MassARRAY and SABER Analyses of SNPs in Embryo DNA Reveal the Abscission of Self-Fertilised Progeny during Fruit Development of Macadamia (Macadamia integrifolia Maiden & Betche)
Abstract
:1. Introduction
2. Results
2.1. Fruitlet Retention
2.2. Biomass and Nutrient Accumulation in Fruitlets
2.3. Nut Quality
3. Discussion
3.1. Fruitlet Retention
3.2. Nut Quality
4. Materials and Methods
4.1. Study Site and Sampling Design
4.2. Sample Collection and Processing
4.3. Paternity Analysis
4.4. Mineral Nutrient Analysis
4.5. Determination of Oil Concentration
4.6. Relationships between Paternity and Fruitlet or Nut Quality
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- van Dijk, M.; Morley, T.; Rau, M.L.; Saghai, Y. Systematic review and meta-analysis of global food security projections to 2050. Nat. Food 2021, 2, 494–501. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.; Engel, B.A.; Qian, H.; Hua, E.; Sun, S.; Wang, Y. Will reaching the maximum achievable yield potential meet future global food demand? J. Clean. Prod. 2021, 294, 126285. [Google Scholar] [CrossRef]
- United Nations. Peace, Dignity and Equality on a Health Planet. Available online: https://www.un.org/en/global-issues/population#:~:text=The%20world%20population%20is%20projected,surrounding%20these%20latest%20population%20projections (accessed on 9 May 2024).
- Mueller, N.D.; Binder, S. Closing yield gaps: Consequences for the global food supply, environmental quality & food security. Daedalus 2015, 144, 45–56. [Google Scholar]
- Ashraf, M.Y.; Ashraf, M.; Akhtar, M.; Mahmood, K.; Saleem, M. Improvement in yield, quality and reduction in fruit drop in kinnow (Citrus reticulata Blanco) by exogenous application of plant growth regulators, potassium and zinc. Pak. J. Bot. 2013, 45, 433–440. [Google Scholar]
- Nasir, M.; Khan, A.S.; Basra, S.A.; Malik, A.U. Foliar application of moringa leaf extract, potassium and zinc influence yield and fruit quality of ‘Kinnow’ mandarin. Sci. Hortic. 2016, 210, 227–235. [Google Scholar] [CrossRef]
- Li, C.; Wang, Y.; Huang, X.; Li, J.; Wang, H.; Li, J. An improved fruit transcription and the identification of the candidate genes involved in fruit abscission induced by carbohydrate stress in litchi. Front. Plant Sci. 2015, 6, 439. [Google Scholar] [PubMed]
- Lordan, J.; Zazurca, L.; Rovira, M.; Torguet, L.; Batlle, I.; DeJong, T.; Miarnau, X. Almond fruit drop patterns under Mediterranean conditions. Agriculture 2021, 11, 544. [Google Scholar] [CrossRef]
- Trueman, S.J.; Turnbull, C.G.N. Fruit set, abscission and dry matter accumulation on girdled branches of macadamia. Ann. Bot. 1994, 74, 667–674. [Google Scholar] [CrossRef]
- Alcaraz, M.L.; Hormaza, J.I. Optimization of controlled pollination in avocado (Persea americana Mill., Lauraceae). Sci. Hortic. 2014, 180, 79–85. [Google Scholar] [CrossRef]
- Hapuarachchi, N.S.; Kämper, W.; Wallace, H.M.; Hosseini Bai, S.; Ogbourne, S.M.; Nichols, J.; Trueman, S.J. Boron effects on fruit set, yield, quality and paternity of Hass avocado. Agronomy 2022, 12, 1479. [Google Scholar] [CrossRef]
- Mitra, S.K.; Pereira, L.S.; Pathak, P.K.; Majumdar, D. Fruit abscission pattern of lychee cultivars. Acta Hortic. 2005, 665, 215–218. [Google Scholar] [CrossRef]
- Wallace, H.M.; Vithanage, V.; Exley, E.M. The effect of supplementary pollination on nut set of Macadamia (Proteaceae). Ann. Bot. 1996, 78, 765–773. [Google Scholar] [CrossRef]
- Trueman, S.J.; Kämper, W.; Nichols, J.; Ogbourne, S.M.; Hawkes, D.; Peters, T.; Hosseini Bai, S.; Wallace, H.M. Pollen limitation and xenia effects in a cultivated mass-flowering tree, Macadamia integrifolia (Proteaceae). Ann. Bot. 2022, 129, 135–146. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, A.G. Flower and fruit abortion: Proximate causes and ultimate functions. Annu. Rev. Ecol. Syst. 1981, 12, 253–279. [Google Scholar] [CrossRef]
- Ahmad, I.; Bibi, F.; Ullah, H.; Munir, T.M. Mango fruit yield and critical quality parameters respond to foliar and soil applications of zinc and boron. Plants 2018, 7, 97. [Google Scholar] [CrossRef] [PubMed]
- Herbert, S.W.; Walton, D.A.; Wallace, H.M. The influence of pollen-parent and carbohydrate availability on macadamia yield and nut size. Sci. Hortic. 2019, 244, 406–412. [Google Scholar] [CrossRef]
- McFadyen, L.M.; Robertson, D.; Sedgley, M.; Kristiansen, P.; Olesen, T. Post-pruning shoot growth increases fruit abscission and reduces stem carbohydrates and yield in macadamia. Ann. Bot. 2011, 107, 993–1001. [Google Scholar] [CrossRef]
- Stephenson, R.A.; Gallagher, E.C. Effects of temperature on premature nut drop in macadamia. Qld. J. Agric. Anim. Sci. 1986, 43, 97–100. [Google Scholar]
- Stephenson, R.A.; Gallagher, E.C. Effects of temperature, tree water status and relative humidity on premature nut drop from macadamia. Sci. Hortic. 1987, 33, 113–121. [Google Scholar] [CrossRef]
- Quentin, A.G.; Close, D.C.; Hennen, L.M.H.P.; Pinkard, E.A. Down-regulation of photosynthesis following girdling, but contrasting effects on fruit set and retention, in two sweet cherry cultivars. Plant Physiol. Biochem. 2013, 73, 359–367. [Google Scholar] [CrossRef]
- Rivas, F.; Erner, Y.; Alós, E.; Juan, M.; Almela, V.; Agustí, M. Girdling increases carbohydrate availability and fruit-set in citrus cultivars irrespective of parthenocarpic ability. J. Hortic. Sci. Biotechnol. 2006, 81, 289–295. [Google Scholar] [CrossRef]
- Yang, W.H.; Lu, C.Z.; Chen, W.; Xu, H.Y. Reduction of early fruit abscission by main-branch-girdling in macadamia is related to the favorable status of carbohydrates and endogenous hormones. HortScience 2022, 57, 40–47. [Google Scholar] [CrossRef]
- Khan, S.U.; Alizai, A.A.; Ahmed, N.; Sayed, S.; Junaid, M.; Kanwal, M.; Ahmed, S.; Alqubaie, A.I.; Alamer, K.H.; Ali, E.F. Investigating the role of potassium and urea to control fruit drop and to improve fruit quality of “Dhakki” date palm. Saudi J. Biol. Sci. 2022, 29, 3806–3814. [Google Scholar] [CrossRef] [PubMed]
- Dag, A.; Eisenstein, D.; Gazit, S.; El-Batsri, R.; Degani, C. Effect of pollenizer distance and selective fruitlet abscission on outcrossing rate and yield in ‘Tommy Atkins’ mango. J. Am. Soc. Hortic. Sci. 1998, 123, 618–622. [Google Scholar] [CrossRef]
- Degani, C.; El-Batsri, R.; Gazit, S. Outcrossing rate, yield, and selective fruit abscission in ‘Ettinger’ and ‘Ardith’ avocado plots. J. Am. Soc. Hortic. Sci. 1997, 122, 813–817. [Google Scholar] [CrossRef]
- Degani, C.; Stern, R.A.; El-Batsri, R.; Gazit, S. Pollen parent effect on the selective abscission of ‘Mauritius’ and ‘Floridian’ lychee fruitlets. J. Am. Soc. Hortic. Sci. 1995, 120, 523–526. [Google Scholar] [CrossRef]
- Vaughton, G.; Carthew, S.M. Evidence for selective fruit abortion in Banksia spinulosa (Proteaceae). Biol. J. Linn. Soc. 1993, 50, 35–46. [Google Scholar] [CrossRef]
- Charlesworth, D.; Charlesworth, B. Inbreeding depression and its evolutionary consequences. Annu. Rev. Ecol. Syst. 1987, 18, 237–268. [Google Scholar] [CrossRef]
- Charlesworth, D.; Willis, J.H. The genetics of inbreeding depression. Nat. Rev. Genet. 2009, 10, 783–796. [Google Scholar] [CrossRef]
- Husband, B.C.; Schemske, D.W. Evolution of the magnitude and timing of inbreeding depression in plants. Evolution 1996, 50, 54–70. [Google Scholar] [CrossRef]
- Seavey, S.R.; Carter, S.K. Self-sterility in Epilobium obcordatum (Onagraceae). Am. J. Bot. 1994, 81, 331–338. [Google Scholar]
- Seavey, S.R.; Bawa, K.S. Late-acting self-incompatibility in angiosperms. Bot. Rev. 1986, 52, 195–219. [Google Scholar] [CrossRef]
- Sage, T.L.; Sampson, F.B. Evidence for ovarian self-incompatibility as a cause of self-sterility in the relictual woody angiosperm, Pseudowintera axillaris (Winteraceae). Ann. Bot. 2003, 91, 807–816. [Google Scholar] [CrossRef] [PubMed]
- Bittencourt, N.S. Evidence for post-zygotic self-incompatibility in Handroanthus impetiginosus (Bignoniaceae). Plant Reprod. 2017, 30, 69–79. [Google Scholar] [CrossRef] [PubMed]
- Martínez-García, P.J.; Dicenta, F.; Ortega, E. Anomalous embryo sac development and fruit abortion caused by inbreeding depression in almond (Prunus dulcis). Sci. Hortic. 2012, 133, 23–30. [Google Scholar] [CrossRef]
- Valtueña, F.J.; Rodríguez-Riaño, T.; Espinosa, F.; Ortega-Olivencia, A. Self-sterility in two Cytisus species (Leguminosae, Papilionoideae) due to early-acting inbreeding depression. Am. J. Bot. 2010, 97, 123–135. [Google Scholar] [CrossRef] [PubMed]
- Xiong, H.; Zou, F.; Guo, S.; Yuan, D.; Niu, G. Self-sterility may be due to prezygotic late-acting self-incompatibility and early-acting inbreeding depression in Chinese chestnut. J. Am. Soc. Hortic. Sci. 2019, 144, 172–181. [Google Scholar] [CrossRef]
- Production of Tree Nuts Worldwide in 2020/2021, by Type (in 1,000 Metric Tons). Available online: https://www.statista.com/statistics/1030790/tree-nut-global-production-by-type/ (accessed on 28 February 2024).
- Olesen, T.; Huett, D.; Smith, G. The production of flowers, fruit and leafy shoots in pruned macadamia trees. Funct. Plant Biol. 2011, 38, 327–336. [Google Scholar] [CrossRef] [PubMed]
- Urata, U. Pollination Requirements of Macadamia; Hawaii Agricultural Experiment Station Technical Bulletin No. 22; Hawaii Agricultural Experiment Station: Honolulu, HI, USA, 1954.
- Trueman, S.J.; Turnbull, C.G.N. Effects of cross-pollination and flower removal on fruit set in macadamia. Ann. Bot. 1994, 73, 23–32. [Google Scholar] [CrossRef]
- Sedgley, M. Early development of the Macadamia ovary. Aust. J. Bot. 1981, 29, 185–193. [Google Scholar] [CrossRef]
- Sedgley, M. Pollen tube growth in macadamia. Sci. Hortic. 1983, 18, 333–341. [Google Scholar] [CrossRef]
- Sedgley, M.; Bell, F.D.H.; Bell, D.; Winks, C.W.; Pattison, S.J.; Hancock, T.W. Self- and cross-compatibility of macadamia cultivars. J. Hortic. Sci. 1990, 65, 205–213. [Google Scholar] [CrossRef]
- Meyers, N.; McConchie, C.; Turnbull, C.; Vithanage, V. Cross pollination and intervarietal compatibility in macadamia. Aust. Macadamia Soc. News Bull. 1995, 22, 5–8. [Google Scholar]
- De Silva, A.L.; Kämper, W.; Wallace, H.M.; Ogbourne, S.M.; Hosseini Bai, S.; Nichols, J.; Trueman, S.J. Boron effects on fruit set, yield, quality and paternity of macadamia. Agronomy 2022, 12, 684. [Google Scholar] [CrossRef]
- Kämper, W.; Trueman, S.J.; Ogbourne, S.M.; Wallace, H.M. Pollination services in a macadamia cultivar depend on across-orchard transport of cross pollen. J. Appl. Ecol. 2021, 58, 2529–2539. [Google Scholar] [CrossRef]
- Langdon, K.S.; King, G.J.; Nock, C.J. DNA paternity testing indicates unexpectedly high levels of self-fertilisation in macadamia. Tree Genet. Genomes 2019, 15, 29. [Google Scholar] [CrossRef]
- Richards, T.E.; Kämper, W.; Trueman, S.J.; Wallace, H.M.; Ogbourne, S.M.; Brooks, P.R.; Nichols, J.; Hosseini Bai, S. Relationships between nut size, kernel quality, nutritional composition and levels of outcrossing in three macadamia cultivars. Plants 2020, 9, 228. [Google Scholar] [CrossRef] [PubMed]
- Trueman, S.J.; Penter, M.G.; Malagodi-Braga, K.S.; Nichols, J.; De Silva, A.L.; Ramos, A.T.M.; Moriya, L.M.; Ogbourne, S.M.; Hawkes, D.; Peters, T.; et al. High outcrossing levels among global macadamia cultivars: Implications for nut quality, orchard designs and pollinator management. Horticulturae 2024, 10, 203. [Google Scholar] [CrossRef]
- Fattahi, R.; Mohammadzedeh, M.; Khadivi-Khub, A. Influence of different pollen sources on nut and kernel characteristics of hazelnut. Sci. Hortic. 2014, 173, 15–19. [Google Scholar] [CrossRef]
- Trueman, S.J.; Nichols, J.; Farrar, M.B.; Wallace, H.M.; Hosseini Bai, S. Outcrossing rate and fruit yield of Hass avocado trees decline at increasing distance from a polliniser cultivar. Agronomy 2024, 14, 122. [Google Scholar] [CrossRef]
- Kämper, W.; Thorp, G.; Wirthensohn, M.; Brooks, P.; Trueman, S.J. Pollen paternity can affect kernel size and nutritional composition of self-incompatible and new self-compatible almond cultivars. Agronomy 2021, 11, 326. [Google Scholar] [CrossRef]
- Klatt, B.K.; Holzschuh, A.; Westphal, C.; Clough, Y.; Smit, I.; Pawelzik, E.; Tscharntke, T. Bee pollination improves crop quality, shelf life and commercial value. Proc. R. Soc. B Biol. Sci. 2014, 281, 20132440. [Google Scholar] [CrossRef] [PubMed]
- Herbert, S.W.; Walton, D.A.; Wallace, H.M. Pollen-parent affects fruit, nut and kernel development of Macadamia. Sci. Hortic. 2019, 244, 406–412. [Google Scholar] [CrossRef]
- Denney, J.O. Xenia includes metaxenia. HortScience 1992, 27, 722–728. [Google Scholar] [CrossRef]
- Olfati, J.A.; Sheykhtaher, Z.; Qamgosar, R.; Khasmakhi-Sabet, A.; Peyvast, G.H.; Samizadeh, H.; Rabiee, B. Xenia and metaxenia on cucumber fruit and seed characteristics. Int. J. Veg. Sci. 2010, 16, 243–252. [Google Scholar] [CrossRef]
- Ding, C.; Chiu, R.W.K.; Lau, T.K.; Leung, T.N.; Chan, L.C.; Chan, A.Y.Y.; Charoenkwan, P.; Ng, I.S.L.; Law, H.; Ma, E.S.K.; et al. MS analysis of single-nucleotide differences in circulating nucleic acids: Application to noninvasive prenatal diagnosis. Proc. Nat. Acad. Sci. USA 2004, 101, 10762–10767. [Google Scholar] [CrossRef] [PubMed]
- Raz, A.; Goldway, M.; Sapir, G.; Stern, R.A. “Hong Long” lychee (Litchi chinensis Sonn.) is the optimal pollinizer for the main lychee cultivars in Israel. Plants 2022, 11, 1996. [Google Scholar] [CrossRef]
- Degani, C.; Goldring, A.; Gazit, S. Pollen-parent effect on outcrossing rate in ‘Hass’ and ‘Fuerte’ avocado plots during fruit development. J. Am. Soc. Hortic. Sci. 1989, 114, 106–111. [Google Scholar] [CrossRef]
- Kämper, W.; Nichols, J.; Tran, T.D.; Burwell, C.J.; Byrnes, S.; Trueman, S.J. Flower visitors, levels of cross-fertilisation, and pollen-parent effects on fruit quality in mango orchards. Agronomy 2023, 13, 2568. [Google Scholar] [CrossRef]
- Kämper, W.; Ogbourne, S.M.; Hawkes, D.; Trueman, S.J. SNP markers reveal relationships between fruit paternity, fruit quality and distance from a cross-pollen source in avocado orchards. Sci. Rep. 2021, 11, 20043. [Google Scholar] [CrossRef]
- Stern, R.A.; Gazit, S.; El-Batsri, R.; Degani, C. Pollen parent effect on outcrossing rate, yield, and fruit characteristics of ‘Floridian’ and’ Mauritius’ lychee. J. Am. Soc. Hortic. Sci. 1993, 118, 109–114. [Google Scholar] [CrossRef]
- Bianchi, M.B.; Meagher, T.R.; Gibbs, P.E. Do s genes or deleterious recessives control late-acting self-incompatibility in Handroanthus heptaphyllus (Bignoniaceae)? A diallel study with four full-sib progeny arrays. Ann. Bot. 2021, 127, 723–736. [Google Scholar] [CrossRef] [PubMed]
- Hao, Y.-Q.; Zhao, X.-F.; She, D.-Y.; Xu, B.; Zhang, D.-Y.; Liao, W.-J. The role of late-acting self-incompatibility and early-acting inbreeding depression in governing female fertility in monkshood, Aconitum kusnezoffii. PLoS ONE 2012, 7, e47034. [Google Scholar] [CrossRef] [PubMed]
- Australian Macadamia Society. Fact Sheet. Pollination; Australian Macadamia Society: Lismore, Australia, 2022. [Google Scholar]
- Boyton, S.J.; Hardner, C.M. Phenology of flowering and nut production in macadamia. Acta Hortic. 2000, 575, 381–387. [Google Scholar] [CrossRef]
- Richards, A.J. Plant Breeding Systems; Chapman & Hall: London, UK, 1997. [Google Scholar]
- Trueman, S.J.; Wallace, H.M. Pollination and resource constraints on fruit set and fruit size of Persoonia rigida (Proteaceae). Ann. Bot. 1999, 83, 145–155. [Google Scholar] [CrossRef]
- McFadyen, L.M.; Morris, S.G.; McConchie, C.A.; Oldham, M.A. Effect of hedging and tree removal on productivity of crowding macadamia orchards. Aust. J. Exp. Agric. 2005, 45, 725–730. [Google Scholar] [CrossRef]
- McFadyen, L.; Robertson, D.; Sedgley, M.; Kristiansen, P.; Olesen, T. Time of pruning affects fruit abscission, stem carbohydrates and yield of macadamia. Funct. Plant Biol. 2012, 39, 481–492. [Google Scholar] [CrossRef] [PubMed]
- Nagao, M.A.; Sakai, W.S. Effects of gibberellic acid, ethephon or girdling on the production of racemes in Macadamia integrifolia. Sci. Hortic. 1990, 42, 47–54. [Google Scholar] [CrossRef]
- Brittain, C.; Kremen, C.; Garber, A.; Klein, A.-M. Pollination and plant resources change the nutritional quality of almonds for human health. PLoS ONE 2014, 9, e90082. [Google Scholar] [CrossRef]
- Strohschen, B. Contributions to the biology of useful plants. IV: Anatomical studies of fruit development and fruit classification of the macadamia nut (Macadamia integrifolia Maiden and Betche). Angew. Bot. 1986, 60, 239–247. [Google Scholar]
- Trueman, S.J. The reproductive biology of macadamia. Sci. Hortic. 2013, 150, 354–359. [Google Scholar] [CrossRef]
- O’Hare, P.; Stephenson, R.; Quinlan, K.; Vock, N. Macadamia Grower’s Handbook; Queensland Department of Primary Industries and Fisheries: Nambour, Australia, 2004.
- Australian Macadamia Society. The Australian Macadamia Industry; Australian Macadamia Society: Lismore, Australia, 2017. [Google Scholar]
- Department of Agriculture and Fisheries. Macadamia Industry Benchmark Report, 2009–2019 Seasons; State of Queensland: Brisbane, Australia, 2019.
- Australian Macadamia Society. Kernel Quality Standard for Processors; Australian Macadamia Society: Lismore, Australia, 2018. [Google Scholar]
- Penter, M.G.; Nkwana, E.; Nxundu, Y. Factors influencing kernel breakage in the South African macadamia industry. S. Afr. Macadamia Grow. Assoc. Yearb. 2008, 16, 6–10. [Google Scholar]
- Carisio, L.; Díaz, S.S.; Ponso, S.; Manino, A.; Porporato, M. Effects of pollinizer density and apple tree position on pollination efficiency in cv. Gala. Sci. Hortic. 2020, 273, 109629. [Google Scholar] [CrossRef]
- Sánchez-Estrada, A.; Cuevas, J. Pollination strategies to improve fruit set in orchards of ‘Manzanillo’ olive in a nontraditional producing country, Mexico. HortTechnology 2019, 29, 258–264. [Google Scholar] [CrossRef]
- Trueman, S.J.; McConchie, C.A.; Turnbull, C.G.N. Ethephon promotion of crop abscission for unshaken and mechanically shaken macadamia. Aust. J. Exp. Agric. 2002, 42, 1001–1008. [Google Scholar] [CrossRef]
- Kron, P.; Husband, B.C.; Kevan, P.G.; Belaoussoff, S. Factors affecting pollen dispersal in high-density apple orchards. HortScience 2001, 36, 1039–1046. [Google Scholar] [CrossRef]
- Matsumoto, S.; Eguchi, T.; Maejima, T.; Komatsu, H. Effect of distance from early flowering pollinizers ‘Maypole’ and ‘Dolgo’ on ‘Fiji’ fruit set. Sci. Hortic. 2008, 117, 151–159. [Google Scholar] [CrossRef]
- Müller, J.L.; Steyn, W.J.; Theron, K.I. The effect of cross-pollination of southern highbush blueberries on fruit set and fruit characteristics. Acta Hortic. 2013, 1007, 571–578. [Google Scholar] [CrossRef]
- Gehrke-Vélez, M.; Castillo-Vera, A.; Ruiz-Bello, C.; Moreno-Martinez, J.L.; Moreno-Basurto, G. Delayed self-incompatibility causes morphological alterations and crop reduction in ‘Ataúlfo’ mango (Mangifera indica L.). N. Z. J. Crop Hortic. Sci. 2012, 40, 215–227. [Google Scholar] [CrossRef]
- Lucas-García, R.; Rosas-Guerrero, V.; Alemán-Figueroa, L.; Almazán-Núñez, R.C.; Violante-González, J.; Kuk-Dzul, J.G. Spatial proximity of ‘Ataulfo’ to ‘Haden’ cultivar increases mango yield and decreases incidence of nubbins. Agronomy 2021, 11, 450. [Google Scholar] [CrossRef]
- Żurawicz, E.; Studnicki, M.; Kubik, J.; Pruski, K. A careful choice of compatible pollinizers significantly improves the size of fruits in red raspberry (Rubus idaeus L.). Sci. Hortic. 2018, 235, 253–257. [Google Scholar] [CrossRef]
- Meyers, N.M.; Morris, S.C.; McFadyen, L.M.; Huett, D.O.; McConchie, C.A. Investigation of sampling procedures to determine macadamia fruit quality in orchards. Aust. J. Exp. Agric. 1999, 39, 1007–1012. [Google Scholar] [CrossRef]
- Ivanova, N.V.; Fazekas, A.J.; Hebert, P.D.N. Semi-automated, membrane-based protocol for DNA isolation from plants. Plant Mol. Biol. Rep. 2008, 26, 186. [Google Scholar] [CrossRef]
- McGeehan, S.L.; Naylor, D.V. Automated instrumental analysis of carbon and nitrogen in plant and soil samples. Commun. Soil Sci. Plant Anal. 1988, 19, 493–505. [Google Scholar] [CrossRef]
- Rayment, G.E.; Higginson, F.R. Australian Laboratory Handbook of Soil and Water Chemical Methods; Inkata: Melbourne, Australia, 1992. [Google Scholar]
- Martinie, G.D.; Schilt, A.A. Investigation of the wet oxidation efficiencies of perchloric acid mixtures for various organic substances and the identities of residual matter. Anal. Chem. 1976, 48, 70–74. [Google Scholar] [CrossRef]
- Munter, R.C.; Grande, R.A. Plant tissue and soil extract analysis by ICP-atomic emission spectrometry. In Developments in Atomic Plasma Spectrochemical Analysis; Byrnes, R.M., Ed.; Heyden: London, UK, 1981; pp. 653–672. [Google Scholar]
- McConchie, C.A.; Meyers, N.M.; Anderson, K.; Vivian-Smith, A.; O’Brien, S.; Richards, S. Development and maturation of macadamia nuts in Australia. In Challenges for Horticulture in the Tropics: Proceedings of the Third Australian Society of Horticultural Science and the First Australian Macadamia Society Research Workshop, Broadbeach, QLD, Australia, 18–22 August 1996; Stephenson, R.A., Winks, C.W., Eds.; Australian Society of Horticultural Science: Brisbane, Australia, 1996; pp. 234–238. [Google Scholar]
- Trueman, S.J.; Richards, S.; McConchie, C.A.; Turnbull, C.G.N. Relationships between kernel oil content, fruit removal force and abscission in macadamia. Aust. J. Exp. Agric. 2000, 40, 859–866. [Google Scholar] [CrossRef]
Cultivar | Common Macadamia Allele | Private Cultivar Allele | DNA Sequence with SNP | 816 | 741 | 842 | A203 | A4 |
---|---|---|---|---|---|---|---|---|
816 | T | C | GGTCGTTACGCNGGCAGAAAAGCNGTAATAGTTNAGATCCTTCGACGATGGAACNTCGAGACCGTCCTTACGGCCATTGCTTGGT[T/C]GNCAGGAATCNGCCAAATACCCCAAGAAGGTNATTCGCAAGGATTCAGCNAAG | CC | TT | TT | TT | TT |
741 | G | T | TGCAGATTNCAATGTAAGAGGTACTAACCCANAACGAAGACAACTN[G/T]TCACTTTCTTTCCATTTGGCAAGCTNCCACTTGCTTTCTGCATCCANAANGAACACGTATTATATGACAAAAACAAGACTAAGTTNTCCAACAAAGA | GG | TT | GG | GG | GG |
741 | T | A | TGCAGGAATCTATCCTGCTATGGCAAAGAAAATGCGAGGATGCTCTGTATTCCCTNTCTCATTCTTGGTGCTCGTCNGGCCTGTAAGGCGTTTGGCATCATTAGN[T/A]ATGGCGAGAATTATATTAAAGGGTGATGGCATTTCG | TT | AA | TT | TT | TT |
741 | C | T | TGCAGGAATCTATCCTGCTATGGCAAAGAAAATGCGAGGATGCTCTGTATTCCCTNTCTCATTCTTGGTGCTCGTCNGGCCTGTAAGGCGTTTGGCATCATTAG[C/T]NATGGCGAGAATTATATNTAAAGGGTGATGGCATTTCG | CC | TT | CC | CC | CC |
842 | A | G | TTATTAATGCTCCTATCTCCTCCCTGTNTCCTGTTCCCTCAAGATTCCGCAGTTGGGCTTCTN[A/G]GCTTAGATATGTTCTCTAGCCATCAATTTTTTAATTTGNGACTATCTCCTTCTTTCTGGNGNAAGAATTTGGACC | AA | AA | GG | AA | AA |
A203 | T | C | TGCAGAACCAAGAGAGCACCATNCGCAACAACTCTTAGAACACNTGCACAATGACTAAGANTGCAGGATTATTTACTAN[T/C]TGCTTGCCACTTTTGAAACTAAGAACNAATATCTTCCATTCCTGANAGAAACAACTCCAAACAG | TT | TT | TT | CC | TT |
A4 | G | A | TGCAGCACAGTGGCATTGTANTGCAATTTCGTTGGAGCAGGNGGGGAGAGGGTAAAGGACTTCAAAAGATGTTTCN[G/A]AATATCTTGCAGAAGGCTTAGTCCTACTNTNTTGAGACCATTAATTAGTTGTATGAATATGAACTACA | GG | GG | GG | GG | AA |
A4 | G | T | TGCAGTTTCAGCAATCGACTCTGCTTCGATACGTGTGAGCNTCCTCACTGACAATGTCAGCAGCTTCACCAA[G/T]NGGCAAGAGCAATAGCAGCTTGAGCTTTTGTNGACTGGCTTATCTGGCTGAANAAAGTCTCGTGTAACCTG | GG | GG | GG | GG | TT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Silva, A.L.; Kämper, W.; Ogbourne, S.M.; Nichols, J.; Royle, J.W.L.; Peters, T.; Hawkes, D.; Hosseini Bai, S.; Wallace, H.M.; Trueman, S.J. MassARRAY and SABER Analyses of SNPs in Embryo DNA Reveal the Abscission of Self-Fertilised Progeny during Fruit Development of Macadamia (Macadamia integrifolia Maiden & Betche). Int. J. Mol. Sci. 2024, 25, 6419. https://doi.org/10.3390/ijms25126419
De Silva AL, Kämper W, Ogbourne SM, Nichols J, Royle JWL, Peters T, Hawkes D, Hosseini Bai S, Wallace HM, Trueman SJ. MassARRAY and SABER Analyses of SNPs in Embryo DNA Reveal the Abscission of Self-Fertilised Progeny during Fruit Development of Macadamia (Macadamia integrifolia Maiden & Betche). International Journal of Molecular Sciences. 2024; 25(12):6419. https://doi.org/10.3390/ijms25126419
Chicago/Turabian StyleDe Silva, Anushika L., Wiebke Kämper, Steven M. Ogbourne, Joel Nichols, Jack W. L. Royle, Trent Peters, David Hawkes, Shahla Hosseini Bai, Helen M. Wallace, and Stephen J. Trueman. 2024. "MassARRAY and SABER Analyses of SNPs in Embryo DNA Reveal the Abscission of Self-Fertilised Progeny during Fruit Development of Macadamia (Macadamia integrifolia Maiden & Betche)" International Journal of Molecular Sciences 25, no. 12: 6419. https://doi.org/10.3390/ijms25126419