Arginine Vasotocin Directly Regulates Spermatogenesis in Adult Zebrafish (Danio rerio) Testes
Abstract
:1. Introduction
2. Results
2.1. Transcript Levels for AVT and AVP Receptors
2.2. Effect of AVT on Basal Spermatogenesis
2.2.1. The Role of Androgens
2.2.2. Effect of AVT on Transcript Abundance of Selected Genes Involved in Spermatogenesis
3. Discussion
4. Material and Methods
4.1. Animals
4.2. Hormones and Chemicals
4.3. Ex Vivo Testis Culture
4.4. RNA Extraction and RT-qPCR
4.5. Quantification of Androgen Released (ELISA)
4.6. Histomorphometric Analysis
4.7. BrdU Incorporation Assay
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Singh, V.; Joy, K. Vasotocin induces final oocyte maturation and ovulation through the production of a maturation-inducing steroid in the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. 2011, 174, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Altmieme, Z.; Jubouri, M.; Touma, K.; Coté, G.; Fonseca, M.; Julian, T.; Mennigen, J. A reproductive role for the nonapeptides vasotocin and isotocin in male zebrafish (Danio rerio). Comp. Biochem. Physiol. Part B: Biochem. Mol. Biol. 2019, 238, 110333. [Google Scholar] [CrossRef] [PubMed]
- Kalamarz-Kubiak, H.; Kleszczyńska, A.; Kulczykowska, E. Cortisol stimulates arginine vasotocin and isotocin release from the hypothalamo-pituitary complex of round goby (Neogobius melanostomus): Probable mechanisms of action. J. Exp. Zool. Part A: Ecol. Integr. Physiol. 2015, 323, 616–626. [Google Scholar] [CrossRef] [PubMed]
- Tong, S.-K.; Lee, H.-L.; Lee, Y.-C.; Wu, L.-C.; Tsou, Y.-L.; Lu, S.-W.; Shih, S.-W.; Hwang, P.-P.; Chou, M.-Y. Arginine Vasopressin Modulates Ion and Acid/Base Balance by Regulating Cell Numbers of Sodium Chloride Cotransporter and H+-ATPase Rich Ionocytes. Int. J. Mol. Sci. 2020, 21, 3957. [Google Scholar] [CrossRef]
- Landin, J.; Hovey, D.; Xu, B.; Lagman, D.; Zettergren, A.; Larhammar, D.; Kettunen, P.; Westberg, L. Oxytocin Receptors Regulate Social Preference in Zebrafish. Sci. Rep. 2020, 10, 5435. [Google Scholar] [CrossRef] [PubMed]
- Balment, R.; Lu, W.; Weybourne, E.; Warne, J. Arginine vasotocin a key hormone in fish physiology and behaviour: A review with insights from mammalian models. Gen. Comp. Endocrinol. 2006, 147, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Saito, N.; Kinzler, S.; Koike, T. Arginine vasotocin and mesotocin levels in theca and granulosa layers of the ovary during the oviposition cycle in hens (Gallus domesticus). Gen. Comp. Endocrinol. 1990, 79, 54–63. [Google Scholar] [CrossRef] [PubMed]
- Mennigen, J.A.; Ramachandran, D.; Shaw, K.; Chaube, R.; Joy, K.P.; Trudeau, V.L. Reproductive roles of the vasopressin/oxytocin neuropeptide family in teleost fishes. Front. Endocrinol. 2022, 13, 1005863. [Google Scholar] [CrossRef] [PubMed]
- Birnbaumer, M. Vasopressin Receptors. Trends Endocrinol. Metab. 2000, 11, 406–410. [Google Scholar] [CrossRef]
- Daza, D.O.; Bergqvist, C.A.; Larhammar, D. The Evolution of Oxytocin and Vasotocin Receptor Genes in Jawed Vertebrates: A Clear Case for Gene Duplications through Ancestral Whole-Genome Duplications. Front. Endocrinol. 2022, 12, 792644. [Google Scholar] [CrossRef]
- Theofanopoulou, C.; Gedman, G.; Cahill, J.A.; Boeckx, C.; Jarvis, E.D. Universal nomenclature for oxytocin–vasotocin ligand and receptor families. Nature 2021, 592, 747–755. [Google Scholar] [CrossRef] [PubMed]
- Rawat, A.; Chaube, R.; Joy, K.P. In situ localization of vasotocin receptor gene transcripts in the brain-pituitary-gonadal axis of the catfish Heteropneustes fossilis: A morpho-functional study. Fish Physiol. Biochem. 2019, 45, 885–905. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.; Joy, K. Relative in vitro seasonal effects of vasotocin and isotocin on ovarian steroid hormone levels in the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. 2009, 162, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez, M.; Specker, J.L. In vitro effects of arginine vasotocin on testosterone production by testes of rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 1991, 83, 249–257. [Google Scholar] [CrossRef] [PubMed]
- Ramallo, M.R.; Grober, M.; Cánepa, M.M.; Morandini, L.; Pandolfi, M. Arginine-vasotocin expression and participation in reproduction and social behavior in males of the cichlid fish Cichlasoma dimerus. Gen. Comp. Endocrinol. 2012, 179, 221–231. [Google Scholar] [CrossRef] [PubMed]
- Wisdom, K.S.; Bhat, I.A.; Pathan, M.A.; I, C.T.; Kumar, P.; Babu, P.G.; Walke, P.; Nayak, S.K.; Sharma, R. Teleost Nonapeptides, Isotocin and Vasotocin Administration Released the Milt by Abdominal Massage in Male Catfish, Clarias magur. Front. Endocrinol. 2022, 13, 899463. [Google Scholar] [CrossRef] [PubMed]
- Kwon, W.-S.; Park, Y.-J.; Kim, Y.-H.; You, Y.-A.; Kim, I.C.; Pang, M.-G. Vasopressin Effectively Suppresses Male Fertility. PLoS ONE 2013, 8, e54192. [Google Scholar] [CrossRef]
- Millar, R.P. GnRHs and GnRH receptors. Anim. Reprod. Sci. 2005, 88, 5–28. [Google Scholar] [CrossRef] [PubMed]
- Moussavi, M.; Wlasichuk, M.; Chang, J.P.; Habibi, H.R. Seasonal effects of GnIH on basal and GnRH-induced goldfish somatotrope functions. J. Endocrinol. 2014, 223, 191–202. [Google Scholar] [CrossRef]
- Ma, Y.; Ladisa, C.; Chang, J.; Habibi, H. Multifactorial control of reproductive and growth axis in male goldfish: Influences of GnRH, GnIH and thyroid hormone. Mol. Cell. Endocrinol. 2019, 500, 110629. [Google Scholar] [CrossRef]
- Pati, D.; Habibi, H.R. Involvement of protein kinase C and arachidonic acid pathways in the gonadotropin-releasing hormone regulation of oocyte meiosis and follicular steroidogenesis in the goldfish ovary. Biol. Reprod. 2002, 66, 813–822. [Google Scholar] [CrossRef]
- Pati, D.; Habibi, H. Direct action of GnRH variants on goldfish oocyte meiosis and follicular steroidogenesis. Mol. Cell. Endocrinol. 2000, 160, 75–88. [Google Scholar] [CrossRef]
- Habibi, H.R.; Pati, D. Extrapituitary gonadotropin-releasing hormone (GnRH) binding sites in goldfish. Fish Physiol. Biochem. 1993, 11, 43–49. [Google Scholar] [CrossRef]
- Fallah, H.P.; Rodrigues, M.S.; Corchuelo, S.; Nóbrega, R.H.; Habibi, H.R. Role of GnRH Isoforms in Paracrine/Autocrine Control of Zebrafish (Danio rerio) Spermatogenesis. Endocrinology 2020, 161, bqaa004. [Google Scholar] [CrossRef]
- Fallah, H.P.; Rodrigues, M.S.; Zanardini, M.; Nóbrega, R.H.; Habibi, H.R. Effects of gonadotropin-inhibitory hormone on early and late stages of spermatogenesis in ex-vivo culture of zebrafish testis. Mol. Cell. Endocrinol. 2021, 520, 111087. [Google Scholar] [CrossRef]
- Fallah, H.P.; Tovo-Neto, A.; Yeung, E.C.; Nóbrega, R.H.; Habibi, H.R. Paracrine/autocrine control of spermatogenesis by gonadotropin-inhibitory hormone. Mol. Cell. Endocrinol. 2019, 492, 110440. [Google Scholar] [CrossRef]
- Ramakrishnappa, N.; Rajamahendran, R.; Lin, Y.-M.; Leung, P. GnRH in non-hypothalamic reproductive tissues. Anim. Reprod. Sci. 2005, 88, 95–113. [Google Scholar] [CrossRef]
- Rodrigues, M.S.; Fallah, H.P.; Zanardini, M.; Malafaia, G.; Habibi, H.R.; Nóbrega, R.H. Interaction between thyroid hormones and gonadotropin inhibitory hormone in ex vivo culture of zebrafish testis: An approach to study multifactorial control of spermatogenesis. Mol. Cell. Endocrinol. 2021, 532, 111331. [Google Scholar] [CrossRef]
- Leal, M.C.; de Waal, P.P.; García-López, Á.; Chen, S.X.; Bogerd, J.; Schulz, R.W. Zebrafish primary testis tissue culture: An approach to study testis function ex vivo. Gen. Comp. Endocrinol. 2009, 162, 134–138. [Google Scholar] [CrossRef]
- Schulz, R.W.; de França, L.R.; Lareyre, J.J.; Le Gac, F.; Chiarini-Garcia, H.; Nobrega, R.H.; Miura, T. Spermatogenesis in fish. Gen. Comp. Endocrinol. 2010, 165, 390–411. [Google Scholar] [CrossRef]
- Nóbrega, R.H.; Morais, R.D.; Crespo, D.; De Waal, P.P.; De França, L.R.; Schulz, R.W.; Bogerd, J. Fsh stimulates spermatogonial proliferation and differentiation in zebrafish via Igf3. Endocrinology 2015, 156, 3804–3817. [Google Scholar] [CrossRef]
- Wilczynski, W.; Quispe, M.; Muñoz, M.I.; Penna, M. Arginine Vasotocin, the Social Neuropeptide of Amphibians and Reptiles. Front. Endocrinol. 2017, 8, 186. [Google Scholar] [CrossRef]
- Salek, S.J.; Sullivan, C.V.; Godwin, J. Arginine vasotocin effects on courtship behavior in male white perch (Morone americana). Behav. Brain Res. 2002, 133, 177–183. [Google Scholar] [CrossRef]
- Goodson, J.L.; Bass, A.H. Social behavior functions and related anatomical characteristics of vasotocin/vasopressin systems in vertebrates. Brain Res. Rev. 2001, 35, 246–265. [Google Scholar] [CrossRef]
- Ramachandran, D.; Sharma, K.; Saxena, V.; Nipu, N.; Rajapaksha, D.C.; Mennigen, J.A. Knock-out of vasotocin reduces reproductive success in female zebrafish, Danio rerio. Front. Endocrinol. 2023, 14, 1151299. [Google Scholar] [CrossRef] [PubMed]
- Bankir, L.; Bichet, D.G.; Morgenthaler, N.G. Vasopressin: Physiology, assessment and osmosensation. J. Intern. Med. 2017, 282, 284–297. [Google Scholar] [CrossRef]
- Acharjee, A.; Chaube, R.; Joy, K. Reproductive stage- and sex-dependant effects of neurohypophyseal nonapeptides on gonadotropin subunit mRNA expression in the catfish Heteropneustes fossilis: An in vitro study. Gen. Comp. Endocrinol. 2018, 260, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Hausmann, H.; Richters, A.; Kreienkamp, H.J.; Meyerhof, W.; Mattes, H.; Lederis, K.; Zwiers, H.; Richter, D. Mutational analysis and molecular modeling of the nonapeptide hormone binding domains of the [Arg8] vasotocin receptor. Proc. Natl. Acad. Sci. USA 1996, 93, 6907–6912. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, Y.; Tang, Q.; Hu, F.; Feng, L.; Shen, J.; Huang, B. The protective effects of selenium-enriched spirulina on the reproductive system of male zebrafish (Danio rerio) exposed to beta-cypermethrin. Food Funct. 2018, 9, 5791–5804. [Google Scholar] [CrossRef]
- García-López, A.; de Jonge, H.; Nóbrega, R.H.; de Waal, P.P.; van Dijk, W.; Hemrika, W.; Taranger, G.L.; Bogerd, J.; Schulz, R.W. Studies in Zebrafish Reveal Unusual Cellular Expression Patterns of Gonadotropin Receptor Messenger Ribonucleic Acids in the Testis and Unexpected Functional Differentiation of the Gonadotropins. Endocrinology 2010, 151, 2349–2360. [Google Scholar] [CrossRef]
- Safian, D.; Bogerd, J.; Schulz, R.W. Regulation of spermatogonial development by Fsh: The complementary roles of locally produced Igf and Wnt signaling molecules in adult zebrafish testis. Gen. Comp. Endocrinol. 2019, 284, 113244. [Google Scholar] [CrossRef] [PubMed]
- Sambroni, E.; Rolland, A.D.; Lareyre, J.-J.; Le Gac, F. Fsh and Lh have common and distinct effects on gene expression in rainbow trout testis. J. Mol. Endocrinol. 2013, 50, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Assis, L.H.D.C.; Henrique, L.; Assis, D.C.; De Nóbrega, R.H.; Gómez-González, N.E. Estrogen-induced inhibition of spermatogenesis in zebrafish is largely reversed by androgen. J. Mol. Endocrinol. 2018, 60, 273–284. [Google Scholar] [CrossRef] [PubMed]
- Crespo, D.; Lemos, M.S.; Zhang, Y.T.; Safian, D.; Norberg, B.; Bogerd, J.; Schulz, R.W. PGE2 inhibits spermatogonia differentiation in zebrafish: Interaction with Fsh and an androgen. J. Endocrinol. 2020, 244, 163–175. [Google Scholar] [CrossRef] [PubMed]
- Toni, L.S.; Garcia, A.M.; Jeffrey, D.A.; Jiang, X.; Stauffer, B.L.; Miyamoto, S.D.; Sucharov, C.C. Optimization of phenol-chloroform RNA extraction. MethodsX 2018, 5, 599–608. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Yeung, E.C.; Chan, C.K. Glycol methacrylate: The art of embedding and serial sectioning. Botany 2014, 93, 1–8. [Google Scholar] [CrossRef]
- Brown, D.L. Bias in image analysis and its solution: Unbiased stereology. J. Toxicol. Pathol. 2017, 30, 183–191. [Google Scholar] [CrossRef] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Skaar, K.S.; Nóbrega, R.H.; Magaraki, A.; Olsen, L.C.; Schulz, R.W.; Male, R. Proteolytically activated, recombinant anti-Müllerian hormone inhibits androgen secretion, proliferation, and differentiation of spermatogonia in adult zebrafish testis organ cultures. Endocrinology 2011, 152, 3527–3540. [Google Scholar] [CrossRef]
Gene | FWD Primer Sequence (5′-3′) | REV Primer Sequence (5′-3′) | GenBank Accession No. | Melting Temp. (°C) | Reference |
---|---|---|---|---|---|
eef1a1l1 | AAGACAACCCCAAGGCTCTCA | CCTTTGGAACGGTGTGATTGA | NM_131263.1 | 59 | [26] |
cyp17a | GGGAGGCCACGGACTGTTA | CCATGTGGAACTGTAGTCAGCAA | NM_212806.3 | 61 | [26] |
fshr | GAGGATTCCCAGTAATGCTTTCCT | TCTATCTCACGAATCCCGTTCTTC | AY278107.1 | 60 | [45] |
lhr | CGCTCAGTACCATCCAATGCT | TTGAAGGCATGGCTCTCTATTTCT | AY714133.1 | 60 | [45] |
piwil1 | GATACCGCTGCTGGAAAAAGG | GCAAGACACACTTGGAGAACCA | NM_183338.1 | 56 | [46] |
insl3 | TCGCATCGTGTGGGAGTTT | TGCACAACGAGGTCTCTATCCA | NM_001115053.2 | 58 | [46] |
sycp3 | AGAAGCTGACCCAAGATCATTCC | AGCTTCAGTTGCTGGCGAAA | NM_001040350.1 | 54.9 | [40] |
cimap1b | GATGCCTGGAGACATGACCAA | CAAAGGAGAAGCTGGGAGCTTT | NM_199958.1 | 63.4 | [29] |
avp | CGGAGCCCATCAGACAGT | TCGCAGCAGATGCCCTCA | NM_178293.2 | 56 | This paper |
avpr1aa | CTTCTACGGGCCGGACTTTC | CGGGCTGCTGAGGACTAAACT | NM_001301114.1 | 58 | [4] |
avpr1ab | CGACTTCTTAGGCTGTTTCC | TAGGCACGCTCTGACTTGAT | NM_001297676.1 | 58 | [4] |
avpr2aa | CCCGCAGATGTTATGGGATA | AGGCTACCATGATGGGTGTA | XM_001345969.7 | 57 | [4] |
avpr2ab | TGTGACGAAAGCCATGTCTAAG | GCGGCCCATAACTGAACAATA | XM_001922007.6 | 57 | This paper |
avpr2l | ATGGGCGCTCAAGCACTAAG | CCGTATGTCAGAGTGGCTTT | NM_001110125.1 | 58 | [4] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zanardini, M.; Zhang, W.; Habibi, H.R. Arginine Vasotocin Directly Regulates Spermatogenesis in Adult Zebrafish (Danio rerio) Testes. Int. J. Mol. Sci. 2024, 25, 6564. https://doi.org/10.3390/ijms25126564
Zanardini M, Zhang W, Habibi HR. Arginine Vasotocin Directly Regulates Spermatogenesis in Adult Zebrafish (Danio rerio) Testes. International Journal of Molecular Sciences. 2024; 25(12):6564. https://doi.org/10.3390/ijms25126564
Chicago/Turabian StyleZanardini, Maya, Weimin Zhang, and Hamid R. Habibi. 2024. "Arginine Vasotocin Directly Regulates Spermatogenesis in Adult Zebrafish (Danio rerio) Testes" International Journal of Molecular Sciences 25, no. 12: 6564. https://doi.org/10.3390/ijms25126564
APA StyleZanardini, M., Zhang, W., & Habibi, H. R. (2024). Arginine Vasotocin Directly Regulates Spermatogenesis in Adult Zebrafish (Danio rerio) Testes. International Journal of Molecular Sciences, 25(12), 6564. https://doi.org/10.3390/ijms25126564