTTGTTGTTCATTGACTTCAGTC | |
MP2 | D9S162 | 9 | (CA)n | NED-GCAACCATTTATGTGGTTAGGG | TCCCACAACAAATCTCCTCAC |
MBP | 18 | (ATGG)n | 6-FAM-GGACCTCGTGAATTACAATCACT | ATCCATTTACCTACCTGTTCATCC | |
D16S310 | 16 | (ATAG)n | VIC-GGGCAACAAGGAGAGACTCT | AAAAAAGGACCTGCCTTTATCC | |
THO1 | 11 | (TCAT)n | NED-AGGCTCTAGCAGCAGCTCAT | TGTACACAGGGCTTCCGAGT | |
IFN-A | 9 | (GT)n | PET-TGCGCGTTAAGTTAATTGGTT | GTAAGGTGGAAACCCCCACT | |
MP3 | D21S1245 | 21 | (AAAG)n | VIC-CCAGAAAATGACACATGAAGGA | TTGTTGAGGATTTTTGCATCA |
D20S48 | 20 | (GT)n | NED-ATGGTCTCCAGTCCCATCTG | TTGACCTGGATGAGCATGTG | |
D9S171 | 9 | (CA)n | NED-TCTGTCTGCTGCCTCCTACA | GATCCTATTTTTCTTGGGGCTA | |
D16S476 | 16 | (AAAG)n | 6-FAM-GGCAACAAGAGCAAAACTCC | GGTGCTCTCTGCCCTATCTG |
Sample Number | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Marker | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | |
MP1 | D4S243 | 11 | 11 | 22 | 11 | 22 | 13 | 11 | 22 | 11 | 22 | 33 | 22 | 11 | 11 | 21 | 33 | 11 | 22 | 11 | 11 |
FGA | 22 | 11 | 22 | 11 | 11 | 22 | 11 | 13 | 11 | 11 | 22 | 22 | 11 | 11 | 11 | 13 | 11 | 11 | 11 | 11 | |
D9S747 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 22 | 22 | 11 | 33 | 22 | 22 | 11 | 22 | 11 | 11 | 22 | 11 | 22 | |
D17S654 | 11 | 11 | 22 | 22 | 11 | 11 | 21 | 21 | 11 | 21 | 33 | 22 | 21 | 21 | 11 | 33 | 13 | 11 | 11 | 31 | |
D17S695 | 11 | 11 | 22 | 22 | 22 | 12 | 11 | 12 | 12 | 22 | 33 | 22 | 11 | 12 | 12 | 32 | 22 | 11 | 12 | 11 | |
MP2 | MBP | 11 | 11 | 22 | 11 | 22 | 11 | 11 | 33 | 11 | 11 | 33 | 22 | 11 | 11 | 11 | 33 | 11 | 11 | 11 | 11 |
MBPa | 11 | 11 | 22 | 11 | 22 | 11 | 11 | 33 | 11 | 11 | 22 | 22 | 13 | 11 | 21 | 33 | 11 | 11 | 22 | 11 | |
D16S310 | 22 | 22 | 22 | 22 | 22 | 11 | 21 | 11 | 11 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 11 | 22 | 22 | |
TH01 | 11 | 21 | 22 | 12 | 11 | 12 | 11 | 21 | 11 | 12 | 23 | 22 | 13 | 11 | 21 | 11 | 12 | 21 | 11 | 11 | |
D9S162 | 11 | 12 | 22 | 21 | 11 | 21 | 11 | 12 | 11 | 21 | 32 | 22 | 11 | 11 | 32 | 11 | 21 | 12 | 11 | 11 | |
IFN-A | 21 | 22 | 22 | 21 | 22 | 11 | 22 | 22 | 22 | 21 | 22 | 22 | 22 | 22 | 13 | 13 | 11 | 41 | 22 | 11 | |
MP3 | D21S1245 | 12 | 11 | 22 | 12 | 11 | 12 | 11 | 33 | 22 | 12 | 22 | 22 | 33 | 22 | 13 | 33 | 22 | 11 | 11 | 11 |
D20S48 | 11 | 21 | 22 | 11 | 11 | 11 | 21 | 21 | 11 | 21 | 23 | 22 | 21 | 11 | 11 | 23 | 11 | 11 | 21 | 21 | |
D9S171 | 11 | 21 | 22 | 22 | 11 | 11 | 21 | 11 | 11 | 12 | 11 | 22 | 22 | 21 | 13 | 23 | 12 | 12 | 22 | 11 | |
D16S476 | 12 | 11 | 22 | 22 | 11 | 12 | 12 | 12 | 22 | 22 | 32 | 22 | 12 | 12 | 12 | 21 | 21 | 12 | 12 | 12 | |
SP | D13SB02 | 21 | 22 | 22 | 12 | 22 | 21 | 21 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 32 | 21 | 11 | 22 | 22 |
AIB | 1 | 1 | 2 | 1 | 1 | 1 | 1 | 3 | 1 | 1 | 3 | 2 | 3 | 1 | 3 | 3 | 1 | 1 | 1 | 3 | |
UMMC | 1 | 1 | 2 | 1 | 1 | 3 | 1 | 3 | 1 | 1 | 3 | 2 | 3 | 1 | 3 | 3 | 3 | 1 | 1 | 1 | |
Agreement | Y | Y | Y | Y | Y | N | Y | Y | Y | Y | Y | Y | Y | Y | Y | Y | N | Y | Y | N |
Sample Number | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Marker | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | |
MP1 | D4S243 | 11 | 33 | 11 | 11 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 22 | 31 | 11 | 11 | 11 | 11 | 11 |
FGA | 11 | 33 | 11 | 11 | 13 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 13 | 11 | 11 | 22 | |
D9S747 | 11 | 33 | 11 | 11 | 22 | 31 | 22 | 11 | 31 | 22 | 22 | 22 | 33 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | |
D17S654 | 21 | 33 | 11 | 31 | 11 | 31 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 22 | 31 | 22 | 33 | 11 | 11 | 11 | |
D17S695 | 21 | 33 | 11 | 22 | 11 | 31 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 22 | 21 | 11 | 33 | 22 | 22 | 11 | |
MP2 | MBP | 22 | 33 | 11 | 11 | 11 | 31 | 11 | 11 | 31 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 33 | 22 | 11 | 11 |
MBPa | 11 | 33 | 11 | 11 | 22 | 22 | 22 | 11 | 31 | 11 | 11 | 22 | 11 | 22 | 11 | 22 | 33 | 22 | 11 | 11 | |
D16S310 | 11 | 12 | 11 | 11 | 11 | 11 | 22 | 11 | 31 | 13 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | |
TH01 | 11 | 22 | 11 | 11 | 11 | 22 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 12 | 22 | |
D9S162 | 11 | 33 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 11 | 22 | 22 | 11 | 11 | 11 | 22 | 11 | 22 | |
IFN-A | 11 | 22 | 22 | 13 | 22 | 22 | 22 | 22 | 31 | 11 | 11 | 11 | 33 | 11 | 11 | 22 | 11 | 22 | 22 | 22 | |
MP3 | D21S1245 | 22 | 22 | 21 | 11 | 21 | 22 | 22 | 11 | 21 | 21 | 11 | 22 | 21 | 11 | 21 | 21 | 11 | 11 | 11 | 11 |
D20S48 | 11 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | |
D9S171 | 11 | 33 | 11 | 22 | 13 | 11 | 11 | 22 | 32 | 13 | 11 | 11 | 33 | 22 | 22 | 11 | 22 | 22 | 22 | 11 | |
D16S476 | 21 | 22 | 11 | 22 | 11 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 22 | 11 | 22 | 22 | 11 | |
SP | D13SB02 | 22 | 22 | 22 | 31 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 11 | 22 | 22 | 22 | 22 |
AIB | 1 | 3 | 1 | 3 | 1 | 3 | 1 | 1 | 3 | 1 | 1 | 1 | 3 | 1 | 3 | 1 | 3 | 1 | 1 | 1 | |
Maryland | 1 | 3 | 1 | 3 | 3 | 1 | 1 | 1 | 1 | 3 | 1 | 1 | 3 | 1 | 1 | 1 | 3 | 1 | 1 | 1 | |
Agreement | Y | Y | Y | Y | N | N | Y | Y | N | N | Y | Y | Y | Y | N | Y | N | Y | Y | N |
Sample Number | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Marker | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | |
MP1 | D4S243 | 11 | 33 | 11 | 11 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 22 | 31 | 11 | 11 | 11 | 11 | 11 |
FGA | 11 | 33 | 11 | 11 | 13 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 13 | 11 | 11 | 22 | |
D9S747 | 11 | 33 | 11 | 11 | 22 | 31 | 22 | 11 | 31 | 22 | 22 | 22 | 33 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | |
D17S654 | 21 | 33 | 11 | 31 | 11 | 31 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 22 | 31 | 22 | 33 | 11 | 11 | 11 | |
D17S695 | 21 | 33 | 11 | 22 | 11 | 31 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 22 | 21 | 11 | 33 | 22 | 22 | 11 | |
MP2 | MBP | 22 | 33 | 11 | 11 | 11 | 31 | 11 | 11 | 31 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 33 | 22 | 11 | 11 |
MBPa | 11 | 33 | 11 | 11 | 22 | 22 | 22 | 11 | 31 | 11 | 11 | 22 | 11 | 22 | 11 | 22 | 33 | 22 | 11 | 11 | |
D16S310 | 11 | 12 | 11 | 11 | 11 | 11 | 22 | 11 | 31 | 13 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | |
TH01 | 11 | 22 | 11 | 11 | 11 | 22 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 12 | 22 | |
D9S162 | 11 | 33 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 11 | 22 | 22 | 11 | 11 | 11 | 22 | 11 | 22 | |
IFN-A | 11 | 22 | 22 | 13 | 22 | 22 | 22 | 22 | 31 | 11 | 11 | 11 | 33 | 11 | 11 | 22 | 11 | 22 | 22 | 22 | |
MP3 | D21S1245 | 22 | 22 | 21 | 11 | 21 | 22 | 22 | 11 | 21 | 21 | 11 | 22 | 21 | 11 | 21 | 21 | 11 | 11 | 11 | 11 |
D20S48 | 11 | 11 | 11 | 22 | 11 | 11 | 11 | 22 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | 11 | |
D9S171 | 11 | 33 | 11 | 22 | 13 | 11 | 11 | 22 | 32 | 13 | 11 | 11 | 33 | 22 | 22 | 11 | 22 | 22 | 22 | 11 | |
D16S476 | 21 | 22 | 11 | 22 | 11 | 11 | 22 | 11 | 11 | 11 | 11 | 11 | 11 | 22 | 11 | 22 | 11 | 22 | 22 | 11 | |
SP | D13SB02 | 22 | 22 | 22 | 31 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 22 | 11 | 22 | 22 | 22 | 22 |
AIB | 1 | 3 | 1 | 3 | 1 | 3 | 1 | 1 | 3 | 1 | 1 | 1 | 3 | 1 | 3 | 1 | 3 | 1 | 1 | 1 | |
Maryland | 1 | 3 | 1 | 3 | 3 | 1 | 1 | 1 | 1 | 3 | 1 | 1 | 3 | 1 | 1 | 1 | 3 | 1 | 1 | 1 | |
Agreement | Y | Y | Y | Y | N | N | Y | Y | N | N | Y | Y | Y | Y | N | Y | N | Y | Y | N |
1BU | 2BU | 3BU | 4BU | 5BU | 6BU | 7BU | 8BU | 9BU | 10BU | 11BU | 12BU | 13BU | 14BU | 15BU | 16BU | 17BU | 18BU | 19BU | 20BU | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Marker | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M | A | M |
D4S243 | 2 | 2 | 1 | 1 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 3 | 3 | 4 | 1 | 1 | 2 | 2 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 |
FGA | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
D9S747 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 3 | 1 | 1 | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 2 | 2 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 2 |
D17S654 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 3 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 |
D17S695 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 2 | 2 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 2 | 2 | 4 | 2 | 1 | 1 | 2 | 2 | 1 | 1 |
MBP | 1 | 1 | 1 | 1 | 2 | 2 | 3 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 4 | 2 | 2 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 |
MBPa | 1 | 1 | 2 | 2 | 2 | 2 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 2 | 2 | 3 | 4 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 2 | 2 |
D16S310 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 4 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 1 | 1 |
TH01 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 3 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 |
D9S162 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 3 | 3 | 3 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | 2 | 2 | 1 | 1 |
IFN-A | 1 | 1 | 2 | 2 | 2 | 2 | 1 | 3 | 3 | 3 | 1 | 1 | 2 | 2 | 1 | 1 | 2 | 2 | 2 | 2 | 2 | 2 | 3 | 3 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 2 | 2 | 1 | 1 | 3 | 3 | 1 | 1 |
D21S1245 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 4 | 4 | 1 | 1 | 4 | 1 | 4 | 1 | 1 | 1 | 2 | 2 | 1 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 4 | 4 |
D20S48 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 3 | 3 | 2 | 2 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
D9S171 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 2 | 3 | 3 | 1 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 1 | 2 | 3 | 3 | 1 | 1 |
D16S476 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 1 | 1 | 3 | 3 | 1 | 1 | 1 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | 1 | 1 |
Overall Evaluation | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 3 | 3 | 3 | 3 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 3 | 1 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Reynolds, T.; Bertsche, K.; Moon, D.; Moon, C. Qualification of the Microsatellite Instability Analysis (MSA) for Bladder Cancer Detection: The Technical Challenges of Concordance Analysis. Int. J. Mol. Sci. 2024, 25, 209. https://doi.org/10.3390/ijms25010209
Reynolds T, Bertsche K, Moon D, Moon C. Qualification of the Microsatellite Instability Analysis (MSA) for Bladder Cancer Detection: The Technical Challenges of Concordance Analysis. International Journal of Molecular Sciences. 2024; 25(1):209. https://doi.org/10.3390/ijms25010209
Chicago/Turabian StyleReynolds, Thomas, Katie Bertsche, David Moon, and Chulso Moon. 2024. "Qualification of the Microsatellite Instability Analysis (MSA) for Bladder Cancer Detection: The Technical Challenges of Concordance Analysis" International Journal of Molecular Sciences 25, no. 1: 209. https://doi.org/10.3390/ijms25010209