Next Article in Journal
Full-Length Transcriptome Analysis of Skeletal Muscle of Jiangquan Black Pig at Different Developmental Stages
Previous Article in Journal
A Double-Humanized Mouse Model for Studying Host Gut Microbiome–Immune Interactions in Gulf War Illness
Previous Article in Special Issue
The Transcriptional Regulator TfmR Directly Regulates Two Pathogenic Pathways in Xanthomonas oryzae pv. oryzicola
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 11
10.3390/ijms25116091
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Employing Genomic Tools to Explore the Molecular Mechanisms behind the Enhancement of Plant Growth and Stress Resilience Facilitated by a Burkholderia Rhizobacterial Strain

by
Yueh-Long Chang
1,
Yu-Cheng Chang
1,
Andi Kurniawan
1,2,
Po-Chun Chang
1,
Ting-Yu Liou
1,
Wen-Der Wang
1 and
Huey-wen Chuang
1,*
1
Department of Agricultural Biotechnology, National Chiayi University, Chiayi 600355, Taiwan
2
Department of Agronomy, Brawijaya University, Malang 65145, Indonesia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(11), 6091; https://doi.org/10.3390/ijms25116091
Submission received: 30 April 2024 / Revised: 28 May 2024 / Accepted: 30 May 2024 / Published: 31 May 2024
(This article belongs to the Special Issue Plant Pathogen Interactions 2.0)
Browse Figures
Versions Notes

Abstract

:
The rhizobacterial strain BJ3 showed 16S rDNA sequence similarity to species within the Burkholderia genus. Its complete genome sequence revealed a 97% match with Burkholderia contaminans and uncovered gene clusters essential for plant-growth-promoting traits (PGPTs). These clusters include genes responsible for producing indole acetic acid (IAA), osmolytes, non-ribosomal peptides (NRPS), volatile organic compounds (VOCs), siderophores, lipopolysaccharides, hydrolytic enzymes, and spermidine. Additionally, the genome contains genes for nitrogen fixation and phosphate solubilization, as well as a gene encoding 1-aminocyclopropane-1-carboxylate (ACC) deaminase. The treatment with BJ3 enhanced root architecture, boosted vegetative growth, and accelerated early flowering in Arabidopsis. Treated seedlings also showed increased lignin production and antioxidant capabilities, as well as notably increased tolerance to water deficit and high salinity. An RNA-seq transcriptome analysis indicated that BJ3 treatment significantly activated genes related to immunity induction, hormone signaling, and vegetative growth. It specifically activated genes involved in the production of auxin, ethylene, and salicylic acid (SA), as well as genes involved in the synthesis of defense compounds like glucosinolates, camalexin, and terpenoids. The expression of AP2/ERF transcription factors was markedly increased. These findings highlight BJ3’s potential to produce various bioactive metabolites and its ability to activate auxin, ethylene, and SA signaling in Arabidopsis, positioning it as a new Burkholderia strain that could significantly improve plant growth, stress resilience, and immune function.

1. Introduction

Employing beneficial microorganisms to promote plant growth and reduce stress damage has become a valuable strategy in agricultural practice. Known as plant-growth-promoting rhizobacteria (PGPR), these beneficial microbes in the rhizosphere significantly impact plant health and productivity. PGPR can enhance plant growth by producing phytohormones such as indole acetic acid (IAA), a natural form of auxin, which is an essential regulator of lateral root formation [1]. Rhizobacteria may increase nutrient availability for plant growth through their activities of mineral solubilization, siderophore production, and nitrogen fixation [2]. Alternatively, PGPR enhance plant growth vigor through the production of various antimicrobial metabolites that suppress the viability of pathogens [3]. As a biocontrol agent, PGPR not only directly target pathogens but also produce elicitors that enhance a plant’s innate defenses, a response known as induced systemic resistance (ISR). In this defense mechanism, jasmonic acid (JA) and ethylene signals are crucial for reshaping plant metabolism to build resistance against pathogens [4]. ISR, elicited by PGPR, exhibits phenotypic similarities to pathogen-induced systemic acquired resistance (SAR), in which salicylic acid (SA) acts as a key regulator for stimulating cellular pathways to establish disease resistance [5]. In the natural environment, plants interact with rhizobacteria by using their pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs), also referred to as microbial-associated molecular patterns (MAMPs) [6]. PRRs recognize the PAMPs/MAMPs and subsequently activate PAMP/MAMP-triggered immunity (PTI/MTI), conferring an effective defense response [7].
PGPR produce various types of bioactive metabolites, which can exert multifaceted effects to improve plant tolerance to unfavorable environments. Throughout their life cycle, plants face a range of environmental stresses at various developmental stages. Root systems are crucial for the uptake of nutrients and water, making them vital for a plant’s survival. Consequently, the root system is key to ensuring that the aboveground parts of the plant can adapt to environmental challenges. Lateral roots are important to expand the root system for nutrient acquisition. Auxin is a key regulator of root growth and development [1]. PGPR are known to stimulate root architecture in the host plant by producing significant amounts of IAA [8]. In addition to its main function in controlling plant growth, studies have shown the regulatory role of auxin in plant responses to abiotic stress. For example, auxin biosynthesis and transport are altered in plants under salt stress conditions [9,10]. Additionally, PGPR can enhance the synthesis of IAA in wheat under salt and drought stress conditions [11]. Moreover, treating banana plants with a Pseudomonas PGPR strain not only increased their resistance to drought and submergence stress but also activated genes linked to the auxin signaling pathway [12]. As plants encounter an unfavorable environment, ethylene is produced to reduce their growth and proliferation [13]. Studies indicate that PGPR mitigate the adverse effects of stressful conditions by producing ACC deaminase, which in turn reduces ethylene production in the host plants [14]. Ethylene suppresses the development of lateral roots by impacting the polar transport of auxin [15]. However, in collaboration with auxin, ethylene also actively promotes the formation of root hairs [16]. Root hairs, components of the root architecture system, play a role in the adaptive response to abiotic stress [17]. For example, under conditions of phosphate starvation, ethylene signaling increases, resulting in enhanced root hair formation [18]. Moreover, ethylene collaborates with JA to regulate the AP2/ERF transcription factor gene family, thereby exerting a positive effect on plant development by enhancing tolerance to abiotic stress and disease resistance [19]. SA and JA signals play crucial roles in triggering plant immunity against pathogens. Additionally, both SA and JA can mitigate the adverse effects of abiotic stress on plant growth by activating antioxidant defenses [20]. For example, SA is a key regulator of the 2,3-butanediol VOC-induced drought stress tolerance [21]. Volatile compounds from a Bacillus strain induced salt stress tolerance in Arabidopsis due to the activation of the JA signaling pathway [22].
The bacterial strains of the Burkholderia genus are widely distributed in the soil. These bacterial strains promote plant growth through their phosphate-solubilizing activities [23], nitrogen-fixation ability [24], and altering phytohormone signaling in the host plants [25]. Genes involved in the synthesis of various antimicrobial metabolites have been identified in the Burkholderia genome [26]. Several strains of the Burkholderia contaminans species have demonstrated their effectiveness in biocontrol of plant diseases [27,28]. Burkholderia phytofirmans PsJN has been reported to activate induced resistance against gray mold and to enhance cold stress tolerance by increasing the levels of stress-related metabolites in a low-temperature environment [29].
In this study, the bacterial strain BJ3 was identified as a newly isolated Burkholderia contaminans strain based on its whole-genome sequencing results. Gene clusters associated with plant-growth-promoting traits (PGPTs) were identified; among these, genes involved in the synthesis of IAA, osmolytes, NRPS, and VOCs were particularly significant. This genome also contains genes related to nitrogen fixation and those encoding ACC deaminase. BJ3 not only promoted vegetative growth but also stimulated an early flowering phenotype in the treated plants. Moreover, this treatment improved plant tolerance to drought and salt stress. A transcriptome analysis revealed that BJ3 treatment activated the expression of genes associated with stress tolerance and vegetative growth, as well as genes linked to hormone signaling pathways, including auxin, ethylene, and SA.

2. Results

2.1. Molecular Characterization of BJ3

The sequencing results for the 16S rDNA PCR fragment from BJ3 bacterial genomic DNA showed 100% identity with several strains of the Burkholderia genus, including Burkholderia contaminans, Burkholderia sp., and Burkholderia cenocepacia (Table 1). To identify genes associated with plant growth promotion in the BJ3 genome, the whole genome sequence was analyzed using both Illumina and Nanopore sequencing systems. The results revealed 7361 open reading frames (ORFs) in the BJ3 genome, which were assigned to two chromosomes. Of these, 7112 (96.62%) ORFs showed sequence identity to Burkholderia contaminans, while 165 (2.24%) ORFs matched sequences from various Burkholderia species. Gene clusters responsible for synthesizing metabolites that function in plant growth promotion were identified and are listed in Table 2. These genes are involved in producing IAA, pyrroloquinoline quinone (PQQ), NRPS, siderophores, volatile organic compounds (VOCs), spermidine (SPD), osmolytes, lipopolysaccharides, and hydrolytic enzymes, such as chitinase and cellulase. The identified PGPT-associated genes also play a role in nitrogen fixation and code for ACC deaminase, which has activity for reducing ethylene synthesis (Figure 1). Microbes producing IAA and ACC deaminase may promote plant growth by altering hormone signaling in the host plants [8,14]. The BJ3 genome contains a large number of genes coding for proteins involved in IAA synthesis via three pathways: indolepyruvate ferredoxin oxidoreductase (IOR) in the indole-3-pyruvate (IPyA) pathway [30], iaaH in the indole-3-acetamide (IAM) pathway [31], and nitrile hydratase (nth) in the indole-3-acetaldoxime/indole-3-acetonitrile (IAOx/IAN) pathway [32]. Gene clusters code for proteins functioning in the regulation of vegetative growth in plants, including nitrogen fixation, the synthesis of pyrroloquinoline quinone (PQQ), and siderophore production. Genes identified in the BJ3 genome coding for proteins with functions related to the nitrogen-fixation process included IscU and Nif3, which exhibit nitrogenase activity [33], along with sigma factor 54-interacting protein and glnA, both playing regulatory roles in nitrogen fixation [34,35]. Pyrroloquinoline quinone (PQQ) is known to play a crucial role in stimulating plant growth and facilitating phosphorous solubilization [36] and is a scavenger of ROS [37]. Furthermore, PvdF is involved in the synthesis of siderophore and pyoverdine [38]. A large gene cluster for the synthesis of NRPs/polyketides and VOCs was identified; these metabolites possess antimicrobial activities [39,40,41,42]. Additionally, two genes, chitinase and cellulase, were identified; the antimicrobial activity of these two hydrolytic enzymes has been characterized [43,44]. Genes involved in the synthesis of lipopolysaccharides were discovered in the BJ3 genome. Bacterial lipopolysaccharides can act as elicitors to trigger plant defense responses [45]. Furthermore, five genes involved in the synthesis of spermidine were identified. Extracellular spermidine produced by Bacillus amyloliquefaciens SQR9 has been demonstrated to enhance salt stress tolerance in Arabidopsis and maize [46]. The BJ3 genome was found to contain genes involved in the synthesis of metabolites capable of regulating osmotic stress; such metabolites included proline, glycine betaine, trehalose, and ectoine. Bacteria that produce these metabolites have been shown to alleviate osmotic stress in plants [47,48,49,50].

2.2. Biochemical Analysis of Strain BJ3

Biochemical analysis indicated that BJ3 produced a higher amount of IAA on the third day of culture, with approximate average concentrations of 38 ppm (Figure 2A). This bacterial strain exhibited significant phosphate-solubilizing activity, generating a clear zone surrounding the bacterial colony in the NBRIP medium (Figure 2B). Nitrogen-fixation activity was analyzed by inoculating BJ3 in the Jensen’s medium, which resulted in the bromothymol blue indicator changing to yellow (Figure 2C). Furthermore, BJ3 also exhibited antifungal activity, suppressing approximately 53% of the mycelial growth of the fungal pathogen Fusarium oxysporum f. sp. cubense tropical race 4 (Foc TR4) (Figure 2D).

2.3. Arabidopsis Growth Promotion Stimulated by Strain BJ3

Metabolites produced by beneficial rhizobacteria can enhance plant growth by affecting root growth [51]. In this study, Arabidopsis seedlings cocultured with BJ3 for four days underwent significant changes, as evidenced by an increased number of lateral roots and a reduction in the length of primary roots (Figure 3A). The number of lateral roots in seedlings treated with BJ3 was significantly higher than that in control seedlings (Figure 3A). Furthermore, the soil-grown Arabidopsis seedlings treated with BJ3 showed an increase in plant size and fresh weight compared to the control plants (Figure 3B). Three weeks after treatment, the BJ3-treated seedlings displayed visible floral inflorescences earlier than the control seedlings. The days required for the appearance of floral inflorescence in the BJ3-treated plants were significantly fewer than those in the control plants (Figure 3C). Furthermore, seedlings treated with BJ3 exhibited elevated levels of lignin in their leaf tissues (Figure 3D) and increased activity of antioxidant enzymes, such as ascorbate peroxidase (APX) and guaiacol peroxidase (POD) (Figure 3E,F).

2.4. BJ3 Treatment Enhanced Seedling Stress Tolerance

Two-week-old Arabidopsis seedlings were pre-treated with BJ3 prior to undergoing a five-day period of water deprivation. After the drought stress, the BJ3-treated seedlings exhibited a greater number of unwilted individuals and demonstrated a higher survival rate (Figure 4A,B). Seven days after rehydration in the post-drought period, the BJ3-treated seedlings showed increases in both plant size and fresh weight (Figure 4C,D). Moreover, an analysis of salt stress tolerance was performed in the BJ3-treated seedlings. Two weeks after the salt stress treatment, the seedlings that received the BJ3 treatment demonstrated greater growth in plant size (Figure 5A), elevated levels of chlorophyll content (Figure 5B), and a diminished buildup of H2O2 (Figure 5C) in contrast to the untreated control group.

2.5. BJ3 Altered Arabidopsis Transcription Associated with Plant Development and Stress Response

PGPR exert a strong effect on modulating plant gene expression. To gain insight into the mechanisms involved in plant growth promotion mediated by BJ3, transcriptome alterations of Arabidopsis treated with BJ3 were analyzed. In total, 208 Arabidopsis genes, which exhibited induction levels greater than Log2[FC] = 2.0, were subjected to further analysis. The detailed gene information is listed in Table S1. As shown in Figure 6A, the upregulated genes are associated with cellular pathways that govern stress tolerance. This includes groups of genes related to disease resistance, stress-associated transcription factors (TFs), and the response to abiotic stress. Upregulated genes also play roles in regulating plant development, such as vegetative and reproductive growth. Furthermore, some of these upregulated genes serve multiple purposes, influencing both stress response and cellular growth by altering hormone signaling, the composition of the cell wall, and chloroplast function. Among these genes, those related to the regulation of disease resistance constituted the largest group (Figure 6B). This group included genes encoding signaling molecules, disease-resistance proteins, pathogenesis-related (PR) proteins, and enzymes involved in the synthesis of defense metabolites, such as glucosinolate, camalexin, and terpenoids (Figure 7A). BJ3 strongly induced the expression of FLG22-INDUCED RECEPTOR-LIKE KINASE 1 (FRK1), a marker for the activation of PTI/MTI [52]. Additionally, it upregulated genes such as MPK11, AtCMPG1, and LecRKA4.1, which play various roles in PTI/MTI [53,54,55]. Furthermore, PP2-A5, encoding a protein belonging to the Phloem Protein2 family, is involved in the induced immunity against insect damage [56]. BJ3 treatment also increased the expression levels of cysteine-rich receptor-like kinase (CRK) gene members. For example, Arabidopsis CRK13’s function is involved in the disease resistance against Pst DC3000 and SA accumulation [57]. Another upregulated gene, ACCELERATED CELL DEATH 6 (ACD6), is a regulator of the defense response mediated by SA [58]. BJ3 also induced the expression of AtPME41, which encodes a pectin methylesterase functioning in the disease resistance against P. syringae [59]. Moreover, Arabidopsis GDSL lipase 1 (GLIP1) plays a role in controlling systemic immunity by regulating components of the ethylene signaling pathway [60]. The major PR genes induced by BJ3 included members of the defensin-like family (Figure 7A). BJ3 treatment also activated genes involved in the synthesis of secondary metabolites associated with the defense response, including IGMT2 and CYP81F2 for glucosinolate synthesis [61,62]; CYP71A12 and PHYTOALEXIN DEFICIENT 3 (PAD3) for camalexin synthesis [63,64]; FAD-linked oxidoreductase 1 (FOX1) for cyanogenic phytoalexin synthesis [65]; and four genes encoding enzymes for terpenoid synthesis, which include BARUOL SYNTHASE 1 (BARS1), terpenoid cyclase (AT1G48820), CYP705A3, and CYP76C2 [66,67].
In Figure 7B, the upregulated genes displaying annotated functions related to abiotic stress responses are highlighted. These include genes regulating the perception and response to stress signals, as well as tolerance to osmotic/ionic stress, heavy metals, and low temperatures. For example, dicarboxylate carrier 2 (DIC2) is important for shuttling malate-oxaloacetate and maintaining redox balance between the mitochondria and the cytosol; genes of DICs are important for plant adaptation to environmental stresses [68,69]. Genes involved in the synthesis of polyamines (PAs) and PA transport include ADC1, ADC2, and OCT5. PAs are polycations and low-molecular-weight metabolites that can exert protective roles on cellular molecules under increased oxidative stress conditions [70]. Furthermore, the expression of RESPONSE TO ABA AND SALT 1 (RAS1) was increased. Nicotianamine synthase 2 (NAS2) is for the synthesis of nicotianamine (NA), acting as a ligand for the detoxification of heavy metals [71]. Aluminum-activated malate transporter 1 (ALMT1) regulates aluminum tolerance in Arabidopsis by secreting malate to chelate the Al in acidic soils [72].
BJ3 upregulated a group of genes encoding transcription factors, playing a dual function in the regulation of abiotic and biotic stress-related physiology (Figure 7C). Among these transcription factors, AP2/ERF transcription factors occupied the largest portion of this gene group (Figure 7C). The expression of CRT/DRE BINDING FACTOR 1 (CBF1), CBF2, and CBF3, members of the AP2/ERF family, is rapidly induced in response to low temperature [73]. Redox Responsive Transcription Factor 1 (RRTF1), also known as ERF109, is an important regulator to control redox homeostasis plant cells after exposure to abiotic stress [74]. ERF114 mediates elicitor-induced disease resistance in Arabidopsis [75]. DWARF AND DELAYED FLOWERING 1 (DDF1) functions in the adaptation response to multiple abiotic stress [76]. Additionally, BJ3 upregulated the expression of several WRKY transcription factors. Among them, WRKY30 plays a dual function in the regulation of disease resistance [77] and abiotic stress tolerance [78]. The regulatory role of WRKY53 is implicated in leaf senescence and disease resistance against P. syringae in Arabidopsis [79,80]. Furthermore, SALT-INDUCIBLE ZINC FINGER 1 (SZF1) encodes a CCCH-type zinc finger protein, displaying functions involved in salt stress and immune responses [81].

2.6. BJ3 Enhanced Arabidopsis Gene Expression Related to Plant Development

The second-largest group of upregulated genes was associated with various aspects of plant growth (Figure 6B). As shown in Figure 7D, genes regulated by BJ3 were involved in regulating root and shoot growth, trichome development, light response, and nutrient transport. Upregulated genes included those encoding the CLAVATA3/ESR (CLE) peptides, Devil/Rotundifolia Like (RTFL) peptides, and LOB domain-containing proteins (LBD). The gene function of the CLE family acts as a signaling molecule mediating the WUSCHEL (WUS) signaling pathway, which is implicated in maintaining the shoot apical meristem (SAM) [82]. The RTFL gene family consists of small peptides that regulate development in Arabidopsis [83]. LBD gene members encode plant-specific transcriptional regulators that play roles in determining organ boundaries during plant development [84]. Another upregulated gene, EPIDERMAL PATTERNING FACTOR-like protein 2 (EPFL2), also plays a role in controlling shoot organ boundaries [85]. The function of Arabidopsis Crinkly4 Related 4 (ACR4) is implicated in regulating root-cell division [86]. MYB39 is involved in regulating suberin biosynthesis in the root endodermis of Arabidopsis [87]. Moreover, COLD REGULATED GENE 27 (COR27) plays a role in controlling the circadian rhythm of plant growth [88]. BJ3 also stimulated the expression of several transporters involved in nitrogen metabolism, including Nitrate transporter 2.5 (NRT2.5), Ammonium transporter 1 member 1 (AMT1;1), Urea-proton symporter (DUR3), PEPTIDE TRANSPORTER 3 (PTR3), Oligopeptide transporter 1 (OPT1), Lysine histidine transporter-like 7 (LHT7), and Siliques Are Red 1 (SIAR1). Among them, the induction fold of NRT2.5 in response to BJ3 treatment was the highest in this gene group, with a Log2[FC] of 4.9.
Additionally, upregulated genes constituted several genes showing annotated functions linked to the regulation of floral organ development, flowering time, and embryo and seed development (Figure 7E). For example, APETALA 1 (AP1) affects floral organ development [89]. The gene function of INFLORESCENCE DEFICIENT IN ABSCISSION (IDA) and INFLORESCENCE DEFICIENT IN ABSCISSION (IDA)-LIKE (IDL) is to regulate floral organ abscission [90]. The transcription factors CONSTANS (CO), LEAFY (FLY), and squamosa-promoter binding protein-like (SPL) are involved in the regulation of flowering time [91,92]. Lea and Oleosin proteins are important during seed maturation [93].

2.7. BJ3 Activated Genes with Multiple Functions in Plant Growth and Stress Tolerance

Rhizobacteria have an impact on plant growth and stress tolerance by influencing the signaling of plant hormones [94]. As shown in Figure 7F, the BJ3 treatment activated the expression of genes involved in hormone signaling transduction pathways, including those for auxin, ethylene, abscisic acid (ABA), SA, gibberellin (GA), and cytokinin (CK). Of these, the genes related to auxin synthesis and response formed the most significant group. The expression of UGT74E2, responsible for the production of indole-3-butyric acid (IBA) glucose conjugates [95], was highly induced, with an induction fold of Log2[FC] greater than 5. Additionally, upregulated genes included YUC5, encoding a flavin monooxygenase that catalyzes the conversion of indole-3-pyruvate (IPA) to IAA, and NIT2, encoding a nitrilase involved in the last step of the synthesis of IAA [96,97]. Furthermore, upregulated genes also included early auxin response genes and SAUR and GH3 gene members [98]. The transcription factor MYB77 is involved in the regulation of auxin signaling [99]. In the seedlings treated with BJ3, three upregulated genes encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) proteins were identified, ACS6, ACS7, and ACS11, all of which are involved in the synthesis of ethylene. Additionally, genes associated with SA biosynthesis and response, such as SARD1 and CBP60G [100], were identified. BJ3 treatment activated the expression of genes involved in ABA synthesis, such as NCED9 [101], and negative regulators of ABA signal transduction, such as ARCK1 and PP2CA [102,103]. The treatment also upregulated genes involved in the cytokinin and GA signaling pathways. However, genes involved in the biosynthesis and degradation of GA and cytokinin had increased expression levels. These results suggested that BJ3 treatment exerted positive effect on auxin, ethylene, and SA signaling in Arabidopsis.
During various developmental stages, the structural integrity of the cell wall requires constant adjustments to facilitate plant growth [104]. As shown in Figure 7G, the analysis of transcriptome alterations revealed a group of upregulated genes that show functions associated with the synthesis of metabolites to fortify the cell wall. For example, Caffeoyl-CoA O-methyltransferase (CCoAMT), Cinnamoyl-CoA reductase 2 (CCR), and Cinnamyl alcohol dehydrogenase 2 (CAD2) encode proteins that are involved in lignin synthesis [105]. The transcription factors MYB87 and MYB15 are regulators of cell-wall strengthening [106,107]. Chloroplasts play a crucial role in energy production via photosynthesis and oxygen release, both of which promote plant growth and enhance crop yields. Additionally, chloroplasts produce biologically active metabolites that enable plants to adapt and respond to stress from harsh environments [108]. As shown in Figure 7H, a gene encoding ribose-5-phosphate isomerase (RPI2) is required for maintaining the chloroplast structure and its photosynthetic capacity [109], and 6-Phosphogluconolactonase 1 (PGL1) is a key enzyme in the oxidative pentose phosphate pathway (OPPP). Moreover, the PGL genes are responsive to abiotic stresses in rice [110].

3. Discussion

The application of Burkholderia contaminans strains for biocontrol purposes has been emphasized, which involves the production of diffusible or volatile antimicrobial metabolites [27,28,111]. In this study, the BJ3 genome contains gene clusters involved in the synthesis of diverse metabolites with antimicrobial activity; among these, NRPS/polyketides and VOCs constitute the two largest groups. BJ3’s metabolites demonstrated significant antifungal activity in suppressing the banana Fusarium wilt pathogen. According to a previous study, the expression of non-ribosomal peptide synthetases in the Burkholderia contaminans strain MS14 is essential for its antifungal activity against Geotrichum candidum [112]. Another study has shown that terpenes, produced by the Burkholderia gladioli strain, are identified as effective antifungal metabolites against Fusarium oxysporum [113]. In addition to exhibiting antifungal activity, BJ3 treatment increased the expression of a large number of Arabidopsis genes linked to cellular pathways associated with induced immunity. BJ3 strongly activated the expression of FRK1, a marker gene for PTI/MTI [52], and CRK6 and CRK20, regulators of the PTI/MTI response [114,115]. Moreover, the BJ3-upregulated genes encode disease-resistance proteins, PR proteins, and those for the synthesis of antimicrobial metabolites, such as glucosinolates, camalexin, and terpenoids [116]. These results illustrate the ability of BJ3 to serve a biocontrol purpose.
Genes involved in the synthesis of IAA constitute the largest gene group associated with plant-growth-promoting traits in the BJ3 genome. IAA is the most abundant form of auxin. This phytohormone plays a crucial role in the regulation of lateral root development [1]. BJ3 produced a significant amount of IAA (close to 40 ppm) and induced the Arabidopsis gene expression involved in auxin synthesis and response. A consistent phenotype has been observed, showing that treatment with BJ3 significantly enhances lateral root development in Arabidopsis seedlings. The BJ3 genome contains gene clusters involved in nitrogen fixation and phosphate solubilization; consistently, BJ3 exhibits significant activity in both processes. These microbial activities may contribute to the growth-promoting effects derived from BJ3. Additionally, Arabidopsis treated with BJ3 exhibited an early flowering phenotype. This early flowering is consistent with the activated expression of the Arabidopsis genes CO, LFY, and SPL13A, which are involved in regulating the transition from vegetative growth to flower initiation [117,118,119]. Ethylene is a regulator for stimulating the transition of vegetative growth to floral development in Arabidopsis [120]. In the BJ3-treated Arabidopsis transcriptome, upregulated genes include three members of the ACS family, which is the rate-limiting enzyme in ethylene synthesis [121]. Further evidence supporting an increased ethylene signal in BJ3-treated Arabidopsis is that a large number of AP2/ERF gene members are stimulated in their expression by BJ3. The expression of these transcription factors is manipulated by the ethylene signal and is crucial for the plant’s adaptive response to various abiotic stresses [122]. Our results indicate that BJ3 activates both auxin and ethylene signals to alter plant growth and development. These findings are consistent with a study demonstrating that these two hormonal signals play roles in plant growth induced by Burkholderia phytofirmans [123].
The BJ3 genome contains a notable number of genes involved in the synthesis of various osmolytes, which may regulate the osmotic balance in plants under osmotic stress conditions [47,48,49,50]. Consistently, the BJ3-treated Arabidopsis exhibited increased tolerance to both drought and salt stress. In addition to producing metabolites that act as osmolytes to protect plants from oxidative damage under osmotic/salt stress, microbes can also activate the plant antioxidant defense system to reduce the production of ROS under stressful conditions [124]. The BJ3 genome includes a gene cluster dedicated to producing spermidine. Strains of PGPR that produce spermidine have been shown to enhance salt stress tolerance in host plants [46]. Additionally, applying spermidine externally can stimulate antioxidant activity in plants [125]. Moreover, BJ3 contains genes for the synthesis of terpenoids and activates Arabidopsis genes related to terpenoid synthesis. This natural compound, in addition to serving as an antimicrobial agent, can also act as an antioxidant in plants [126]. BJ3 treatment triggered the expression of genes involved in SA biosynthesis and signaling pathways. SA plays a beneficial role in enhancing plant tolerance to various abiotic stresses through the activation of antioxidant activity [127]. In addition to playing a crucial role in the regulation of root development, a regulatory role of auxin in stress adaptation is revealed. For example, transgenic potato overexpressing the auxin biosynthesis gene YUCCA6 resulted in an increased auxin level and enhanced drought stress tolerance [128]. Moreover, auxin improves plant abiotic stress tolerance by manipulating antioxidant activity in plant cells [129]. In this study, BJ3 treatment activated antioxidant enzymes and enhanced plant tolerance to both drought and salt stress. Therefore, BJ3 may serve a protective function in plants, either by producing various types of osmolytes or by activating signaling pathways that help develop an adaptive response to stress.

4. Materials and Methods

4.1. Bacterial Strain Characterization

The BJ3 strain was isolated from a growing substrate. PCR amplification of the genomic DNA from the bacterial strain was performed using the primers fD1 (5′AGAGTTTGATCCTGGCTCAG3′) and rP1 (5′ACGGTTACCTTGTTACGACTT3′), targeting the 16S rDNA sequence [130]. The PCR fragment was analyzed using a 3730 DNA Analyzer (Applied Biosystems®; Foster City, CA, USA). The obtained 16S rDNA sequences were analyzed using the Basic Local Alignment Search Tool (BLAST) program [131] in the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed 1 September 2023)).

4.2. De Novo Whole Genome Assembly

The fragmented genome DNA of BcD1 was prepared using the Celero PCR workflow with an Enzymatic Fragmentation DNA-Seq Kit (Tecan Trading AG, Männedorf, Switzerland). DNA sequencing was performed by the paired-end method on the Illumina MiSeq system (Illumina, Inc., San Diego, CA, USA). The raw sequence data’s quality was assessed with NanoPlot v1.28.1 [132]. Following this, adapters, low-quality sequences (Q20), and ambiguous bases were trimmed from the reads. The de novo assembly of the genome sequencing data was carried out using SPAdes v.3.14.1 [133]. Open reading frames (ORFs) were predicted by GlimmerHMM [134]. RNAmmer and tRNAscan SE were used to predict rRNA and tRNA, respectively [135,136]. Gene sequences were annotated through the NCBI database. The functional analysis of the genes was performed using FastAnnotator [137] and the Gene Ontology Consortium (http://geneontology.org/) (accessed on 5 September 2023). The phylogenetic classification of protein families was determined using the Cluster of Orthologous Groups (COG) database (http://www.ncbi.nlm.nih.gov/COG) (accessed 1 September 2023)).

4.3. Analysis of the Bioactivity of Microbial Metabolites

To measure IAA production, BJ3 was cultured for 24, 48, and 72 h in Luria Broth (LB) medium supplemented with 2 mg/mL L-tryptophan. Supernatants from the bacterial cultures were added to Salkowski reagent and incubated in the dark at room temperature for 20 min. The absorbance at 535 nm was determined, and the IAA concentration (in ppm) was calculated based on a standard curve derived from known IAA concentrations. The phosphate-solubilizing activity of BJ3 was determined by following procedures described by Nautiyal (1999) [138]. BJ3 was inoculated on the NBRIP plate containing 1% glucose, 0.5% Ca3(PO4)2, 0.5% MgCl2·6H2O, 0.025% MgSO4·7H2O, 0.02% KCl, and 0.01% (NH4)2SO4, pH 7.0, and cultured for 14 days. The nitrogen-fixation activity of BJ3 was analyzed on Jensen’s media [139] containing × 25 µg/mL of bromothymol blue. After 4 days of culture, the formation of a yellow zone surrounding the bacterial culture was used as an indicator of nitrogen fixation. The detection of antifungal activity in the metabolites produced by the isolated bacterial strain was carried out using methods outlined by Tsai et al. (2023) [140]. Briefly, two filter paper pieces, each soaked with 10 μL of bacterial solutions at a concentration of 1 × 108 CFU/mL, were placed 3 cm away from a mycelial plug of Fusarium oxysporum f. sp. cubense tropical race 4 (Foc TR4) on potato dextrose agar (PDA) plates. Water served as the control. The cultures were then incubated for seven days at 28 °C. The growth inhibition rate was assessed by measuring the diameter of fungal mycelia in the control and treated groups and calculating the inhibition rate (I) = (1 − diameter of mycelia of treatment/diameter of mycelia of control) × 100.

4.4. Analysis of Growth-Promotion Effects

Seeds of Arabidopsis thaliana (ecotype Columbia) were germinated on ½ MS medium for 3 days. Seedlings were transferred to a fresh medium without and with bacterial inoculation and cultured for an additional 4 days. Lateral root number per seedling was estimated. A bacterial culture with a density of 1 × 108 CFU/mL was used to treat Arabidopsis seedlings that had been germinating in soil for one week. Each pot contained ten seedlings, and four pots in total were subjected to the bacterial treatment, which was performed weekly over a three-week period. After three treatments, the fresh weight and floral inflorescence of the seedlings were recorded. Furthermore, both the lignin content and the activity of antioxidant enzymes, including ascorbate peroxidase (APX) and guaiacol peroxidase (POD), were analyzed, following the procedures described by Chang et al. [141].

4.5. Analysis of Drought and Salt Stress Tolerance

Two-week-old seedlings were treated with BJ3 at a bacterial density of 1 × 108 CFU/mL and then subjected to a water deprivation period of five days. Plants that did not wilt, indicated by stars, were counted. The survival rate was calculated by dividing the number of unwilted plants by the total number of plants. Seven days after the recovery of the water supply, the fresh weight of the seedlings was measured.
For the analysis of salt stress tolerance, after the BJ3 treatment, 125 mM NaCl (30 mL) was applied to both the control and BJ3-treated seedlings. The salt stress treatment was administered three times a week. After two weeks of salt stress treatment, both chlorophyll content and H2O2 content were measured by following the procedures described by Kurniawan and Chuang (2022) [142].

4.6. RNA-Seq Transcriptome Analysis

The leaf tissues from 2-week-old Arabidopsis seedlings treated with BJ3 were harvested for total RNA extraction using the method described by Parcy et al. [143]. Five μg of total RNA was used to construct the RNA-seq library following Illumina’s protocols. After sequencing the library on the Illumina NextSeq 500 platform, the resulting sequences were analyzed using procedures outlined by Tsai et al. (2023) [140]. Gene expression levels were quantified using FPKM (Fragments Per Kilobase of exons per Million mapped reads) values. The fold change (FC) in gene expression was calculated by dividing the expression levels in the treatment group by those in the control group. Genes with a log2(FC) greater than 1.0 were considered upregulated; furthermore, genes with a log2(FC) equal to or greater than 2.0 were selected for further study.

4.7. Statistical Analysis

The differences among the treatments were evaluated using the ANOVA technique within the SAS (3.8) software. Statistical significance was established at a p-value of less than 0.05 from the Tukey test.

5. Conclusions

The BJ3 genome contains four key gene groups crucial for synthesizing IAA, NRPS, terpenoids, and osmolytes, along with a gene cluster associated with nitrogen fixation. BJ3 produces substantial amounts of IAA and antifungal metabolites while demonstrating nitrogen-fixing and phosphate-solubilizing capabilities. It promotes plant growth by strengthening root architecture, encouraging vegetative growth, and inducing earlier flowering. Additionally, BJ3-treated plants exhibit increased antioxidant activity and reduced negative effects from drought and salt stress. The transcriptome analysis indicates that BJ3 is a potent elicitor of gene expression involved in plant hormone signaling pathways, including auxin, ethylene, and SA. These activated pathways may regulate plant growth, disease resistance, and adaptive responses to abiotic stress.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms25116091/s1.

Author Contributions

Y.-L.C.: data analysis and manuscript writing; Y.-C.C.: bacterial characterization; A.K.: plant experiment; P.-C.C.: abiotic stress analysis; T.-Y.L.: bacterial characterization; W.-D.W.: providing comments on manuscript preparation; H.-w.C.: experimental design, data analysis, and manuscript writing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Agriculture, grant number 113AS-14.2.1-RS-02. The APC was funded by 113AS-14.2.1-RS-02.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Lavenus, J.; Goh, T.; Roberts, I.; Guyomarc’h, S.; Lucas, M.; De Smet, I.; Fukaki, H.; Beeckman, T.; Bennett, M.; Laplaze, L. Lateral root development in Arabidopsis: Fifty shades of auxin. Trends Plant Sci. 2013, 18, 450–458. [Google Scholar] [CrossRef] [PubMed]
  2. Lucke, M.; Correa, M.G.; Levy, A. The role of secretion systems, effectors, and secondary metabolites of beneficial rhizobacteria in interactions with plants and microbes. Front. Plant Sci. 2020, 11, 589416. [Google Scholar] [CrossRef] [PubMed]
  3. Shameer, S.; Prasad, T. Plant growth promoting rhizobacteria for sustainable agricultural practices with special reference to biotic and abiotic stresses. Plant Growth Regul. 2018, 84, 603–615. [Google Scholar] [CrossRef]
  4. Wei, G.; Kloepper, J.W.; Tuzun, S. Induction of systemic resistance of cucumber to Colletotrichum orbiculare by select strains of plant growth-promoting rhizobacteria. Phytopathology 1991, 81, 1508–1512. [Google Scholar] [CrossRef]
  5. van Loon, L.C.; Bakker, P.A.; Pieterse, C.M. Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopath. 1998, 36, 453–483. [Google Scholar] [CrossRef] [PubMed]
  6. Dodds, P.N.; Rathjen, J.P. Plant immunity: Towards an integrated view of plant–pathogen interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef] [PubMed]
  7. Alhoraibi, H.; Bigeard, J.; Rayapuram, N.; Colcombet, J.; Hirt, H. Plant immunity: The MTI-ETI model and beyond. Curr. Issues Mol. Biol. 2019, 30, 39–58. [Google Scholar] [CrossRef]
  8. Khalid, A.; Arshad, M.; Zahir, Z.A. Screening plant growth-promoting rhizobacteria for improving growth and yield of wheat. J. Appl. Microbiol. 2004, 96, 473–480. [Google Scholar] [CrossRef]
  9. Yan, S.; Che, G.; Ding, L.; Chen, Z.; Liu, X.; Wang, H.; Zhao, W.; Ning, K.; Zhao, J.; Tesfamichael, K. Different cucumber CsYUC genes regulate response to abiotic stresses and flower development. Sci. Rep. 2016, 6, 20760. [Google Scholar] [CrossRef]
  10. Ribba, T.; Garrido-Vargas, F.; O’Brien, J.A. Auxin-mediated responses under salt stress: From developmental regulation to biotechnological applications. J. Exp. Bot. 2020, 71, 3843–3853. [Google Scholar] [CrossRef]
  11. Barnawal, D.; Bharti, N.; Pandey, S.S.; Pandey, A.; Chanotiya, C.S.; Kalra, A. Plant growth-promoting rhizobacteria enhance wheat salt and drought stress tolerance by altering endogenous phytohormone levels and TaCTR1/TaDREB2 expression. Physiol. Plant. 2017, 161, 502–514. [Google Scholar] [CrossRef] [PubMed]
  12. Maulidah, N.I.; Tseng, T.-S.; Chen, G.-H.; Hsieh, H.-Y.; Chang, S.-F.; Chuang, H.-W. Transcriptome analysis revealed cellular pathways associated with abiotic stress tolerance and disease resistance induced by Pseudomonas aeruginosa in banana plants. Plant Gene 2021, 27, 100321. [Google Scholar] [CrossRef]
  13. Pierik, R.; Sasidharan, R.; Voesenek, L.A.C.J. Growth control by ethylene: Adjusting phenotypes to the environment. J. Plant Growth Regul. 2007, 26, 188–200. [Google Scholar] [CrossRef]
  14. Singh, R.P.; Pandey, D.M.; Jha, P.N.; Ma, Y. ACC deaminase producing rhizobacterium Enterobacter cloacae ZNP-4 enhance abiotic stress tolerance in wheat plant. PLoS ONE 2022, 17, e0267127. [Google Scholar] [CrossRef] [PubMed]
  15. Lewis, D.R.; Negi, S.; Sukumar, P.; Muday, G.K. Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 2011, 138, 3485–3495. [Google Scholar] [CrossRef]
  16. Strader, L.C.; Chen, G.L.; Bartel, B. Ethylene directs auxin to control root cell expansion. Plant J. 2010, 64, 874–884. [Google Scholar] [CrossRef]
  17. Karlova, R.; Boer, D.; Hayes, S.; Testerink, C. Root plasticity under abiotic stress. Plant Physiol. 2021, 187, 1057–1070. [Google Scholar] [CrossRef]
  18. Song, L.; Yu, H.; Dong, J.; Che, X.; Jiao, Y.; Liu, D. The molecular mechanism of ethylene-mediated root hair development induced by phosphate starvation. PLoS Genet. 2016, 12, e1006194. [Google Scholar] [CrossRef] [PubMed]
  19. Kazan, K. Diverse roles of jasmonates and ethylene in abiotic stress tolerance. Trends Plant Sci. 2015, 20, 219–229. [Google Scholar] [CrossRef]
  20. Karimi, N.; Ghasempour, H.-R. Salicylic acid and jasmonic acid restrains nickel toxicity by ameliorating antioxidant defense system in shoots of metallicolous and non-metallicolous Alyssum inflatum Náyr. Populations. Plant Physiol. Biochem. 2019, 135, 450–459. [Google Scholar]
  21. Cho, S.M.; Kang, B.R.; Han, S.H.; Anderson, A.J.; Park, J.-Y.; Lee, Y.-H.; Cho, B.H.; Yang, K.-Y.; Ryu, C.-M.; Kim, Y.C. 2R, 3R-butanediol, a bacterial volatile produced by Pseudomonas chlororaphis O6, is involved in induction of systemic tolerance to drought in Arabidopsis thaliana. Mol. Plant Microbe Interact. 2008, 21, 1067–1075. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, S.; Tian, Y.; Jia, M.; Lu, X.; Yue, L.; Zhao, X.; Jin, W.; Wang, Y.; Zhang, Y.; Xie, Z. Induction of salt tolerance in Arabidopsis thaliana by volatiles from Bacillus amyloliquefaciens FZB42 via the jasmonic acid signaling pathway. Front. Microbiol. 2020, 11, 562934. [Google Scholar] [CrossRef] [PubMed]
  23. Ghosh, R.; Barman, S.; Mukherjee, R.; Mandal, N.C. Role of phosphate solubilizing Burkholderia spp. for successful colonization and growth promotion of Lycopodium cernuum L. (Lycopodiaceae) in lateritic belt of Birbhum district of West Bengal, India. Microbiol. Res. 2016, 183, 80–91. [Google Scholar] [CrossRef] [PubMed]
  24. Elliott, G.N.; Chen, W.M.; Chou, J.H.; Wang, H.C.; Sheu, S.Y.; Perin, L.; Reis, V.M.; Moulin, L.; Simon, M.F.; Bontemps, C. Burkholderia phymatum is a highly effective nitrogen-fixing symbiont of Mimosa spp. and fixes nitrogen ex planta. New Phytol. 2007, 173, 168–180. [Google Scholar] [CrossRef] [PubMed]
  25. Kurepin, L.V.; Park, J.M.; Lazarovits, G.; Bernards, M.A. Burkholderia phytofirmans-induced shoot and root growth promotion is associated with endogenous changes in plant growth hormone levels. Plant Growth Regul. 2015, 75, 199–207. [Google Scholar] [CrossRef]
  26. Bach, E.; Passaglia, L.M.P.; Jiao, J.; Gross, H. Burkholderia in the genomic era: From taxonomy to the discovery of new antimicrobial secondary metabolites. Crit. Rev. Microbiol. 2022, 48, 121–160. [Google Scholar] [CrossRef]
  27. Zaman, N.R.; Chowdhury, U.F.; Reza, R.N.; Chowdhury, F.T.; Sarker, M.; Hossain, M.M.; Akbor, M.A.; Amin, A.; Islam, M.R.; Khan, H. Plant growth promoting endophyte Burkholderia contaminans NZ antagonizes phytopathogen Macrophomina phaseolina through melanin synthesis and pyrrolnitrin inhibition. PLoS ONE 2021, 16, e0257863. [Google Scholar] [CrossRef]
  28. Heo, A.Y.; Koo, Y.M.; Choi, H.W. Biological control activity of plant growth promoting rhizobacteria Burkholderia contaminans AY001 against tomato fusarium wilt and bacterial speck diseases. Biology 2022, 11, 619. [Google Scholar] [CrossRef]
  29. Theocharis, A.; Bordiec, S.; Fernandez, O.; Paquis, S.; Dhondt-Cordelier, S.; Baillieul, F.; Clément, C.; Barka, E.A. Burkholderia phytofirmans PsJN primes Vitis vinifera L. and confers a better tolerance to low nonfreezing temperatures. Mol. Plant Microbe In. 2012, 25, 241–249. [Google Scholar] [CrossRef]
  30. Imada, E.L.; de Oliveira, A.L.M.; Hungria, M.; Rodrigues, E.P. Indole-3-acetic acid production via the indole-3-pyruvate pathway by plant growth promoter Rhizobium tropici CIAT 899 is strongly inhibited by ammonium. Res. Microbiol. 2017, 168, 283–292. [Google Scholar] [CrossRef]
  31. Lehmann, T.; Hoffmann, M.; Hentrich, M.; Pollmann, S. Indole-3-acetamide-dependent auxin biosynthesis: A widely distributed way of indole-3-acetic acid production? Eur. J. Cell Biol. 2010, 89, 895–905. [Google Scholar] [CrossRef] [PubMed]
  32. Duca, D.; Rose, D.R.; Glick, B.R. Characterization of a nitrilase and a nitrile hydratase from Pseudomonas sp. strain UW4 that converts indole-3-acetonitrile to indole-3-acetic acid. Appl. Environ. Microbiol. 2014, 80, 4640–4649. [Google Scholar] [CrossRef] [PubMed]
  33. Dos Santos, P.C.; Johnson, D.C.; Ragle, B.E.; Unciuleac, M.-C.; Dean, D.R. Controlled expression of nif and isc iron-sulfur protein maturation components reveals target specificity and limited functional replacement between the two systems. J. Bacteriol. 2007, 189, 2854–2862. [Google Scholar] [CrossRef] [PubMed]
  34. do Carmo Dias, B.; da Mota, F.F.; Jurelevicius, D.; Seldin, L. Genetics and regulation of nitrogen fixation in Paenibacillus brasilensis PB24. Microbiol. Res. 2021, 243, 126647. [Google Scholar] [CrossRef] [PubMed]
  35. Kullik, I.; Fritsche, S.; Knobel, H.; Sanjuan, J.; Hennecke, H.; Fischer, H. Bradyrhizobium japonicum has two differentially regulated, functional homologs of the sigma 54 gene (rpoN). J. Bacteriol. 1991, 173, 1125–1138. [Google Scholar] [CrossRef] [PubMed]
  36. Ludueña, L.M.; Anzuay, M.S.; Angelini, J.G.; Barros, G.; Luna, M.F.; Monge, M.D.P.; Fabra, A.; Taurian, T. Role of bacterial pyrroloquinoline quinone in phosphate solubilizing ability and in plant growth promotion on strain Serratia sp. S119. Symbiosis 2017, 72, 31–43. [Google Scholar] [CrossRef]
  37. Ludueña, L.M.; Bianucci, E.; Anzuay, M.S.; Angelini, J.G.; Fabra, A.; Taurian, T. First insights into the role of PQQ cofactor in the modulation of bacterial redox state and in the early interaction with peanut (Arachis hypogaea L.). Appl Soil Ecol 2020, 152, 103560. [Google Scholar] [CrossRef]
  38. Kenjić, N.; Hoag, M.; Moraski, G.C.; Caperelli, C.A.; Moran, G.R.; Lamb, A.L. PvdF of pyoverdin biosynthesis is a structurally unique N10-formyltetrahydrofolate-dependent formyltransferase. Arch. Biochem. Biophys. 2019, 664, 40–50. [Google Scholar] [CrossRef] [PubMed]
  39. Gu, G.; Smith, L.; Wang, N.; Wang, H.; Lu, S.-E. Biosynthesis of an antifungal oligopeptide in Burkholderia contaminans strain MS14. Biochem. Biophys. Res. Commun. 2009, 380, 328–332. [Google Scholar] [CrossRef]
  40. Singh, D.; Devappa, V.; Yadav, D.K. Suppression of tomato bacterial wilt incited by Ralstonia pseudosolanacearum using polyketide antibiotic-producing Bacillus spp. isolated from rhizospheric soil. Agriculture 2022, 12, 2009. [Google Scholar] [CrossRef]
  41. Garcia-Gonzalez, E.; Müller, S.; Ensle, P.; Süssmuth, R.D.; Genersch, E. Elucidation of sevadicin, a novel non-ribosomal peptide secondary metabolite produced by the honey bee pathogenic bacterium P aenibacillus larvae. Environ. Microbiol. 2014, 16, 1297–1309. [Google Scholar] [CrossRef] [PubMed]
  42. Farag, M.A.; Zhang, H.; Ryu, C.-M. Dynamic chemical communication between plants and bacteria through airborne signals: Induced resistance by bacterial volatiles. J. Chem. Ecol. 2013, 39, 1007–1018. [Google Scholar] [CrossRef] [PubMed]
  43. Singh, R.P.; Saati, A.A.; Faidah, H.; Bantun, F.; Jalal, N.A.; Haque, S.; Rai, A.K.; Srivastava, M. Prospects of microbial cellulase production using banana peels wastes for antimicrobial applications. Intern. J. Food Microbiol. 2023, 388, 110069. [Google Scholar] [CrossRef] [PubMed]
  44. Loc, N.H.; Huy, N.D.; Quang, H.T.; Lan, T.T.; Thu, H.T.T. Characterisation and antifungal activity of extracellular chitinase from a biocontrol fungus, Trichoderma asperellum PQ34. Mycology 2020, 11, 38–48. [Google Scholar] [CrossRef] [PubMed]
  45. Sun, A.; Li, Z. Regulatory role of nitric oxide in lipopolysaccharides-triggered plant innate immunity. Plant Signal Behav. 2013, 8, 1081–1096. [Google Scholar] [CrossRef] [PubMed]
  46. Chen, L.; Liu, Y.; Wu, G.; Zhang, N.; Shen, Q.; Zhang, R. Beneficial rhizobacterium Bacillus amyloliquefaciens SQR9 induces plant salt tolerance through spermidine production. Mol. Plant-Microbe Interact. 2017, 30, 423–432. [Google Scholar] [CrossRef]
  47. Rodríguez-Salazar, J.; Suarez, R.; Caballero-Mellado, J.; Iturriaga, G. Trehalose accumulation in Azospirillum brasilense improves drought tolerance and biomass in maize plants. FEMS Microbiol. Lett. 2009, 296, 52–59. [Google Scholar] [CrossRef]
  48. Elsakhawy, T.A.; Fetyan, N.; Ghazi, A.A. The potential use of ectoine produced by a moderately halophilic bacteria Chromohalobacter salexigens KT989776 for enhancing germination and primary seedling of flax “Linum usitatissimum L.” under salinity conditions. Biotechnol. J. Int. 2019, 23, 1–12. [Google Scholar] [CrossRef]
  49. Yasin, N.A.; Akram, W.; Khan, W.U.; Ahmad, S.R.; Ahmad, A.; Ali, A. Halotolerant plant-growth promoting rhizobacteria modulate gene expression and osmolyte production to improve salinity tolerance and growth in Capsicum annum L. Environ. Sci. Pollut. Res. 2018, 25, 23236–23250. [Google Scholar] [CrossRef]
  50. Mukhtar, S.; Zareen, M.; Khaliq, Z.; Mehnaz, S.; Malik, K. Phylogenetic analysis of halophyte-associated rhizobacteria and effect of halotolerant and halophilic phosphate-solubilizing biofertilizers on maize growth under salinity stress conditions. J. Appl. Microbiol. 2020, 128, 556–573. [Google Scholar] [CrossRef]
  51. Vacheron, J.; Desbrosses, G.; Bouffaud, M.-L.; Touraine, B.; Moënne-Loccoz, Y.; Muller, D.; Legendre, L.; Wisniewski-Dyé, F.; Prigent-Combaret, C. Plant growth-promoting rhizobacteria and root system functioning. Front. Plant Sci. 2013, 4, 57135. [Google Scholar] [CrossRef] [PubMed]
  52. Asai, T.; Tena, G.; Plotnikova, J.; Willmann, M.R.; Chiu, W.-L.; Gomez-Gomez, L.; Boller, T.; Ausubel, F.M.; Sheen, J. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 2002, 415, 977–983. [Google Scholar] [CrossRef] [PubMed]
  53. Heise, A.; Lippok, B.; Kirsch, C.; Hahlbrock, K. Two immediate-early pathogen-responsive members of the AtCMPG gene family in Arabidopsis thaliana and the W-box-containing elicitor-response element of AtCMPG1. Proc. Natl. Acad. Sci. USA 2002, 99, 9049–9054. [Google Scholar] [CrossRef] [PubMed]
  54. Bethke, G.; Pecher, P.; Eschen-Lippold, L.; Tsuda, K.; Katagiri, F.; Glazebrook, J.; Scheel, D.; Lee, J. Activation of the Arabidopsis thaliana mitogen-activated protein kinase MPK11 by the flagellin-derived elicitor peptide, flg22. Mol. Plant Microbe Interact. 2012, 25, 471–480. [Google Scholar] [CrossRef] [PubMed]
  55. Singh, P.; Kuo, Y.-C.; Mishra, S.; Tsai, C.-H.; Chien, C.-C.; Chen, C.-W.; Desclos-Theveniau, M.; Chu, P.-W.; Schulze, B.; Chinchilla, D. The lectin receptor kinase-VI. 2 is required for priming and positively regulates Arabidopsis pattern-triggered immunity. Plant Cell 2012, 24, 1256–1270. [Google Scholar] [CrossRef] [PubMed]
  56. Santamaría, M.E.; Martínez, M.; Arnaiz, A.; Rioja, C.; Burow, M.; Grbic, V.; Díaz, I. An Arabidopsis TIR-lectin two-domain protein confers defense properties against Tetranychus urticae. Plant Physiol. 2019, 179, 1298–1314. [Google Scholar] [CrossRef] [PubMed]
  57. Acharya, B.R.; Raina, S.; Maqbool, S.B.; Jagadeeswaran, G.; Mosher, S.L.; Appel, H.M.; Schultz, J.C.; Klessig, D.F.; Raina, R. Overexpression of CRK13, an Arabidopsis cysteine-rich receptor-like kinase, results in enhanced resistance to Pseudomonas syringae. Plant J. 2007, 50, 488–499. [Google Scholar] [CrossRef] [PubMed]
  58. Lu, H.; Rate, D.N.; Song, J.T.; Greenberg, J.T. ACD6, a novel ankyrin protein, is a regulator and an effector of salicylic acid signaling in the Arabidopsis defense response. Plant Cell 2003, 15, 2408–2420. [Google Scholar] [CrossRef]
  59. Bethke, G.; Grundman, R.E.; Sreekanta, S.; Truman, W.; Katagiri, F.; Glazebrook, J. Arabidopsis PECTIN METHYLESTERASEs contribute to immunity against Pseudomonas syringae. Plant Physiol. 2014, 164, 1093–1107. [Google Scholar] [CrossRef]
  60. Kim, H.G.; Kwon, S.J.; Jang, Y.J.; Nam, M.H.; Chung, J.H.; Na, Y.-C.; Guo, H.; Park, O.K. GDSL LIPASE1 modulates plant immunity through feedback regulation of ethylene signaling. Plant Physiol. 2013, 163, 1776–1791. [Google Scholar] [CrossRef]
  61. Pfalz, M.; Mikkelsen, M.D.; Bednarek, P.; Olsen, C.E.; Halkier, B.A.; Kroymann, J. Metabolic engineering in Nicotiana benthamiana reveals key enzyme functions in Arabidopsis indole glucosinolate modification. Plant Cell 2011, 23, 716–729. [Google Scholar] [CrossRef] [PubMed]
  62. Pfalz, M.; Vogel, H.; Kroymann, J. The gene controlling the indole glucosinolate modifier1 quantitative trait locus alters indole glucosinolate structures and aphid resistance in Arabidopsis. Plant Cell 2009, 21, 985–999. [Google Scholar] [CrossRef] [PubMed]
  63. Schuhegger, R.; Nafisi, M.; Mansourova, M.; Petersen, B.L.; Olsen, C.E.; Svatoš, A.; Halkier, B.A.; Glawischnig, E. CYP71B15 (PAD3) catalyzes the final step in camalexin biosynthesis. Plant Physiol. 2006, 141, 1248–1254. [Google Scholar] [CrossRef] [PubMed]
  64. Millet, Y.A.; Danna, C.H.; Clay, N.K.; Songnuan, W.; Simon, M.D.; Werck-Reichhart, D.; Ausubel, F.M. Innate immune responses activated in Arabidopsis roots by microbe-associated molecular patterns. Plant Cell 2010, 22, 973–990. [Google Scholar] [CrossRef] [PubMed]
  65. Rajniak, J.; Barco, B.; Clay, N.K.; Sattely, E.S. A new cyanogenic metabolite in Arabidopsis required for inducible pathogen defence. Nature 2015, 525, 376–379. [Google Scholar] [CrossRef] [PubMed]
  66. Mizutani, M.; Ohta, D. Diversification of P450 genes during land plant evolution. Annu. Rev. Plant Biol. 2010, 61, 291–315. [Google Scholar] [CrossRef] [PubMed]
  67. Lodeiro, S.; Xiong, Q.; Wilson, W.K.; Kolesnikova, M.D.; Onak, C.S.; Matsuda, S.P. An oxidosqualene cyclase makes numerous products by diverse mechanisms: A challenge to prevailing concepts of triterpene biosynthesis. J. Am. Chem. Soc. 2007, 129, 11213–11222. [Google Scholar] [CrossRef] [PubMed]
  68. Barreto, P.; Arcuri, M.L.C.; Lima, R.P.M.; Marino, C.L.; Maia, I.G. Comprehensive in silico analysis and transcriptional profiles highlight the importance of mitochondrial dicarboxylate carriers (DICs) on hypoxia response in both Arabidopsis thaliana and Eucalyptus grandis. Plants 2022, 11, 181. [Google Scholar] [CrossRef]
  69. Palmieri, L.; Picault, N.; Arrigoni, R.; Besin, E.; Palmieri, F.; Hodges, M. Molecular identification of three Arabidopsis thaliana mitochondrial dicarboxylate carrier isoforms: Organ distribution, bacterial expression, reconstitution into liposomes and functional characterization. Biochem. J. 2008, 410, 621–629. [Google Scholar] [CrossRef]
  70. Alcázar, R.; Bueno, M.; Tiburcio, A.F. Polyamines: Small amines with large effects on plant abiotic stress tolerance. Cells 2020, 9, 2373. [Google Scholar] [CrossRef]
  71. Schuler, M.; Bauer, P. Heavy metals need assistance: The contribution of nicotianamine to metal circulation throughout the plant and the Arabidopsis NAS gene family. Front Plant Sci. 2011, 2, 69. [Google Scholar] [CrossRef] [PubMed]
  72. Wang, J.; Yu, X.; Ding, Z.J.; Zhang, X.; Luo, Y.; Xu, X.; Xie, Y.; Li, X.; Yuan, T.; Zheng, S.J. Structural basis of ALMT1-mediated aluminum resistance in Arabidopsis. Cell Res. 2022, 32, 89–98. [Google Scholar] [CrossRef] [PubMed]
  73. Gilmour, S.J.; Zarka, D.G.; Stockinger, E.J.; Salazar, M.P.; Houghton, J.M.; Thomashow, M.F. Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J. 1998, 16, 433–442. [Google Scholar] [CrossRef] [PubMed]
  74. Bahieldin, A.; Atef, A.; Edris, S.; Gadalla, N.O.; Ramadan, A.M.; Hassan, S.M.; Al Attas, S.G.; Al-Kordy, M.A.; Al-Hajar, A.S.M.; Sabir, J.S.M. Multifunctional activities of ERF109 as affected by salt stress in Arabidopsis. Sci. Rep. 2018, 8, 6403. [Google Scholar] [CrossRef] [PubMed]
  75. Li, Z.; Zhang, Y.; Ren, J.; Jia, F.; Zeng, H.; Li, G.; Yang, X. Ethylene-responsive factor ERF114 mediates fungal pathogen effector PevD1-induced disease resistance in Arabidopsis thaliana. Mol. Plant Pathol. 2022, 23, 819–831. [Google Scholar] [CrossRef] [PubMed]
  76. Kang, H.-G.; Kim, J.; Kim, B.; Jeong, H.; Choi, S.H.; Kim, E.K.; Lee, H.-Y.; Lim, P.O. Overexpression of FTL1/DDF1, an AP2 transcription factor, enhances tolerance to cold, drought, and heat stresses in Arabidopsis thaliana. Plant Sci. 2011, 180, 634–641. [Google Scholar] [CrossRef] [PubMed]
  77. Zou, L.; Yang, F.; Ma, Y.; Wu, Q.; Yi, K.; Zhang, D. Transcription factor WRKY30 mediates resistance to Cucumber mosaic virus in Arabidopsis. Biochem. Biophys. Res. Commun. 2019, 517, 118–124. [Google Scholar] [CrossRef] [PubMed]
  78. Scarpeci, T.E.; Zanor, M.I.; Mueller-Roeber, B.; Valle, E.M. Overexpression of AtWRKY30 enhances abiotic stress tolerance during early growth stages in Arabidopsis thaliana. Plant Mol. Biol. 2013, 83, 265–277. [Google Scholar] [CrossRef] [PubMed]
  79. Zentgraf, U.; Doll, J. Arabidopsis WRKY53, a node of multi-layer regulation in the network of senescence. Plants 2019, 8, 578. [Google Scholar] [CrossRef]
  80. Hu, Y.; Dong, Q.; Yu, D. Arabidopsis WRKY46 coordinates with WRKY70 and WRKY53 in basal resistance against pathogen Pseudomonas syringae. Plant Sci. 2012, 185, 288–297. [Google Scholar] [CrossRef]
  81. Kong, L.; Feng, B.; Yan, Y.; Zhang, C.; Kim, J.H.; Xu, L.; Rack, J.G.M.; Wang, Y.; Jang, J.-C.; Ahel, I. Noncanonical mono (ADP-ribosyl) ation of zinc finger SZF proteins counteracts ubiquitination for protein homeostasis in plant immunity. Mol. Cell 2021, 81, 4591–4604. [Google Scholar] [CrossRef] [PubMed]
  82. Miwa, H.; Kinoshita, A.; Fukuda, H.; Sawa, S. Plant meristems: CLAVATA3/ESR-related signaling in the shoot apical meristem and the root apical meristem. J. Plant Res. 2009, 122, 31–39. [Google Scholar] [CrossRef] [PubMed]
  83. Wen, J.; Lease, K.A.; Walker, J.C. DVL, a novel class of small polypeptides: Overexpression alters Arabidopsis development. Plant J. 2004, 37, 668–677. [Google Scholar] [CrossRef] [PubMed]
  84. Yruela, I. Plant development regulation: Overview and perspectives. J. Plant Physiol. 2015, 182, 62–78. [Google Scholar] [CrossRef]
  85. Fujihara, R.; Uchida, N.; Tameshige, T.; Kawamoto, N.; Hotokezaka, Y.; Higaki, T.; Simon, R.; Torii, K.U.; Tasaka, M.; Aida, M. The boundary-expressed EPIDERMAL PATTERNING FACTOR-LIKE2 gene encoding a signaling peptide promotes cotyledon growth during Arabidopsis thaliana embryogenesis. Plant Biotechnol. 2021, 38, 317–322. [Google Scholar] [CrossRef] [PubMed]
  86. De Smet, I.; Vassileva, V.; De Rybel, B.; Levesque, M.P.; Grunewald, W.; Van Damme, D.; Van Noorden, G.; Naudts, M.; Van Isterdael, G.; De Clercq, R. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science 2008, 322, 594–597. [Google Scholar] [CrossRef] [PubMed]
  87. Cohen, H.; Fedyuk, V.; Wang, C.; Wu, S.; Aharoni, A. SUBERMAN regulates developmental suberization of the Arabidopsis root endodermis. Plant J. 2020, 102, 431–447. [Google Scholar] [CrossRef] [PubMed]
  88. Li, X.; Ma, D.; Lu, S.X.; Hu, X.; Huang, R.; Liang, T.; Xu, T.; Tobin, E.M.; Liu, H. Blue light-and low temperature-regulated COR27 and COR28 play roles in the Arabidopsis circadian clock. Plant Cell 2016, 28, 2755–2769. [Google Scholar] [CrossRef] [PubMed]
  89. Wellmer, F.; Graciet, E.; Riechmann, J.L. Specification of floral organs in Arabidopsis. J. Exp. Bot. 2014, 65, 1–9. [Google Scholar] [CrossRef]
  90. Stenvik, G.-E.; Tandstad, N.M.; Guo, Y.; Shi, C.-L.; Kristiansen, W.; Holmgren, A.; Clark, S.E.; Aalen, R.B.; Butenko, M.A. The EPIP peptide of INFLORESCENCE DEFICIENT IN ABSCISSION is sufficient to induce abscission in Arabidopsis through the receptor-like kinases HAESA and HAESA-LIKE2. Plant Cell 2008, 20, 1805–1817. [Google Scholar] [CrossRef]
  91. Kaufmann, K.; Pajoro, A.; Angenent, G.C. Regulation of transcription in plants: Mechanisms controlling developmental switches. Nat. Rev. Genet. 2010, 11, 830–842. [Google Scholar] [CrossRef] [PubMed]
  92. Preston, J.C.; Jorgensen, S.A.; Orozco, R.; Hileman, L.C. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia. Planta 2016, 243, 429–440. [Google Scholar] [CrossRef] [PubMed]
  93. Santos-Mendoza, M.; Dubreucq, B.; Baud, S.; Parcy, F.; Caboche, M.; Lepiniec, L. Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis. Plant J. 2008, 54, 608–620. [Google Scholar] [CrossRef] [PubMed]
  94. Khan, N.; Bano, A.; Ali, S.; Babar, M.A. Crosstalk amongst phytohormones from planta and PGPR under biotic and abiotic stresses. Plant Growth Regul. 2020, 90, 189–203. [Google Scholar] [CrossRef]
  95. Tognetti, V.B.; Van Aken, O.; Morreel, K.; Vandenbroucke, K.; Van De Cotte, B.; De Clercq, I.; Chiwocha, S.; Fenske, R.; Prinsen, E.; Boerjan, W. Perturbation of indole-3-butyric acid homeostasis by the UDP-glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell 2010, 22, 2660–2679. [Google Scholar] [CrossRef] [PubMed]
  96. Won, C.; Shen, X.; Mashiguchi, K.; Zheng, Z.; Dai, X.; Cheng, Y.; Kasahara, H.; Kamiya, Y.; Chory, J.; Zhao, Y. Conversion of tryptophan to indole-3-acetic acid by TRYPTOPHAN AMINOTRANSFERASES OF ARABIDOPSIS and YUCCAs in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 18518–18523. [Google Scholar] [CrossRef]
  97. Hillebrand, H.; Bartling, D.; Weiler, E.W. Structural analysis of the nit2/nit1/nit3 gene cluster encoding nitrilases, enzymes catalyzing the terminal activation step in indole-acetic acid biosynthesis in Arabidopsis thaliana. Plant Mol. Biol. 1998, 36, 89–99. [Google Scholar] [CrossRef] [PubMed]
  98. Woodward, A.W.; Bartel, B. Auxin: Regulation, action, and interaction. Ann. Bot. 2005, 95, 707–735. [Google Scholar] [CrossRef] [PubMed]
  99. Shin, R.; Burch, A.Y.; Huppert, K.A.; Tiwari, S.B.; Murphy, A.S.; Guilfoyle, T.J.; Schachtman, D.P. The Arabidopsis transcription factor MYB77 modulates auxin signal transduction. Plant Cell 2007, 19, 440–2453. [Google Scholar] [CrossRef]
  100. Wang, L.; Tsuda, K.; Truman, W.; Sato, M.; Nguyen, L.V.; Katagiri, F.; Glazebrook, J. CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. Plant J. 2011, 67, 1029–1041. [Google Scholar] [CrossRef]
  101. Lefebvre, V.; North, H.; Frey, A.; Sotta, B.; Seo, M.; Okamoto, M.; Nambara, E.; Marion-Poll, A. Functional analysis of Arabidopsis NCED6 and NCED9 genes indicates that ABA synthesized in the endosperm is involved in the induction of seed dormancy. Plant J. 2006, 45, 309–319. [Google Scholar] [CrossRef]
  102. Tanaka, H.; Osakabe, Y.; Katsura, S.; Mizuno, S.; Maruyama, K.; Kusakabe, K.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Abiotic stress-inducible receptor-like kinases negatively control ABA signaling in Arabidopsis. Plant J. 2012, 70, 599–613. [Google Scholar] [CrossRef]
  103. Rodrigues, A.; Adamo, M.; Crozet, P.; Margalha, L.; Confraria, A.; Martinho, C.; Elias, A.; Rabissi, A.; Lumbreras, V.; González-Guzmán, M. ABI1 and PP2CA phosphatases are negative regulators of Snf1-related protein kinase1 signaling in Arabidopsis. Plant Cell 2013, 25, 3871–3884. [Google Scholar] [CrossRef]
  104. Rui, Y.; Dinneny, J.R. A wall with integrity: Surveillance and maintenance of the plant cell wall under stress. New Phytol. 2020, 225, 1428–1439. [Google Scholar] [CrossRef]
  105. Goujon, T.; Sibout, R.; Eudes, A.; MacKay, J.; Jouanin, L. Genes involved in the biosynthesis of lignin precursors in Arabidopsis thaliana. Plant Physiol. Biochem. 2003, 41, 677–687. [Google Scholar] [CrossRef]
  106. Fujiwara, S.; Mitsuda, N.; Nakai, Y.; Kigoshi, K.; Suzuki, K.; Ohme-Takagi, M. Chimeric repressor analysis identifies MYB87 as a possible regulator of morphogenesis via cell wall organization and remodeling in Arabidopsis. Biotechnol. Lett. 2014, 36, 1049–1057. [Google Scholar] [CrossRef] [PubMed]
  107. Chezem, W.R.; Memon, A.; Li, F.-S.; Weng, J.-K.; Clay, N.K. SG2-type R2R3-MYB transcription factor MYB15 controls defense-induced lignification and basal immunity in Arabidopsis. Plant Cell 2017, 29, 1907–1926. [Google Scholar] [CrossRef]
  108. Mamaeva, A.; Taliansky, M.; Filippova, A.; Love, A.J.; Golub, N.; Fesenko, I. The role of chloroplast protein remodeling in stress responses and shaping of the plant peptidome. New Phytol. 2020, 227, 1326–1334. [Google Scholar] [CrossRef] [PubMed]
  109. Xiong, Y.; DeFraia, C.; Williams, D.; Zhang, X.; Mou, Z. Deficiency in a cytosolic ribose-5-phosphate isomerase causes chloroplast dysfunction, late flowering and premature cell death in Arabidopsis. Physiol. Plant. 2009, 137, 249–263. [Google Scholar] [CrossRef] [PubMed]
  110. Hou, F.Y.; Huang, J.; Yu, S.L.; Zhang, H.S. The 6-phosphogluconate dehydrogenase genes are responsive to abiotic stresses in rice. J. Integr. Plant Biol. 2007, 49, 655–663. [Google Scholar] [CrossRef]
  111. Tagele, S.B.; Kim, S.W.; Lee, H.G.; Kim, H.S.; Lee, Y.S. Effectiveness of multi-trait Burkholderia contaminans KNU17BI1 in growth promotion and management of banded leaf and sheath blight in maize seedling. Microbiol. Res. 2018, 214, 8–18. [Google Scholar] [CrossRef] [PubMed]
  112. Gu, G.; Wang, N.; Chaney, N.; Smith, L.; Lu, S.-E. AmbR1 is a key transcriptional regulator for production of antifungal activity of Burkholderia contaminans strain MS14. FEMS Microbiol. Lett. 2009, 297, 54–60. [Google Scholar] [CrossRef] [PubMed]
  113. Elshafie, H.S.; Camele, I.; Racioppi, R.; Scrano, L.; Iacobellis, N.S.; Bufo, S.A. In vitro antifungal activity of Burkholderia gladioli pv. agaricicola against some phytopathogenic fungi. Int. J. Mol. Sci. 2012, 13, 16291–16302. [Google Scholar] [CrossRef] [PubMed]
  114. Yeh, Y.-H.; Chang, Y.-H.; Huang, P.-Y.; Huang, J.-B.; Zimmerli, L. Enhanced Arabidopsis pattern-triggered immunity by overexpression of cysteine-rich receptor-like kinases. Front. Plant Sci. 2015, 6, 322. [Google Scholar] [CrossRef] [PubMed]
  115. Ederli, L.; Madeo, L.; Calderini, O.; Gehring, C.; Moretti, C.; Buonaurio, R.; Paolocci, F.; Pasqualini, S. The Arabidopsis thaliana cysteine-rich receptor-like kinase CRK20 modulates host responses to Pseudomonas syringae pv. tomato DC3000 infection. J. Plant Physiol. 2011, 168, 1784–1794. [Google Scholar] [CrossRef] [PubMed]
  116. Kliebenstein, D.J. Secondary metabolites and plant/environment interactions: A view through Arabidopsis thaliana tinged glasses. Plant Cell Environ. 2004, 27, 675–684. [Google Scholar] [CrossRef]
  117. Sankhuan, D.; Ji, M.; Takanashi, S.; Imamura, Y.; Sato, S.; Supaibulwatana, K.; Otani, M.; Nakano, M. Induction of dwarf and early flowering phenotypes in Tricyrtis sp. by ectopic expression of LEAFY from Arabidopsis thaliana. Plant Biotechnol. 2022, 39, 205–208. [Google Scholar] [CrossRef] [PubMed]
  118. Takagi, H.; Hempton, A.K.; Imaizumi, T. Photoperiodic flowering in Arabidopsis: Multilayered regulatory mechanisms of CONSTANS and the florigen FLOWERING LOCUS T. Plant Commun. 2023, 4, 100552. [Google Scholar] [CrossRef] [PubMed]
  119. Jung, J.-H.; Lee, H.-J.; Ryu, J.Y.; Park, C.-M. SPL3/4/5 integrate developmental aging and photoperiodic signals into the FT-FD module in Arabidopsis flowering. Mol. Plant 2016, 9, 1647–1659. [Google Scholar] [CrossRef]
  120. Ogawara, T.; Higashi, K.; Kamada, H.; Ezura, H. Ethylene advances the transition from vegetative growth to flowering in Arabidopsis thaliana. J. Plant Physiol. 2003, 160, 1335–1340. [Google Scholar] [CrossRef]
  121. Adams, D.O.; Yang, S.F. Ethylene biosynthesis: Identification of 1-aminocyclopropane-1-carboxylic acid as an intermediate in the conversion of methionine to ethylene. Proc. Natl. Acad. Sci. USA 1979, 76, 170–174. [Google Scholar] [CrossRef]
  122. Nadeem, S.M.; Zahir, Z.A.; Naveed, M.; Ashraf, M. Microbial ACC-deaminase: Prospects and applications for inducing salt tolerance in plants. Crit. Rew. Plant Sci. 2010, 29, 360–393. [Google Scholar] [CrossRef]
  123. Poupin, M.J.; Greve, M.; Carmona, V.; Pinedo, I. A complex molecular interplay of auxin and ethylene signaling pathways is involved in Arabidopsis growth promotion by Burkholderia phytofirmans PsJN. Front. Plant Sci. 2016, 7, 492. [Google Scholar] [CrossRef]
  124. Gowtham, H.G.; Singh, S.B.; Shilpa, N.; Aiyaz, M.; Nataraj, K.; Udayashankar, A.C.; Amruthesh, K.N.; Murali, M.; Poczai, P.; Gafur, A. Insight into recent progress and perspectives in improvement of antioxidant machinery upon PGPR augmentation in plants under drought stress: A review. Antioxidants 2022, 11, 1763. [Google Scholar] [CrossRef] [PubMed]
  125. Hu, Q.-J.; Chen, M.-X.; Song, T.; Cheng, C.-L.; Tian, Y.; Hu, J.; Zhang, J.-H. Spermidine enhanced the antioxidant capacity of rice seeds during seed aging. Plant Growth Regul. 2020, 91, 397–406. [Google Scholar] [CrossRef]
  126. Wang, C.-Y.; Chen, Y.-W.; Hou, C.-Y. Antioxidant and antibacterial activity of seven predominant terpenoids. Int. J. Food Prop. 2019, 22, 230–238. [Google Scholar] [CrossRef]
  127. Wani, A.B.; Chadar, H.; Wani, A.H.; Singh, S.; Upadhyay, N. Salicylic acid to decrease plant stress. Environ. Chem. Lett. 2017, 15, 15101–15123. [Google Scholar] [CrossRef]
  128. Im Kim, J.; Baek, D.; Park, H.C.; Chun, H.J.; Oh, D.-H.; Lee, M.K.; Cha, J.-Y.; Kim, W.-Y.; Kim, M.C.; Chung, W.S. Overexpression of Arabidopsis YUCCA6 in potato results in high-auxin developmental phenotypes and enhanced resistance to water deficit. Mol. Plant 2013, 6, 337–349. [Google Scholar] [CrossRef] [PubMed]
  129. Mir, A.R.; Alam, P.; Hayat, S. Auxin regulates growth, photosynthetic efficiency and mitigates copper induced toxicity via modulation of nutrient status, sugar metabolism and antioxidant potential in Brassica juncea. Plant Physiol. Biochem. 2022, 185, 244–259. [Google Scholar] [CrossRef]
  130. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef]
  131. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  132. De Coster, W.; D’hert, S.; Schultz, D.T.; Cruts, M.; Van Broeckhoven, C. NanoPack: Visualizing and processing long-read sequencing data. Bioinformatics 2018, 34, 2666–2669. [Google Scholar] [CrossRef]
  133. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
  134. Majoros, W.H.; Pertea, M.; Salzberg, S.L. TigrScan and GlimmerHMM: Two open source ab initio eukaryotic gene-finders. Bioinformatics 2004, 20, 2878–2879. [Google Scholar] [CrossRef]
  135. Lagesen, K.; Hallin, P.; Rødland, E.A.; Stærfeldt, H.-H.; Rognes, T.; Ussery, D.W. RNAmmer: Consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. 2007, 35, 3100–3108. [Google Scholar] [CrossRef]
  136. Lowe, T.M.; Eddy, S.R. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25, 955–964. [Google Scholar] [CrossRef] [PubMed]
  137. Chen, T.-W.; Gan, R.R.; Wu, T.H.; Huang, P.-J.; Lee, C.-Y.; Chen, Y.-Y.M.; Chen, C.-C.; Tang, P. FastAnnotator—An efficient transcript annotation web tool. In BMC Genom: 2012; Springer: Berlin/Heidelberg, Germany, 2012; pp. 1–8. [Google Scholar]
  138. Nautiyal, C.S. An efficient microbiological growth medium for screening phosphate solubilizing microorganisms. FEMS Microbiol. Lett. 1999, 170, 265–270. [Google Scholar] [CrossRef]
  139. Ahmad, F.; Ahmad, I.; Khan, M. Screening of free-living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiol. Res. 2008, 163, 173–181. [Google Scholar] [CrossRef] [PubMed]
  140. Tsai, S.-H.; Hsiao, Y.-C.; Chang, P.E.; Kuo, C.-E.; Lai, M.-C.; Chuang, H.-W. Exploring the biologically active metabolites produced by Bacillus cereus for plant growth promotion, heat stress tolerance, and resistance to bacterial soft rot in Arabidopsis. Metabolites 2023, 13, 676. [Google Scholar] [CrossRef]
  141. Chang, P.E.; Wu, Y.-H.; Tai, C.-Y.; Lin, I.-H.; Wang, W.-D.; Tseng, T.-S.; Chuang, H.-W. Examining the Transcriptomic and Biochemical Signatures of Bacillus subtilis Strains: Impacts on Plant Growth and Abiotic Stress Tolerance. Int. J. Mol. Sci. 2023, 24, 13720. [Google Scholar] [CrossRef]
  142. Kurniawan, A.; Chuang, H.W. Rhizobacterial Bacillus mycoides functions in stimulating the antioxidant defence system and multiple phytohormone signalling pathways to regulate plant growth and stress tolerance. J. Appl. Microbiol. 2022, 132, 1260–1274. [Google Scholar] [CrossRef] [PubMed]
  143. Parcy, F.; Valon, C.; Raynal, M.; Gaubier-Comella, P.; Delseny, M.; Giraudat, J. Regulation of gene expression programs during Arabidopsis seed development: Roles of the ABI3 locus and of endogenous abscisic acid. Plant Cell 1994, 6, 1567–1582. [Google Scholar] [PubMed]
Ijms 25 06091 g001
Figure 1. Gene clusters associated with plant-growth-promotion traits. The BJ3 genome contains candidate genes that function in promoting plant growth.
Figure 1. Gene clusters associated with plant-growth-promotion traits. The BJ3 genome contains candidate genes that function in promoting plant growth.
Ijms 25 06091 g001
Ijms 25 06091 g002
Figure 2. Physiological properties of strain BJ3. The bacterial strain produced IAA; the highest concentration of IAA was detected after a three-day culture period (A). Error bars present the SD from the mean of three replicates. Different letters within the histograms represent statistical significance at a p-value of 0.05. The phosphate-solubilizing activity of the tested bacterial strain is indicated by the production of an obvious clear zone in the NBRIP medium (B). The nitrogen-fixation activity of the tested bacterial strain is indicated by a change in the color of bromothymol blue to yellow (C). The tested bacterial strain inhibited the mycelial growth of Foc TR4, and the rate of mycelial inhibition is indicated at the bottom of the photo (D).
Figure 2. Physiological properties of strain BJ3. The bacterial strain produced IAA; the highest concentration of IAA was detected after a three-day culture period (A). Error bars present the SD from the mean of three replicates. Different letters within the histograms represent statistical significance at a p-value of 0.05. The phosphate-solubilizing activity of the tested bacterial strain is indicated by the production of an obvious clear zone in the NBRIP medium (B). The nitrogen-fixation activity of the tested bacterial strain is indicated by a change in the color of bromothymol blue to yellow (C). The tested bacterial strain inhibited the mycelial growth of Foc TR4, and the rate of mycelial inhibition is indicated at the bottom of the photo (D).
Ijms 25 06091 g002
Ijms 25 06091 g003
Figure 3. Physiological alterations in Arabidopsis seedlings in response to BJ3 treatment. BJ3 inoculation increased the root architecture and lateral root number in seedlings (A). The treated seedlings grown in the soil exhibited increased plant size and fresh weight (B). An early flowering phenotype was observed, and days to flower development were reduced (C). Error bars present the SD from the mean and n = 10. The BJ3 treatment increased lignin content (D), as well as the activity of antioxidant enzymes APX (E) and POD (F). Values in each histogram represent the mean of three replicates ± SD. Different letters within the histograms represent statistical significance at a p-value of 0.05.
Figure 3. Physiological alterations in Arabidopsis seedlings in response to BJ3 treatment. BJ3 inoculation increased the root architecture and lateral root number in seedlings (A). The treated seedlings grown in the soil exhibited increased plant size and fresh weight (B). An early flowering phenotype was observed, and days to flower development were reduced (C). Error bars present the SD from the mean and n = 10. The BJ3 treatment increased lignin content (D), as well as the activity of antioxidant enzymes APX (E) and POD (F). Values in each histogram represent the mean of three replicates ± SD. Different letters within the histograms represent statistical significance at a p-value of 0.05.
Ijms 25 06091 g003
Ijms 25 06091 g004
Figure 4. Drought stress tolerance induced by BJ3. After water deprivation, the seedlings treated with BJ3 exhibited a greater number of unwilted individuals (A); an asterisk indicates the wilted seedlings. The BJ3-treated seedlings showed a higher survival rate (B). Seven days after rewatering following the drought stress treatment, the BJ3-treated seedlings exhibited increases in both plant size (C) and fresh weight (D). Values in each histogram represent the mean of three replicates ± SD. Different letters within the histograms represent statistical significance at a p-value of 0.05.
Figure 4. Drought stress tolerance induced by BJ3. After water deprivation, the seedlings treated with BJ3 exhibited a greater number of unwilted individuals (A); an asterisk indicates the wilted seedlings. The BJ3-treated seedlings showed a higher survival rate (B). Seven days after rewatering following the drought stress treatment, the BJ3-treated seedlings exhibited increases in both plant size (C) and fresh weight (D). Values in each histogram represent the mean of three replicates ± SD. Different letters within the histograms represent statistical significance at a p-value of 0.05.
Ijms 25 06091 g004
Ijms 25 06091 g005
Figure 5. Salt stress tolerance induced by BJ3. Two weeks after the salt stress treatment, the seedlings treated with BJ3 exhibited a larger plant size (A), higher chlorophyll content levels (B), and reduced H2O2 accumulation (C) compared to the control. Different letters within the histograms represent statistical significance at a p-value of 0.05.
Figure 5. Salt stress tolerance induced by BJ3. Two weeks after the salt stress treatment, the seedlings treated with BJ3 exhibited a larger plant size (A), higher chlorophyll content levels (B), and reduced H2O2 accumulation (C) compared to the control. Different letters within the histograms represent statistical significance at a p-value of 0.05.
Ijms 25 06091 g005
Ijms 25 06091 g006
Figure 6. Transcriptomic alterations of Arabidopsis seedlings in response to BJ3 treatment. The BJ3 upregulated genes were classified into eight groups based on their annotated functions; moreover, these groups were assigned to biological functions related to stress tolerance, development, or both (A). The number of genes in each group is presented (B).
Figure 6. Transcriptomic alterations of Arabidopsis seedlings in response to BJ3 treatment. The BJ3 upregulated genes were classified into eight groups based on their annotated functions; moreover, these groups were assigned to biological functions related to stress tolerance, development, or both (A). The number of genes in each group is presented (B).
Ijms 25 06091 g006
Ijms 25 06091 g007
Figure 7. The BJ3 upregulated genes from the Arabidopsis transcriptome analysis. Upregulated genes exhibit annotated functions linked to disease resistance (A), abiotic stress (B), stress-associated transcription factors (TF) (C), vegetative growth (D), reproductive growth (E), hormone signaling (F), cell-wall components (G), and chloroplast function (H). Different shades of red indicate the fold changes in gene expression.
Figure 7. The BJ3 upregulated genes from the Arabidopsis transcriptome analysis. Upregulated genes exhibit annotated functions linked to disease resistance (A), abiotic stress (B), stress-associated transcription factors (TF) (C), vegetative growth (D), reproductive growth (E), hormone signaling (F), cell-wall components (G), and chloroplast function (H). Different shades of red indicate the fold changes in gene expression.
Ijms 25 06091 g007
Table 1. BLAST search results.
Table 1. BLAST search results.
Bacterial StrainsSequence Length (bp)Identity (%)
Burkholderia contaminans strain ILQ216 1420100
Burkholderia contaminans strain XL731337100
Burkholderia sp. strain GB131365100
Burkholderia contaminans strain SK8751337100
Burkholderia sp. strain NFB35 1417100
Burkholderia sp. strain BC 1378100
Burkholderia sp. strain 337D1377100
Burkholderia sp. strain 60H 1368100
Burkholderia sp. strain 40H1374100
Burkholderia sp. strain 1H 1375100
Burkholderia cenocepacia strain PC184 1338100
Table 2. Genes related to plant-growth-promoting traits.
Table 2. Genes related to plant-growth-promoting traits.
Accession No.Gene NameAccession No.Gene Name
IAA synthesis
WP_039362343trpCWP_046196360iaaH
WP_039346423IORWP_039366865IOR
WP_039358309trpBWP_039358314trpA
WP_039356730nthBWP_039356728nthA
WP_027788472trpD
Ethylene synthesis
WP_039371479ACC deaminase
PQQ synthesis
WP_039369440PqqDWP_039369437PqqC
WP_039369434PqqBQFR11588PqqE
Nitrogen fixation
WP_011352562IscU, nifU homologWP_039366622Nif3-like
WP_069586144sigma 54-interactingWP_039364811glnA
WP_039369321glnAWP_039355335glnA
WP_039342705type I methionyl aminopeptidase
Siderophore synthesis
WP_039358638PvdF
NRPS/PKS
WP_039359006NRPSsWP_039358647NRPSs
WP_039366349NRPSsWP_039366347NRPSs
WP_039364197NRPSsWP_039361298PksD
WP_039361196DsbA_FrnE
Hydrolytic enzymes
MBA9830528chitinaseBBA41828cellulase
VOCs
-Terpenoid synthesis
WP_039342858ispFWP_011352390ispD
WP_039342723DxrWP_039360848terpene synthase
-Acetoin biosynthesis
WP_039351048Bdh1WP_039344544Bdh1
Lipopolysaccharide synthesis
WP_039360609waaFWP_039360073LptD
Spermidine synthesis
WP_039360784speDWP_039370372SpdS
WP_039353965speBWP_039360775SPMS
WP_039339273SPMS
Osmolytes synthesis
-Proline
WP_039361374proCWP_039353092proB
WP_039361497proA
-Trehalose
WP_039348314otsBWP_039348312otsA
-Glycine betaine
WP_039369516betAWP_039354575betA
-Ectoine
WP_039344448ectC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chang, Y.-L.; Chang, Y.-C.; Kurniawan, A.; Chang, P.-C.; Liou, T.-Y.; Wang, W.-D.; Chuang, H.-w. Employing Genomic Tools to Explore the Molecular Mechanisms behind the Enhancement of Plant Growth and Stress Resilience Facilitated by a Burkholderia Rhizobacterial Strain. Int. J. Mol. Sci. 2024, 25, 6091. https://doi.org/10.3390/ijms25116091

AMA Style

Chang Y-L, Chang Y-C, Kurniawan A, Chang P-C, Liou T-Y, Wang W-D, Chuang H-w. Employing Genomic Tools to Explore the Molecular Mechanisms behind the Enhancement of Plant Growth and Stress Resilience Facilitated by a Burkholderia Rhizobacterial Strain. International Journal of Molecular Sciences. 2024; 25(11):6091. https://doi.org/10.3390/ijms25116091

Chicago/Turabian Style

Chang, Yueh-Long, Yu-Cheng Chang, Andi Kurniawan, Po-Chun Chang, Ting-Yu Liou, Wen-Der Wang, and Huey-wen Chuang. 2024. "Employing Genomic Tools to Explore the Molecular Mechanisms behind the Enhancement of Plant Growth and Stress Resilience Facilitated by a Burkholderia Rhizobacterial Strain" International Journal of Molecular Sciences 25, no. 11: 6091. https://doi.org/10.3390/ijms25116091

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop