Onion (Allium cepa L.) Flavonoid Extract Ameliorates Osteoporosis in Rats Facilitating Osteoblast Proliferation and Differentiation in MG-63 Cells and Inhibiting RANKL-Induced Osteoclastogenesis in RAW 264.7 Cells
Abstract
:1. Introduction
2. Results
2.1. Main Components in the OFE
2.2. Effects of OFE on Morphological Parameters by Micro-CT
2.3. Effect of OFE on the Histopathological Analysis of Bone Tissues of OVX Rats
2.4. Effect of OFE on Serum Biochemical Markers
2.5. OFE Promoted Proliferation and Differentiation of MG-63 Cells
2.6. Effect of OFE on OPG/RANKL Pathway
2.7. OFE Inhibited the Differentiation of Osteoclasts without Cytotoxicity
2.8. Effect of OFE on Expression of Osteoclast-Specific mRNA
3. Discussion
4. Materials and Methods
4.1. Materials and Reagents
4.2. Preparation of Allium cepa L. Extract
4.3. Animal Experimental Study
4.3.1. Animals and Administration
4.3.2. Administration of Animals
4.3.3. Hematoxylin and Eosin (H&E) Staining
4.3.4. Micro-CT Analysis
4.3.5. Serum Determination
4.4. In Vitro Study
4.4.1. Cell Culture
4.4.2. MTT Assay
4.4.3. Alkaline Phosphatase (ALP) Activity Assay
4.4.4. Alizarin Red S (ARS) Staining
4.4.5. TRAP Activity
4.4.6. RNA Extraction and Real-Time Reverse Transcription (RT)-PCR
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Marini, H.; Minutoli, L.; Polito, F.; Bitto, A.; Altavilla, D.; Atteritano, M.; Gaudio, A.; Mazzaferro, S.; Frisina, A.; Frisina, N.; et al. Effects of the phytoestrogen genistein on bone metabolism in osteopenic postmenopausal women—A randomized trial. Ann. Intern. Med. 2007, 146, 839–847. [Google Scholar] [CrossRef]
- Srivastava, S.; Bankar, R.; Roy, P. Assessment of the role of flavonoids for inducing osteoblast differentiation in isolated mouse bone marrow derived mesenchymal stem cells. Phytomedicine 2013, 20, 683–690. [Google Scholar] [CrossRef]
- Wang, L.; Yu, W.; Yin, X.; Cui, L.; Tang, S.; Jiang, N.; Cui, L.; Zhao, N.; Lin, Q.; Chen, L.; et al. Prevalence of Osteoporosis and Fracture in China: The China Osteoporosis Prevalence Study. JAMA Netw. Open 2021, 4, e2121106. [Google Scholar] [CrossRef]
- Zhang, L.; Luo, X.; Liu, H.; Zhu, W.; Zhang, X.; Zhu, S.; Zhang, X.; Zhao, G.; Li, T.; Xiao, F.; et al. Prevalence and risk factors of osteoporosis and osteopenia among residents in Hubei province, China. Arch. Osteoporos. 2023, 18, 49. [Google Scholar] [CrossRef]
- Letarouilly, J.G.; Broux, O.; Clabaut, A. New insights into the epigenetics of osteoporosis. Genomics 2019, 111, 793–798. [Google Scholar] [CrossRef]
- Xu, H.; Yin, D.; Liu, T.; Chen, F.; Chen, Y.; Wang, X.; Sheng, J. Tea polysaccharide inhibits RANKL-induced osteoclastogenesis in RAW264.7 cells and ameliorates ovariectomy-induced osteoporosis in rats. Biomed. Pharmacother. 2018, 102, 539–548. [Google Scholar] [CrossRef]
- Ni, X.; Wu, B.; Li, S.; Zhu, W.; Xu, Z.; Zhang, G.; Cui, H.; Bai, Q.; Wang, J. Equol exerts a protective effect on postmenopausal osteoporosis by upregulating OPG/RANKL pathway. Phytomedicine 2023, 108, 154509. [Google Scholar] [CrossRef]
- Chen, X.; Wang, Z.; Duan, N.; Zhu, G.; Schwarz, E.M.; Xie, C. Osteoblast–osteoclast interactions. Connect. Tissue Res. 2018, 59, 99–107. [Google Scholar] [CrossRef]
- Morin, S.N.; Feldman, S.; Funnell, L.; Giangregorio, L.; Kim, S.; McDonald-Blumer, H.; Santesso, N.; Ridout, R.; Ward, W.; Ashe, M.C.; et al. Clinical practice guideline for management of osteoporosis and fracture prevention in Canada: 2023 update. CMAJ 2023, 195, E1333–E1348. [Google Scholar] [CrossRef]
- Gera, I.; Szücs, N. The recombinant human parathyroid hormone, teriparatide as an alternative remedy for the medication-related osteonecrosis of the jaw. Orv. Hetil. 2023, 164, 1406–1415. [Google Scholar] [CrossRef]
- Johnston, C.B.; Dagar, M. Osteoporosis in Older Adults. Med. Clin. N. Am. 2020, 104, 38–43. [Google Scholar] [CrossRef]
- Hollman, P.H.; Katan, M.B. Dietary Flavonoids: Intake, Health Effects and Bioavailability. Food Chem. Toxicol. 1999, 37, 937–942. [Google Scholar] [CrossRef]
- Jiang, J.; Xiao, S.; Xu, X.; Ma, H.; Feng, C.; Jia, X. Isomeric flavonoid aglycones derived from Epimedii Folium exerted different intensities in anti-osteoporosis through OPG/RANKL protein targets. Int. Immunopharmacol. 2018, 62, 277–286. [Google Scholar] [CrossRef]
- Manohar, C.M.; Xue, J.; Murayyan, A.; Neethirajan, S.; Shi, J. Antioxidant activity of polyphenols from Ontario grown onion varieties using pressurized low polarity water technology. J. Funct. Foods 2017, 31, 52–62. [Google Scholar] [CrossRef]
- Walle, T.; Otake, Y.; Walle, U.K.; Wilson, F.A. Quercetin Glucosides Are Completely Hydrolyzed in Ileostomy Patients before Absorption. J. Nutr. 2000, 130, 2658–2661. [Google Scholar] [CrossRef]
- Law, Y.Y.; Chiu, H.F.; Lee, H.H.; Shen, Y.C.; Venkatakrishnan, K.; Wang, C.K. Consumption of onion juice modulates oxidative stress and attenuates the risk of bone disorders in middle-aged and post-menopausal healthy subjects. Food Funct. 2016, 7, 902–912. [Google Scholar] [CrossRef]
- Chang, Q.; Wong, Y.S. Identification of flavonoids in Hakmeitau beans (Vigna sinensis) by high-performance liquid chromatography-electrospray mass spectrometry (LC-ESI/MS). J. Agric. Food Chem. 2004, 52, 6694–6699. [Google Scholar] [CrossRef]
- Salahuddin, M.A.H.; Ismail, A.; Kassim, N.K.; Hamid, M.; Ali, M.S.M. Phenolic profiling and evaluation of in vitro antioxidant, α-glucosidase and α-amylase inhibitory activities of Lepisanthes fruticosa (Roxb) Leenh fruit extracts. Food Chem. 2020, 331, 127240. [Google Scholar] [CrossRef]
- Ji, S.; He, D.D.; Wang, T.Y. Separation and characterization of chemical constituents in Ginkgo biloba extract by off-line hydrophilic interaction×reversed-phase two-dimensional liquid chromatography coupled with quadrupole-time of flight mass spectrometry. J. Pharm. Biomed. Anal. 2017, 146, 68–78. [Google Scholar] [CrossRef]
- Cecchi, L.; Ieri, F.; Vignolini, P.; Mulinacci, N.; Romani, A. Characterization of Volatile and Flavonoid Composition of Different Cuts of Dried Onion (Allium cepa L.) by HS-SPME-GC-MS, HS-SPME-GC×GC-TOF and HPLC-DAD. Molecules 2020, 25, 408. [Google Scholar] [CrossRef]
- Yu, F.; Chang, J.; Li, J.; Li, Z.; Li, Z.; Zhang, H.; Liu, Q. Protective effects of oridonin against osteoporosis by regulating immunity and activating the Wnt3a/β-catenin/VEGF pathway in ovariectomized mice. Int. Immunopharmacol. 2023, 118, 110011. [Google Scholar] [CrossRef]
- Wang, Y.; Che, L.; Chen, X.; He, Z.; Song, D.; Yuan, Y.; Liu, C. Repurpose dasatinib and quercetin: Targeting senescent cells ameliorates postmenopausal osteoporosis and rejuvenates bone regeneration. Bioact. Mater. 2023, 25, 13–28. [Google Scholar] [CrossRef]
- Nguyen, P.A.-O.; Bouin, M.; Ste-Marie, L.G. Upper gastrointestinal safety of oral bisphosphonate in hospitalized patients. Osteoporos. Int. 2021, 32, 193–197. [Google Scholar] [CrossRef]
- Amigues, C.; Fresse, A.; Roux, C.H.; Gauthier, S.; Vieillard, M.H.; Drici, M.D.; Breuil, V. Zoledronate and osteonecrosis of the jaw in osteoporosis: Incidence and risk factors. Jt. Bone Spine 2023, 90, 105599. [Google Scholar] [CrossRef]
- Lefeuvre, L.; Caruso, A.; Biver, E.; Fayolle, D. Orbital myositis induced by alendronate: A case report. Eur. J. Neurol. 2023, 30, 1828–1830. [Google Scholar] [CrossRef]
- Ke, H.Z. Animal models for osteoporosis research. Bone 2010, 47, S349–S350. [Google Scholar] [CrossRef]
- Satué, M.; del Mar Arriero, M.; Monjo, M.; Ramis, J.M. Quercitrin and Taxifolin stimulate osteoblast differentiation in MC3T3-E1 cells and inhibit osteoclastogenesis in RAW 264.7 cells. Biochem. Pharmacol. 2013, 86, 1476–1486. [Google Scholar] [CrossRef]
- Mei, L.; Chi, Z.; Xinhan, L.; Zeheng, L.; Yao, C.; Jiyuan, Z. Isoquercitrin promotes the osteogenic differentiation of osteoblasts and BMSCs via the RUNX2 or BMP pathway. Connect. Tissue Res. 2018, 60, 189–199. [Google Scholar]
- Tang, C.H.; Huang, T.H.; Chang, C.S.; Fu, W.M.; Yang, R.S. Water solution of onion crude powder inhibits RANKL-induced osteoclastogenesis through ERK, p38 and NF-κB pathways. Osteoporos. Int. 2008, 20, 93–103. [Google Scholar] [CrossRef]
- Tang, Y.; Rajendran, P.; Veeraraghavan, V.P.; Hussain, S.; Balakrishna, J.P.; Chinnathambi, A.; Alharbi, S.A.; Alahmadi, T.A.; Rengarajan, T.; Mohan, S.K. Osteogenic differentiation and mineralization potential of zinc oxide nanoparticles from Scutellaria baicalensis on human osteoblast-like MG-63 cells. Mater. Sci. Eng. C 2021, 119, 111656. [Google Scholar] [CrossRef]
- Wang, D.; Cui, L.; Chang, X.; Guan, D. Biosynthesis and characterization of zinc oxide nanoparticles from Artemisia annua and investigate their effect on proliferation, osteogenic differentiation and mineralization in human osteoblast-like MG-63 Cells. J. Photochem. Photobiol. B Biol. 2020, 202, 111652. [Google Scholar] [CrossRef]
- Indran, I.R.; Liang, R.L.Z.; Min, T.E.; Yong, E.L. Preclinical studies, and clinical evaluation of compounds from the genus Epimedium for osteoporosis and bone health. Pharmacol. Ther. 2016, 162, 188–205. [Google Scholar] [CrossRef]
- Fernando, R.; Outi, M.K. Osteoporosis and Bone Mass Disorders: From Gene Pathways to Treatments. Trends Endocrinol. Metab. 2016, 27, 262–281. [Google Scholar]
- Kurgan, N.; Bott, K.N.; Helmeczi, W.E.; Roy, B.D.; Brindle, I.D.; Klentrou, P.; Fajardo, V.A. Low dose lithium supplementation activates Wnt/beta-catenin signalling and increases bone OPG/RANKL ratio in mice. Biochem. Biophys. Res. Commun. 2019, 511, 394–397. [Google Scholar] [CrossRef]
- Ii, D.A.G.; Bialek, P.; Ahn, J.D.; Starbuck, M.; Patel, M.S.; Clevers, H.; Taketo, M.M.; Long, F.; Mcmahon, A.P.; Lang, R.A. Canonical Wnt Signaling in Differentiated Osteoblasts Controls Osteoclast Differentiation. Dev. Cell 2005, 8, 751–764. [Google Scholar]
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef]
- Yu, T.; Liu, X.; Jiang, M.; Li, Y.; Su, H.; Niu, B. Cucumber seed polypeptides regulate RANKL-induced osteoclastogenesis through OPG/RANKL/RANK and NF-κB. In Vitro Cell. Dev. Biol. Anim. 2023, 60, 54–66. [Google Scholar] [CrossRef]
- Liu, M.; Liu, S.; Zhang, Q.; Fang, Y.; Yu, Y.; Zhu, L.; Liu, Y.; Gong, W.; Zhao, L.; Qin, L.; et al. Curculigoside attenuates oxidative stress and osteoclastogenesis via modulating Nrf2/NF-κB signaling pathway in RAW264.7 cells. J. Ethnopharmacol. 2021, 275, 114129. [Google Scholar] [CrossRef]
- Chen, S.; Jin, J.; Xu, Z.; Han, H.; Wu, L.; Li, Z. Catalpol attenuates osteoporosis in ovariectomized rats through promoting osteoclast apoptosis via the Sirt6-ERα-FasL axis. Phytomedicine 2024, 123, 155262. [Google Scholar] [CrossRef]
- Kabsun, K.; Seoung-Hoon, L.; Jung, H.K.; Yongwon, C.; Nacksung, K. NFATc1 induces osteoclast fusion via up-regulation of Atp6v0d2 and the dendritic cell-specific transmembrane protein (DC-STAMP). Mol. Endocrinol. 2008, 22, 176–185. [Google Scholar]
- Halleen, J.M.; Raisanen, S.R.; Alatalo, S.L.; Vaananen, H.K. Potential function for the ROS-generating activity of TRACP. J. Bone Miner. Res. 2010, 18, 1908–1911. [Google Scholar] [CrossRef]
- Iniguez-Ariza, N.M.; Clarke, B.L. Bone biology, signaling pathways, and therapeutic targets for osteoporosis. Maturitas 2015, 82, 245–255. [Google Scholar] [CrossRef]
- Mammen, D.; Daniel, M. A critical evaluation on the reliability of two aluminum chloride chelation methods for quantification of flavonoids. Food Chem. 2012, 135, 1365–1368. [Google Scholar] [CrossRef]
- Komori, T. Animal models for osteoporosis. Eur. J. Pharmacol. 2015, 759, 287–294. [Google Scholar] [CrossRef]
- Pradeep, S.R.; Srinivasan, K. Alleviation of oxidative stress-mediated nephropathy by dietary fenugreek (Trigonella foenum-graecum) seeds and onion (Allium cepa) in streptozotocin-induced diabetic rats. Food Funct. 2018, 9, 134–148. [Google Scholar] [CrossRef]
- Xiong, Y.; Huang, C.W.; Shi, C.; Peng, L.; Cheng, Y.T.; Hong, W.; Liao, J. Quercetin suppresses ovariectomy-induced osteoporosis in rat mandibles by regulating autophagy and the NLRP3 pathway. Exp. Biol. Med. 2023, 248, 2363–2380. [Google Scholar] [CrossRef]
- Yang, J.; Zou, Y.; Guo, J.; Yang, X.; Jin, B. Protective effect of isoflavone enriched soy β-conglycinin on osteoporosis in ovariectomized rats. J. Food Biochem. 2022, 46, e14507. [Google Scholar] [CrossRef]
- Nagamma, T.; Konuri, A.; Bhat, K.M.R.; Udupa, P.E.G.; Nayak, Y. Trigonella foenum-graecum L. seed extract modulates biochemical and histomorphological changes in therapeutic model of high-fat diet-fed ovariectomized rats. 3 Biotech 2023, 13, 285. [Google Scholar] [CrossRef]
- Yang, H.J.; Kim, M.J.; Qiu, J.Y.; Zhang, T.; Wu, X.; Jang, D.J.; Park, S. Rice Porridge Containing Welsh Onion Root Water Extract Alleviates Osteoarthritis-Related Pain Behaviors, Glucose Levels, and Bone Metabolism in Osteoarthritis-Induced Ovariectomized Rats. Nutrients 2019, 11, 1503. [Google Scholar] [CrossRef]
- Dong, X.; Yang, Q.; Du, Z.; Zhang, G.; Shi, C.; Qin, X.; Song, Y. Identification of optimal reference genes for gene expression normalization in human osteosarcoma cell lines under proliferative conditions. Front. Genet. 2022, 13, 989990. [Google Scholar] [CrossRef]
- Lucy, T.T.; Mamun-Or-Rashid, A.N.M.; Yagi, M.; Yonei, Y. Serial Passaging of RAW 264.7 Cells Modulates Intracellular AGE Formation and Downregulates RANKL-Induced In Vitro Osteoclastogenesis. Int. J. Mol. Sci. 2022, 23, 2371. [Google Scholar] [CrossRef]
- He, F.; Luo, S.; Liu, S.; Wan, S.; Li, J.; Chen, J.; Zuo, H.; Pei, X. Zanthoxylum bungeanum seed oil inhibits RANKL-induced osteoclastogenesis by suppressing ERK/c-JUN/NFATc1 pathway and regulating cell cycle arrest in RAW264.7 cells. J. Ethnopharmacol. 2022, 289, 115094. [Google Scholar] [CrossRef]
- Mamun-Or-Rashid, A.; Lucy, T.; Yagi, M.; Yonei, Y. Inhibitory Effects of Astaxanthin on CML-HSA-Induced Inflammatory and RANKL-Induced Osteoclastogenic Gene Expression in RAW 264.7 Cells. Biomedicines 2021, 10, 54. [Google Scholar] [CrossRef]
Target mRNA | Primer Sequence (5′-3′) | Fragment Size (bp) |
---|---|---|
OPG | F: GAAACGTTTCCTCCAAAGTACC R: CTGTCTGTGTAGTAGTGGTCAG | 155 |
RANKL | F: TTACCTGTATGCCAACATTTGC R: TTTGATGCTGGTTTTAGTGACG | 103 |
GAPDH | F: CAGGAGGCATTGCTGATGAT R: GAAGGCTGGGGCTCATTT | 138 |
Trap | F: CAAGAACTTGCGACCATTGTTA R: ATCCATAGTGAAACCGCAAGTA | 191 |
Ctsk | F: GCTTGGCATCTTTCCAGTTTTA R: CAACACTGCATGGTTCACATTA | 83 |
Mmp-9 | F: CAAAGACCTGAAAACCTCCAAC R: GACTGCTTCTCTCCCATCATC | 105 |
Nfatc-1 | F: GAGAATCGAGATCACCTCCTAC R: TTGCAGCTAGGAAGTACGTCTT | 93 |
Gapdh | F: GGTTGTCTCCTGCGACTTCA R: TGGTCCAGGGTTTCTTACTCC | 183 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, D.; Wang, X.; Sun, K.; Guo, J.; Zhao, J.; Dong, Y.; Bao, Y. Onion (Allium cepa L.) Flavonoid Extract Ameliorates Osteoporosis in Rats Facilitating Osteoblast Proliferation and Differentiation in MG-63 Cells and Inhibiting RANKL-Induced Osteoclastogenesis in RAW 264.7 Cells. Int. J. Mol. Sci. 2024, 25, 6754. https://doi.org/10.3390/ijms25126754
Zhang D, Wang X, Sun K, Guo J, Zhao J, Dong Y, Bao Y. Onion (Allium cepa L.) Flavonoid Extract Ameliorates Osteoporosis in Rats Facilitating Osteoblast Proliferation and Differentiation in MG-63 Cells and Inhibiting RANKL-Induced Osteoclastogenesis in RAW 264.7 Cells. International Journal of Molecular Sciences. 2024; 25(12):6754. https://doi.org/10.3390/ijms25126754
Chicago/Turabian StyleZhang, Danyang, Xiaoyu Wang, Kezhuo Sun, Jianli Guo, Jia Zhao, Yuesheng Dong, and Yongming Bao. 2024. "Onion (Allium cepa L.) Flavonoid Extract Ameliorates Osteoporosis in Rats Facilitating Osteoblast Proliferation and Differentiation in MG-63 Cells and Inhibiting RANKL-Induced Osteoclastogenesis in RAW 264.7 Cells" International Journal of Molecular Sciences 25, no. 12: 6754. https://doi.org/10.3390/ijms25126754