Molecular Markers for Marker-Assisted Breeding for Biotic and Abiotic Stress in Melon (Cucumis melo L.): A Review
Abstract
:1. Introduction
2. Methodology
- Science Direct (www.sciencedirect.com, accessed on 23 June 2023)
- Research gate (www.researchgate.net, accessed on 28 June 2023)
- Google Scholar (scholar.google.com, accessed on 20 July 2023)
- Web of Science TM (www.webofknowledge.com, accessed on 2 August 2023)
- Scopus (www.scopus.com, accessed on 26 August 2023)
3. Molecular Markers for Biotic and Abiotic Stress in Melons
3.1. Biotic Stress
3.1.1. Viral Pathogens
3.1.2. Fungal Pathogens
3.1.3. Bacterial Pathogens
3.1.4. Nematodes
3.1.5. Insects and Herbivores
3.2. Abiotic Stress
3.2.1. Cold/Chilling
3.2.2. Drought
3.2.3. Salt
3.2.4. Toxic Compounds
4. Molecular Markers for Marker-Assisted Backcrossing (MABC) and Cultivar Identification
5. Limitations and Challenges
6. Conclusions and Future Perspectives
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Robinson, R.W.; Whitaker, T.W. Cucumis. In Handbook of Genetics; King, R.C., Ed.; Springer: Boston, MA, USA, 1974; pp. 145–150. ISBN 978-1-4684-2996-1. [Google Scholar]
- Zhao, G.; Lian, Q.; Zhang, Z.; Fu, Q.; He, Y.; Ma, S.; Ruggieri, V.; Monforte, A.J.; Wang, P.; Julca, I. A Comprehensive Genome Variation Map of Melon Identifies Multiple Domestication Events and Loci Influencing Agronomic Traits. Nat. Genet. 2019, 51, 1607–1615. [Google Scholar] [CrossRef] [PubMed]
- Shahwar, D.; Khan, Z.; Park, Y. Molecular Marker-Assisted Mapping, Candidate Gene Identification, and Breeding in Melon (Cucumis melo L.): A Review. Int. J. Mol. Sci. 2023, 24, 15490. [Google Scholar] [CrossRef] [PubMed]
- Vishwakarma, V.K.; Gupta, J.K.; Upadhyay, P.K. Pharmacological importance of Cucumis melo L.: An overview. Asian J. Pharm. Clin. Res. 2017, 10, 8–12. [Google Scholar] [CrossRef]
- FAOSTAT. 2020. Available online: https://www.fao.org/family-farming/detail/en/c/1316738/ (accessed on 29 April 2024).
- Report Linker. Global Melon-Based Beverages Market Report 2021–2028; Report Linker: Lyon, France, 2021. [Google Scholar]
- Roy, S.J.; Tucker, E.J.; Tester, M. Genetic Analysis of Abiotic Stress Tolerance in Crops. Curr. Opin. Plant Biol. 2011, 14, 232–239. [Google Scholar] [CrossRef] [PubMed]
- Ashraf, M.; Wu, L. Breeding for Salinity Tolerance in Plants. Crit. Rev. Plant Sci. 1994, 13, 17–42. [Google Scholar] [CrossRef]
- Baxter, A.; Mittler, R.; Suzuki, N. ROS as Key Players in Plant Stress Signalling. J. Exp. Bot. 2014, 65, 1229–1240. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.-H.; Wu, D.-H.; Huang, J.-H.; Tsao, S.-J.; Hwu, K.-K.; Lo, H.-F. Mapping Quantitative Trait Loci for Fruit Traits and Powdery Mildew Resistance in Melon (Cucumis melo). Bot. Stud. 2016, 57, 19. [Google Scholar] [CrossRef]
- Yuste-Lisbona, F.J.; Capel, C.; Sarria, E.; Torreblanca, R.; Gómez-Guillamón, M.L.; Capel, J.; Lozano, R.; López-Sesé, A.I. Genetic Linkage Map of Melon (Cucumis melo L.) and Localization of a Major QTL for Powdery Mildew Resistance. Mol. Breed. 2011, 27, 181–192. [Google Scholar] [CrossRef]
- Li, B.; Zhao, Y.; Zhu, Q.; Zhang, Z.; Fan, C.; Amanullah, S.; Gao, P.; Luan, F. Mapping of Powdery Mildew Resistance Genes in Melon (Cucumis melo L.) by Bulked Segregant Analysis. Sci. Hortic. 2017, 220, 160–167. [Google Scholar] [CrossRef]
- Branham, S.E.; Kousik, C.; Mandal, M.K.; Wechter, W.P. Quantitative Trait Loci Mapping of Resistance to Powdery Mildew Race 1 in a Recombinant Inbred Line Population of Melon. Plant Dis. 2021, 105, 3809–3815. [Google Scholar] [CrossRef]
- Cao, Y.; Diao, Q.; Chen, Y.; Jin, H.; Zhang, Y.; Zhang, H. Development of KASP Markers and Identification of a QTL Underlying Powdery Mildew Resistance in Melon (Cucumis melo L.) by Bulked Segregant Analysis and RNA-Seq. Front. Plant Sci. 2021, 11, 593207. [Google Scholar] [CrossRef] [PubMed]
- Dogimont, C.; Leconte, L.; Périn, C.; Thabuis, A.; Lecoq, H.; Pitrat, M. Identification of QTLs Contributing to Resistance to Different Strains of Cucumber Mosaic Cucumovirus in Melon. Acta Hortic. 2000, 510, 391–398. [Google Scholar] [CrossRef]
- Essafi, A.; Díaz-Pendón, J.A.; Moriones, E.; Monforte, A.J.; Garcia-Mas, J.; Martín-Hernández, A.M. Dissection of the Oligogenic Resistance to Cucumber Mosaic Virus in the Melon Accession PI 161375. Theor. Appl. Genet. 2009, 118, 275–284. [Google Scholar] [CrossRef]
- Perchepied, L.; Dogimont, C.; Pitrat, M. Strain-Specific and Recessive QTLs Involved in the Control of Partial Resistance to Fusarium Oxysporum f. Sp. Melonis Race 1.2 in a Recombinant Inbred Line Population of Melon. Theor. Appl. Genet. 2005, 111, 65–74. [Google Scholar] [CrossRef]
- Branham, S.E.; Patrick Wechter, W.; Lambel, S.; Massey, L.; Ma, M.; Fauve, J.; Farnham, M.W.; Levi, A. QTL-Seq and Marker Development for Resistance to Fusarium oxysporum f. Sp. Niveum Race 1 in Cultivated Watermelon. Mol. Breed. 2018, 38, 139. [Google Scholar] [CrossRef]
- Frantz, J.D.; Jahn, M.M. Five Independent Loci Each Control Monogenic Resistance to Gummy Stem Blight in Melon (Cucumis melo L.). Theor. Appl. Genet. 2004, 108, 1033–1038. [Google Scholar] [CrossRef]
- Liu, L.; Zhai, W.; Chen, Y.; Zhu, W. QTL Molecular Marker Location of Gummy Stem Blight Resistance in Melon (Cucumis melo). J. Fruit Sci. 2013, 30, 748–752. [Google Scholar]
- Sáez, C.; Esteras, C.; Martínez, C.; Ferriol, M.; Dhillon, N.P.S.; López, C.; Picó, B. Resistance to Tomato Leaf Curl New Delhi Virus in Melon Is Controlled by a Major QTL Located in Chromosome 11. Plant Cell Rep. 2017, 36, 1571–1584. [Google Scholar] [CrossRef] [PubMed]
- Daley, J.; Branham, S.; Levi, A.; Hassell, R.; Wechter, P. Mapping Resistance to Alternaria Cucumerina in Cucumis melo. Phytopathology® 2017, 107, 427–432. [Google Scholar] [CrossRef]
- Branham, S.E.; Daley, J.; Levi, A.; Hassell, R.; Wechter, W.P. QTL Mapping and Marker Development for Tolerance to Sulfur Phytotoxicity in Melon (Cucumis melo). Front. Plant Sci. 2020, 11, 1097. [Google Scholar] [CrossRef]
- Sousaraei, N.; Ramshini, H.; Lotfi, M.; Sharzei, A. Marker Assisted Backcrossing for Introgression of Fusarium Wilt Resistance Gene into Melon. Euphytica 2018, 214, 7. [Google Scholar] [CrossRef]
- Shimira, F.; Uğur, S.; Özdemir, Ş.M.; Mendi, Y.Y. Future and Prospect Use of Pyrethrum (Chrysanthemum Cinerariifolium) as Part of the Integrated Pest and Disease Management (IPDM) Tool in Turkey. Turk. J. Agric.-Food Sci. Technol. 2021, 9, 150–158. [Google Scholar] [CrossRef]
- Gupta, P.K.; Kumar, J.; Mir, R.R.; Kumar, A. Marker-Assisted Selection as a Component of Conventional Plant Breeding. In Plant Breeding Reviews; Janick, J., Ed.; Wiley: Hoboken, NJ, USA, 2010; pp. 145–217. ISBN 978-0-470-52585-2. [Google Scholar]
- Kesh, H.; Kaushik, P. Advances in Melon (Cucumis melo L.) Breeding: An Update. Sci. Hortic. 2021, 282, 110045. [Google Scholar] [CrossRef]
- De Mori, G.; Cipriani, G. Marker-Assisted Selection in Breeding for Fruit Trait Improvement: A Review. Int. J. Mol. Sci. 2023, 24, 8984. [Google Scholar] [CrossRef] [PubMed]
- Ansari, W.A.; Atri, N.; Ahmad, J.; Qureshi, M.I.; Singh, B.; Kumar, R.; Rai, V.; Pandey, S. Drought Mediated Physiological and Molecular Changes in Muskmelon (Cucumis melo L.). PLoS ONE 2019, 14, e0222647. [Google Scholar] [CrossRef] [PubMed]
- Gallitelli, D. The Ecology of Cucumber Mosaic Virus and Sustainable Agriculture. Virus Res. 2000, 71, 9–21. [Google Scholar] [CrossRef]
- Li, N.; Yu, C.; Yin, Y.; Gao, S.; Wang, F.; Jiao, C.; Yao, M. Pepper Crop Improvement Against Cucumber Mosaic Virus (CMV): A Review. Front. Plant Sci. 2020, 11, 598798. [Google Scholar] [CrossRef]
- Lin, H.-X.; Rubio, L.; Smythe, A.; Jiminez, M.; Falk, B.W. Genetic Diversity and Biological Variation among California Isolates of Cucumber Mosaic Virus. J. Gen. Virol. 2003, 84, 249–258. [Google Scholar] [CrossRef]
- Pascual, L.; Yan, J.; Pujol, M.; Monforte, A.J.; Picó, B.; Martín-Hernández, A.M. CmVPS41 Is a General Gatekeeper for Resistance to Cucumber Mosaic Virus Phloem Entry in Melon. Front. Plant Sci. 2019, 10, 479350. [Google Scholar] [CrossRef]
- Karchi, Z. Inheritance of Resistance to Cucumber Mosaic Virus in Melons. Phytopathology 1975, 65, 479. [Google Scholar] [CrossRef]
- Ruiz, L.; López, C.; Picó, B.; Janssen, D. Resistance to Cucumber Green Mottle Mosaic Virus in Cucumis melo. Plants 2021, 10, 1077. [Google Scholar] [CrossRef] [PubMed]
- Baudracco-Arnas, S.; Pitrat, M. A Genetic Map of Melon (Cucumis melo L.) with RFLP, RAPD, Isozyme, Disease Resistance and Morphological Markers. Theor. Appl. Genet. 1996, 93, 57–64. [Google Scholar] [CrossRef]
- Morales, M.; Luís-Arteaga, M.; Álvarez, J.M.; Dolcet-Sanjuan, R.; Monfort, A.; Arús, P.; Garcia-Mas, J. Marker Saturation of the Region Flanking the Gene NSV Conferring Resistance to the Melon Necrotic Spot Carmovirus (MNSV) in Melon. J. Am. Soc. Hortic. Sci. 2002, 127, 540–544. [Google Scholar] [CrossRef]
- Sáez, C.; Flores-León, A.; Montero-Pau, J.; Sifres, A.; Dhillon, N.P.; López, C.; Picó, B. RNA-Seq Transcriptome Analysis Provides Candidate Genes for Resistance to Tomato Leaf Curl New Delhi Virus in Melon. Front. Plant Sci. 2022, 12, 798858. [Google Scholar] [CrossRef] [PubMed]
- Román, B.; Gómez, P.; Janssen, D.; Ruiz, L. Insights into the Key Genes in Cucumis melo and Cucurbita Moschata ToLCNDV Resistance. Horticulturae 2023, 9, 231. [Google Scholar] [CrossRef]
- Amano, M.; Mochizuki, A.; Kawagoe, Y.; Iwahori, K.; Niwa, K.; Svoboda, J.; Maeda, T.; Imura, Y. High-Resolution Mapping of Zym, a Recessive Gene for Zucchini Yellow Mosaic Virus Resistance in Cucumber. Theor. Appl. Genet. 2013, 126, 2983–2993. [Google Scholar] [CrossRef] [PubMed]
- Adler-Berke, N.; Goldenberg, Y.; Brotman, Y.; Kovalski, I.; Gal-On, A.; Doniger, T.; Harel-Beja, R.; Troadec, C.; Bendahmane, A.; Pitrat, M.; et al. The Melon Zym Locus Conferring Resistance to ZYMV: High Resolution Mapping and Candidate Gene Identification. Agronomy 2021, 11, 2427. [Google Scholar] [CrossRef]
- Fang, G. Genetic Engineering of Potyvirus Resistance Using Constructs Derived from the Zucchini Yellow Mosaic Virus Coat Protein Gene. Mol. Plant. Microbe Interact. 1993, 6, 358. [Google Scholar] [CrossRef] [PubMed]
- Danin-Poleg, Y.; Tadmor, Y.; Tzuri, G.; Reis, N.; Hirschberg, J.; Katzir, N. Construction of a Genetic Map of Melon with Molecular Markers and Horticultural Traits, and Localization of Genes Associated with ZYMV Resistance. Euphytica 2002, 125, 373–384. [Google Scholar] [CrossRef]
- Oumouloud, A.; El-Otmani, M.; Chikh-Rouhou, H.; Claver, A.G.; Torres, R.G.; Perl-Treves, R.; Álvarez, J.M. Breeding Melon for Resistance to Fusarium Wilt: Recent Developments. Euphytica 2013, 192, 155–169. [Google Scholar] [CrossRef]
- Deol, J.K.; Sharma, S.P.; Rani, R.; Kalia, A.; Chhuneja, P.; Sarao, N.K. Inheritance Analysis and Identification of SSR Markers Associated with Fusarium Wilt Resistance in Melon. J. Hortic. Sci. Biotechnol. 2022, 97, 66–74. [Google Scholar] [CrossRef]
- Brotman, Y.; Kovalski, I.; Dogimont, C.; Pitrat, M.; Portnoy, V.; Katzir, N.; Perl-Treves, R. Molecular Markers Linked to Papaya Ring Spot Virus Resistance and Fusarium Race 2 Resistance in Melon. Theor. Appl. Genet. 2005, 110, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Sitterly, F.; Keinath, A.P. Gummy Stem Blight. In Compendium of Cucurbit Diseases; Zitter, T.A., Hopkins, D.L., Thomas, C., Eds.; APS Press, The American Phytopathological Society: St. Paul, MN, USA, 1996. [Google Scholar]
- Wolukau, J.N.; Zhou, X.; Chen, J. Identification of Amplified Fragment Length Polymorphism Markers Linked to Gummy Stem Blight (Didymella Bryoniae) Resistance in Melon (Cucumis melo L.) PI 420145. HortScience 2009, 44, 32–34. [Google Scholar] [CrossRef]
- Hassan, M.Z.; Robin, A.H.K.; Rahim, M.A.; Natarajan, S.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Screening of Melon Genotypes Identifies Gummy Stem Blight Resistance Associated with Gsb1 Resistant Loci. J. Plant Biotechnol. 2018, 45, 217–227. [Google Scholar] [CrossRef]
- Hu, Z.; Deng, G.; Mou, H.; Xu, Y.; Chen, L.; Yang, J.; Zhang, M. A Re-Sequencing-Based Ultra-Dense Genetic Map Reveals a Gummy Stem Blight Resistance-Associated Gene in Cucumis melo. DNA Res. 2018, 25, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Xu, B.; Bi, Y.; Lou, Q.; Chen, J.; Qian, C.; Zhang, Y.; Yi, H. Development of a Muskmelon Cultivar with Improved Resistance to Gummy Stem Blight and Desired Agronomic Traits Using Gene Pyramiding. Czech J. Genet. Plant Breed. 2017, 53, 23–29. [Google Scholar] [CrossRef]
- Hassan, M.Z.; Rahim, M.A.; Natarajan, S.; Robin, A.H.K.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Gummy Stem Blight Resistance in Melon: Inheritance Pattern and Development of Molecular Markers. Int. J. Mol. Sci. 2018, 19, 2914. [Google Scholar] [CrossRef] [PubMed]
- Hollomon, D.W.; Wheeler, I.E.; Hollomon, D.W.; Wheeler, I.E. Controlling Powdery Mildews with Chemistry. In The Powdery Mildews: A Comprehensive Treatise; American Phytopathological Society (APS Press): St. Paul, MN, USA, 2022; Volume 17, pp. 249–255. [Google Scholar]
- Jahn, M.; Munger, H.M.; McCreight, J.D. Breeding Cucurbit Crops for Powdery Mildew Resistance. In The Powdery Mildews: A Comprehensive Treatise; American Phytopathological Society (APS Press): St. Paul, MN, USA, 2002; Volume 17, pp. 239–248. [Google Scholar]
- Sun, J.; Dong, Y.; Wang, C.; Xiao, S.; Jiao, Z.; Gao, C. Identification and Characterization of Melon Circular RNAs Involved in Powdery Mildew Responses through Comparative Transcriptome Analysis. PeerJ 2021, 9, e11216. [Google Scholar] [CrossRef]
- Zhang, T.; Xu, N.; Amanullah, S.; Gao, P. Genome-Wide Identification, Evolution, and Expression Analysis of MLO Gene Family in Melon (Cucumis melo L.). Front. Plant Sci. 2023, 14, 1144317. [Google Scholar] [CrossRef]
- Burdman, S.; Walcott, R. Acidovorax Citrulli: Generating Basic and Applied Knowledge to Tackle a Global Threat to the Cucurbit Industry. Mol. Plant Pathol. 2012, 13, 805–815. [Google Scholar] [CrossRef]
- Islam, M.R.; Hossain, M.R.; Jesse, D.M.I.; Jung, H.-J.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Development of Molecular Marker Linked with Bacterial Fruit Blotch Resistance in Melon (Cucumis melo L.). Genes 2020, 11, 220. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.R.; Hossain, M.R.; Jesse, D.M.I.; Jung, H.-J.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Characterization, Identification and Expression Profiling of Genome-Wide R-Genes in Melon and Their Putative Roles in Bacterial Fruit Blotch Resistance. BMC Genet. 2020, 21, 80. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.; Wang, X.; Liu, X.; Yang, S.; Yu, X.; Qian, C.; Li, J.; Lou, Q.; Chen, J. Candidate Genes Underlying the Quantitative Trait Loci for Root-Knot Nematode Resistance in a Cucumis hystrix Introgression Line of Cucumber Based on Population Sequencing. J. Plant Res. 2019, 132, 813–823. [Google Scholar] [CrossRef] [PubMed]
- Sattar, S.; Yan, S.; Ramanjulu, S. Cucumis melo MicroRNA Expression Profile During Aphid Herbivory in a Resistant and Susceptible Interaction. Am. Phytopathol. Soc. 2012, 25, 839–848. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Zhou, Y.-F.; Gao, L.-Y.; Wang, Y.-L.; Yang, L.-M.; Zhu, H.-Y.; Wang, J.-M.; Zhao, S.-J.; Ma, C.-S.; Sun, S.-R.; et al. Dissecting the Genetic Architecture of Melon Chilling Tolerance at the Seedling Stage by Association Mapping and Identification of the Elite Alleles. Front. Plant Sci. 2018, 9, 1577. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Gao, G.; Cao, S.; Xie, Q.; Qi, H. Isolation and Functional Validation of the CmLOX08 Promoter Associated with Signalling Molecule and Abiotic Stress Responses in Oriental Melon, Cucumis melo Var. Makuwa Makino. BMC Plant Biol. 2019, 19, 75. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Shan, C.H.; Ning, M.; Zhao, X.X.; Du, H.F.; Cai, W.C.; Tang, F.X. Transcriptome Profiling of Gold Queen Hami Melons under Cold Stress. Russ. J. Plant Physiol. 2020, 67, 888–897. [Google Scholar] [CrossRef]
- Song, W.; Zhou, F.; Shan, C.; Zhang, Q.; Ning, M.; Liu, X.; Zhao, X.; Cai, W.; Yang, X.; Hao, G. Identification of Glutathione S-Transferase Genes in Hami Melon (Cucumis melo Var. Saccharinus) and Their Expression Analysis under Cold Stress. Front. Plant Sci. 2021, 12, 672017. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Li, Q.; Chen, B.; Wang, J.; Ding, F.; Wang, P.; Zhang, X.; Hou, J.; Luo, R.; Li, X.; et al. Identification of Candidate Genes That Regulate the Trade-off between Seedling Cold Tolerance and Fruit Quality in Melon (Cucumis melo L.). Hortic. Res. 2023, 10, uhad093. [Google Scholar] [CrossRef]
- Ansari, W.A.; Atri, N.; Singh, B.; Pandey, S. Changes in Antioxidant Enzyme Activities and Gene Expression in Two Muskmelon Genotypes under Progressive Water Stress. Biol. Plant. 2017, 61, 333–341. [Google Scholar] [CrossRef]
- Xing, Q.; Liao, J.; Cao, S.; Li, M.; Lv, T.; Qi, H. CmLOX10 Positively Regulates Drought Tolerance through Jasmonic Acid-Mediated Stomatal Closure in Oriental Melon (Cucumis melo Var. Makuwa Makino). Sci. Rep. 2020, 10, 17452. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Wang, L.; Zhang, Y.; Huang, D. Identification of Early Response Genes to Salt Stress in Roots of Melon (Cucumis melo L.) Seedlings. Mol. Biol. Rep. 2013, 40, 2915–2926. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Gao, L.; Zhang, Y.; Zhang, F.; Yang, X.; Huang, D. Genome-Wide Investigation of the NAC Transcription Factor Family in Melon (Cucumis melo L.) and Their Expression Analysis under Salt Stress. Plant Cell Rep. 2016, 35, 1827–1839. [Google Scholar] [CrossRef] [PubMed]
- Shah, I.H.; Manzoor, M.A.; Sabir, I.A.; Ashraf, M.; Haq, F.; Arif, S.; Abdullah, M.; Niu, Q.; Zhang, Y. Genome-Wide Identification and Comparative Analysis of MATE Gene Family in Cucurbitaceae Species and Their Regulatory Role in Melon (Cucumis melo) under Salt Stress. Hortic. Environ. Biotechnol. 2022, 63, 595–612. [Google Scholar] [CrossRef]
- Chevilly, S.; Dolz-Edo, L.; Martínez-Sánchez, G.; Morcillo, L.; Vilagrosa, A.; López-Nicolás, J.M.; Blanca, J.; Yenush, L.; Mulet, J.M. Distinctive traits for drought and salt stress tolerance in melon (Cucumis melo L.). Front. Plant Sci. 2021, 12, 777060. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Chen, K.; Zhang, J.; Wang, J.; Li, H.; Yang, X.; Shi, Q. Genome-Wide Characterization of MATE Family Members in Cucumis melo L. and Their Expression Profiles in Response to Abiotic and Biotic Stress. Hortic. Plant J. 2022, 8, 474–488. [Google Scholar] [CrossRef]
- Cui, H.; Fan, C.; Ding, Z.; Wang, X.; Tang, L.; Bi, Y.; Luan, F.; Gao, P. CmPMRl and CmPMrs Are Responsible for Resistance to Powdery Mildew Caused by Podosphaera Xanthii Race 1 in Melon. Theor. Appl. Genet. 2022, 135, 1209–1222. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Li, C.; Tian, J.; Qiu, Y.; Geng, L.; Wang, J. Identification and Fine Mapping of Gummy Stem Blight Resistance Gene Gsb-7(t) in Melon. Phytopathology 2023, 113, 858–865. [Google Scholar] [CrossRef]
- Olalekan, K.K.; Rafii, M.Y.; Salleh, A.M.; Mohamed, M.T.; Ahmad, K.; Misran, A.; Abro, T.F.; Oladosu, Y.; Arolu, I.W.; Samuel, C. Analysis of Recurrent Parent Genome Recovery in Marker-Assisted Backcross Breeding Programme in Watermelon. Int. J. Sci. Technol. Res. 2019, 8, 945–955. [Google Scholar]
S. No | Traits | QTL Name | Parents | Generation a | Linkage Group | Markers b | Reference |
---|---|---|---|---|---|---|---|
I | Biotic Stress | ||||||
1. | Powdery mildew | qPM2 | TARI-08874xBai-li-gua | F2 | II | CSJCT358, CMBR120 | [10] |
Pm-R | TGR-1551 x Bola de Ora | F2 | V | PM3-CAPS | [11] | ||
BPm12.1 | MR-1xTop Mark | F2 | XII | (CAPS) BSA12-LI3ECORI, BSA12-LI4HINFI | [12] | ||
qPx1-5 | PI 124111x Ananas Yokne’am (AY) | RIL | V | (KASP) pm1-5_25329892, pm1-5_25461503 pm1-5_25625375 | [13] | ||
qPx1-12 | XII | (KASP) pm1-12_22848920 pm1-12_22904659 | |||||
CmPMR-12 | Wm-6x 12D-1 | F2 | XII | (KASP) KA002213 and KA002215 | [14] | ||
2. | Cucumber mosaic virus (CMV) | CmVPS41 | Védrantais x PI 161375 | RILs | NA | NA | [15] |
A major QTL | Piel de Sapo x PI 161375 | NILs | XII | CMN61_44, CMN21_55 | [16] | ||
3. | Fusarim wilt | qFom-1.2-9 | Védrantais x Isabelle. | RIL | IX | NA | [17] |
qFom-1.2-11 | XI | NA | |||||
qFom1-2 | MR1x Ananas Yok’neum | RIL | II | S2_15048162, S2_15110453 | [18] | ||
qFom1-7 | VII | S7_13949405, S7_13949474 | |||||
qFom1-11 | IX | S11_6921979 | |||||
qFom1-12 | XII | S12_18312135, S12_18322152, S12_18322266, S12_18380444 | |||||
4. | Gummy stem blight | Gsb-1 | Cornell ZPPM 339’ x PI482399 | F2 | I | NA | [19] |
Gsb-2 | II | NA | |||||
Gsb-3 | III | NA | |||||
Gsb-4 | IV | NA | |||||
gsb-5 | V | NA | |||||
gsb1.1 | JSD-3 x S717 | F2:3 | I | NA | [20] | ||
gsb2.1 | II | NA | |||||
gsb3.1 | III | NA | |||||
gsb5.1 | V | NA | |||||
gsb6.1 | VI | NA | |||||
5. | Tomato leaf curl New Delhi virus (ToLCNDV) | ToLCNDVVT30_2 | WM-7x Piel de Sapo | F2 and BC1 | II | CMPSNP658 | [21] |
ToLCNDVSy15_11 | XI | CMPSNP475 | |||||
ToLCNDVSy30_11 | XI | CMPSNP475 | |||||
ToLCNDVVT30_11 | XI | CMPSNP475 | |||||
ToLCNDVSy15_12 | XII | AI_35-A08 | |||||
ToLCNDVSy30_12 | XII | AI_35-A08 | |||||
ToLCNDVVT30_12 | XII | AI_35-A08 | |||||
6. | Alternaria leaf blight (ALB) | qALB-10 | MR-1x Ananas | RIL | X | S10_10324787 | [22] |
qALB-12 | XII | S12_22731131 | |||||
II | Abiotic stress | ||||||
1. | Sulfur tolerance | qSulf-1 | MR-1x Ananas Yok’neum | RILs | I | Sulf1_33860724, Sulf1-33791317, Sulf1-33804906, Sulf1-33835488, Sulf1-33851209 | [23] |
qSulf-12 | XII | NA | |||||
qSulf-8 | VIII | NA |
Traits | Locus Name | Gene ID | Gene Function | Chr. | Marker Name (Type a) | Primer Sequence (5′–3′) | Ref. |
---|---|---|---|---|---|---|---|
Bacterial fruit blotch | NA | MELO3C022157 | TIR-NBS-LRR domain | 9 | MB157 (InDel) | F: ATGGAAGCAATTGAGGAATC R: TACAATGACCTAGTACTCCC | [58] |
NA | MELO3C023441 | Receptor-kinase, putative | 1 | M3441 | F: GGGAAAGAGTTAAATGCGAC R: CCATCTAGACCTTGGTTTCC | [59] | |
MELO3C016529 | TMV resistance protein N | 6 | M6529 | F: CCGTGTGGCGGTCGGCGGTG R: ACAATGCCGCCACCGTCTTC | |||
MELO3C022157 | TMV resistance protein N-like isoform X1 | 9 | M2157 | F: GGAATCCATGGACGACGGAA R: TCCCTCCACCGATGAACCTG | |||
MELO3C022146 | TMV resistance protein N-like | 9 | M2146 | F: GTACGGATGAACAAAAGCAT R: TCCATTGTTGAACCTCCTCC | |||
MELO3C025518 | Disease resistance protein RGA2-like | 9 | M5518 | F: GGCACACGGTTTTCTTCAAC R: TTCTTCTATTCTTCTGGTCC | |||
MELO3C004303 | TMV resistance protein N-like | 5 | M4303 | F: GGTTGGTGGACGTGATTGGT R: ACTTTCCTTAAAAGCATGCC | |||
Zucchini Yellow Mosaic Virus | Zym | MELO3C015342 | Myb/SANT-like DNA-binding domain protein | 2 | NA | NA | [41] |
MELO3C015353 | Disease resistance protein | 2 | |||||
Tomato leaf curl New Delhi virus (ToLCNDV) | NA | MELO3C022327 | Putative transmembrane protein | 11 | NA | F: CTTTCATCATGGTGTTCTCCGC R: AGAACAATCCTACCGTCGTTCC | [38] |
MELO3C022337 | Auxin-responsive protein SAUR36 | NA | |||||
MELO3C022319 | DNA primase large subunit | F: AGTTGCTCGGTTGATTGGTC R: CGTCAGACTTAGGGCCTTTG | |||||
Powdery mildew | NA | MELO3C002434 | ankyrin repeats containing protein | 12 | NA | NA | [14] |
O | CmMLO5 MELO3C012438 | MLO-like protein | 10 | NA | F: ATGGCTGAATGTGGAACAGAGCA R: TCATTTGGCAAATGAGAAGTCCGA | [56] | |
NA | CmPMRl MELO3C002441 | Ankyrin repeat family protein | 12 | PM12R-5 (CAPS) | F:GCCAACTAAGAGAATGTTCA R:AATGCTGGAGATGCTGTC | [74] | |
PM12R-6 (CAPS) | F:TATACCTCATCATCTCACTCC R:TGGTCGGTGTTGATACTAC | ||||||
CmPMrs MELO3C012438 | MLO-like protein | 10 | PM10m-4 (CAPS) | F:TGGTTGAGAGCTTCATAGAT R:CCAAATGATTAGGTGTAGATGG | |||
PM10m-5 (CAPS) | F:CAATCCTGGCATACATTATCC R:CACTGTCACTATGGCTCAC | ||||||
Cucumber mosaic virus (CMV) | cmv1 | CmVPS41 | Vacuolar protein sorting 41 | NA | NA | NA | [33] |
Gummy stem blight | Gsb5.1 | MELO3C022157 | Nucleotide binding site–leucine-rich repeat | 9 | Kh-GSB9-1 (Indel) | F: GTTAGGAAACAACAGACCTCCA R: CAGAACGCACAAAACTCAAAGGAC | [52] |
Kh-GSB9-2 (Indel) | F: CCTAATAGTCCTTTGAGTTTTGTGCG R: GGTGTGCTTGGATTGGCTTTCT | ||||||
Gsb | MELO3C012987 | Encoding protein similar to the uncharacterized Avr9/Cf-9 rapidly elicited (ACRE) protein 146 | 4 | NA | F: AGCAAGCTCATGGTTGATCTC F: GAGAAGGCGAGACCAGAGAC | [50] | |
Gsb-7(t) | MELO3C010403 | Putative receptor-like protein kinase | 7 | NA | NA | [75] | |
Chilling/Cold tolerance | CMCT505 | MELO3C013397, MELO3C013398, MELO3C013399, MELO3C013400, MELO3C013401, MELO3C013402, MELO3C013403 | SAUR-like auxin-responsive family protein | 1 | NA | NA | [62] |
MELO3C013404 | Cellulose synthase catalytic subunit | ||||||
MELO3C013405 | Methionine-tRNA ligase | ||||||
MELO3C013406 | tRNA-dihydrouridine(47) synthase [NAD(P)(+)] | ||||||
MELO3C013407 | Putative transcription factor | ||||||
MELO3C013408 | Putative transcription factor PosF21 | ||||||
MELO3C013409 | GAGA-binding transcriptional activator | ||||||
MELO3C013410, MELO3C013411 | NADP-dependent D-sorbitol-6-phosphate dehydrogenase | ||||||
NA | CmEAF7 MELO3C012147.2 | Subunit of nucleosome acetyltransferase of H4 complex (NuA4) | 10 | NA | F: TCTGAGCTCTCTAGAATGGAAA R: TTTGGCGTCTTCCATAGACTCT | [66] | |
Drought tolerance | NA | CmLOX10 | NA | 5 | NA | F: TGACAGGACAAGGAGTTC R: CGGTATTGGCAAGAATGTTA | [68] |
Salt and Drought tolerance | NA | CmLOX08 MELO3C011885 | Lipoxygenase | 10 | LOX08pro | F: TAGTAGCATTGGGCACATA R: TATTAGCGTCTGCGGAGA | [63] |
Autotoxicity and saline-alkali stresses | NA | CmMYB2R40, CmMYB2R54 | NA | 4 | NA | NA | [64] |
Sulphur phytotoxicity | NA | MELO3C024245 | Sorting nexin-13 | 1 | NA | NA | [23] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shahwar, D.; Khan, Z.; Park, Y. Molecular Markers for Marker-Assisted Breeding for Biotic and Abiotic Stress in Melon (Cucumis melo L.): A Review. Int. J. Mol. Sci. 2024, 25, 6307. https://doi.org/10.3390/ijms25126307
Shahwar D, Khan Z, Park Y. Molecular Markers for Marker-Assisted Breeding for Biotic and Abiotic Stress in Melon (Cucumis melo L.): A Review. International Journal of Molecular Sciences. 2024; 25(12):6307. https://doi.org/10.3390/ijms25126307
Chicago/Turabian StyleShahwar, Durre, Zeba Khan, and Younghoon Park. 2024. "Molecular Markers for Marker-Assisted Breeding for Biotic and Abiotic Stress in Melon (Cucumis melo L.): A Review" International Journal of Molecular Sciences 25, no. 12: 6307. https://doi.org/10.3390/ijms25126307