OsPUB9 Gene Edited by CRISPR/Cas9 Enhanced Resistance to Bacterial Leaf Blight in Rice (Oryza sativa L.)
Abstract
:1. Introduction
2. Results
2.1. Generation and Characterization of Null Mutants through CRISPR/Cas9-Targeted Knockout of the Ospub9 Gene
2.1.1. Generation of Knockout Mutant Lines of the OsPUB9 Gene
2.1.2. Analysis of Mutation Types through Deep-Sequencing and Generation of OsPUB9 Gene-Edited Null Lines
2.1.3. Analysis of Putative Protein Expression Based on Gene Editing in Null Mutants
2.2. Biotic Stress Resistance in OsPUB9 Gene-Edited Null Lines
2.2.1. Evaluation of Resistance against Xanthomonas. Oryzae v. oryzae
2.2.2. Analysis of Histochemical Staining
2.3. Expression Analysis of R Genes Related to Biotic Stress Resistance
2.4. Investigation of Agronomic Traits
3. Discussion
4. Materials and Methods
4.1. Selection of Target Sites and sgRNA of the OsPUB9 Gene
4.2. Synthesis of sgRNA and Construction of CRISPR/Cas9 Vector
4.3. Transformation to Rice Callus via Agrobacterium-Mediated Method
4.4. Analysis of Mutation Types Using Deep-Sequencing and Selection of Null Mutants
4.5. Pathogenicity Test of Leaf Bacterial Leaf Blight in Null Mutants
4.6. Analysis of Putative Protein Expression in Null Mutants
4.7. Analysis of DAB Staining
4.8. Expression Analysis of R Genes Related to Biotic Stress Resistance
4.9. Investigation of Agronomic Traits
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kinoshita, A.; ten Hove, C.A.; Tabata, R.; Yamada, M.; Shimizu, N.; Ishida, T.; Yamaguchi, K.; Shigenobu, S.; Takebayashi, Y.; Iuchi, S.; et al. A plant U-box protein, PUB4, regulates asymmetric cell division and cell proliferation in the root meristem. Development 2015, 142, 444–453. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Wu, Y.; Xie, Q. Ubiquitin-Proteasome System in ABA Signaling: From Perception to Action. Mol. Plant 2016, 9, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Samuel, M.A.; Mudgil, Y.; Salt, J.N.; Delmas, F.; Ramachandran, S.; Chilelli, A.; Goring, D.R. Interactions between the S-Domain Receptor Kinases and AtPUB-ARM E3 Ubiquitin Ligases Suggest a Conserved Signaling Pathway in Arabidopsis. Plant Physiol. 2008, 147, 2084–2095. [Google Scholar] [CrossRef] [PubMed]
- Furlan, G.; Nakagami, H.; Eschen-Lippold, L.; Jiang, X.; Majovsky, P.; Kowarschik, K.; Hoehenwarter, W.; Lee, J.; Trujillo, M. Changes in PUB22 Ubiquitination Modes Triggered by MITOGEN-ACTIVATED PROTEIN KINASE3 Dampen the Immune Response. Plant Cell 2017, 29, 726–745. [Google Scholar] [CrossRef] [PubMed]
- Azevedo, C.; Santos-Rosa, M.J.; Shirasu, K. The U-box protein family in plants. Trends Plant Sci. 2001, 6, 354–358. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Tang, D.; Wang, K.; Wu, X.; Lu, L.; Yu, H.; Gu, M.; Yan, C.; Cheng, Z. Mutations in the F-box gene LARGER PANICLE improve the panicle architecture and enhance the grain yield in rice. Plant Biotechnol. J. 2011, 9, 1002–1013. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Zhong, S.; Li, G.; Li, Q.; Mao, B.; Deng, Y.; Zhang, H.; Zeng, L.; Song, F.; He, Z. Rice RING protein OsBBI1 with E3 ligase activity confers broad-spectrum resistance against Magnaporthe oryzae by modifying the cell wall defence. Cell Res. 2011, 21, 835–848. [Google Scholar] [CrossRef]
- Yamada, S.; Kano, A.; Tamaoki, D.; Miyamoto, A.; Shishido, H.; Miyoshi, S.; Taniguchi, S.; Akimitsu, K.; Gomi, K. Involvement of OsJAZ8 in jasmonate-induced resistance to bacterial blight in rice. Plant Cell Physiol. 2012, 53, 2060–2072. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.L.; Yao, J.; Mei, C.S.; Tong, X.H.; Zeng, L.J.; Li, Q.; Xiao, L.T.; Sun, T.P.; Li, J.; Deng, X.W.; et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc. Natl. Acad. Sci. USA 2012, 109, E1192–E1200. [Google Scholar] [CrossRef]
- Lee, H.Y.; Seo, J.S.; Cho, J.H.; Jung, H.; Kim, J.K.; Lee, J.S.; Rhee, S.; Do Choi, Y. Oryza sativa COI homologues restore jasmonate signal transduction in Arabidopsis coi1-1 mutants. PLoS ONE 2013, 8, e52802. [Google Scholar] [CrossRef]
- Puchta, H. The repair of double-strand breaks in plants: Mechanisms and consequences for genome evolution. J. Exp. Bot. 2004, 56, 1–14. [Google Scholar] [CrossRef]
- Wang, F.; Wang, C.; Liu, P.; Lei, C.; Hao, W.; Gao, Y.; Liu, Y.; Zhao, K. Enhanced Rice Blast Resistance by CRISPR/Cas9-Targeted Mutagenesis of the ERF Transcription Factor Gene OsERF922. PLoS ONE 2016, 11, e0154027. [Google Scholar] [CrossRef] [PubMed]
- Varkonyi-Gasic, E.; Wang, T.; Voogd, C.; Jeon, S.; Drummond, R.S.; Gleave, A.P.; Allan, A.C. Mutagenesis of kiwifruit CENTRORADIALIS-like genes transforms a climbing woody perennial with long juvenility and axillary flowering into a compact plant with rapid terminal flowering. Plant Biotechnol. J. 2018, 17, 869–880. [Google Scholar] [CrossRef]
- Zhou, J.; Lu, D.; Xu, G.; Finlayson, S.A.; He, P.; Shan, L. The dominant negative ARM domain uncovers multiple functions of PUB13 in Arabidopsis immunity, flowering, and senescence. J. Exp. Bot. 2015, 66, 3353–3366. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; He, M.; Li, J.; Chen, L.; Huang, Z.; Zheng, S.; Zhu, L.; Ni, E.; Jiang, D.; Zhao, B.; et al. Development of Commercial Thermo-sensitive Genic Male Sterile Rice Accelerates Hybrid Rice Breeding Using the CRISPR/Cas9-mediated TMS5 Editing System. Sci. Rep. 2016, 6, 37395. [Google Scholar] [CrossRef]
- Miao, C.; Xiao, L.; Hua, K.; Zou, C.; Zhao, Y.; Bressan, R.A.; Zhu, J. Mutations in a subfamily of abscisic acid receptor genes promote rice growth and productivity. Proc. Natl. Acad. Sci. USA 2018, 115, 6058–6063. [Google Scholar] [CrossRef]
- Sánchez-León, S.; Gil-Humanes, J.; Ozuna, C.V.; Giménez, M.J.; Sousa, C.; Voytas, D.F.; Barro, F. Low-gluten, nontransgenic wheat engineered with CRISPR/Cas9. Plant Biotechnol. J. 2017, 16, 902–910. [Google Scholar] [CrossRef]
- Jansing, J.; Sack, M.; Augustine, S.M.; Fischer, R.; Bortesi, L. CRISPR/Cas9-mediated knockout of six glycosyltransferase genes in Nicotiana benthamiana for the production of recombinant proteins lacking β-1,2-xylose and core α-1,3-fucose. Plant Biotechnol. J. 2019, 17, 350–361. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Nolan, T.M.; Jiang, H.; Yin, Y. AP2/ERF Transcription Factor Regulatory Networks in Hormone and Abiotic Stress Responses in Arabidopsis. Front. Plant Sci. 2019, 10, 437723. [Google Scholar] [CrossRef]
- Zhou, H.; Liu, B.; Weeks, D.P.; Spalding, M.H.; Yang, B. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Res. 2014, 42, 10903–10914. [Google Scholar] [CrossRef]
- Rajarajeswari, N.; Muralidharan, K. Assessments of farm yield and district production loss from bacterial leaf blight epidemics in rice. Crop Prot. 2006, 25, 244–252. [Google Scholar] [CrossRef]
- Kumar, A.; Guha, A.; Bimolata, W.; Reddy, A.R.; Laha, G.S.; Sundaram, R.M.; Pandey, M.K.; Ghazi, I.A. Leaf gas exchange physiology in rice genotypes infected with bacterial blight: An attempt to link photosynthesis with disease severity and rice yield. Aust. J. Crop Sci. 2013, 7, 32–39. [Google Scholar]
- Mew, T.W.; Cruz, C.V.; Medalla, E.S. Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted in the Philippines. Plant Dis. 1992, 76, 1029–1032. [Google Scholar]
- Noh, T.H.; Lee, D.K.; Kang, M.H.; Shin, M.S.; Na, S.Y. Identification of new race of Xanthomonas Oryzae pv. oryzae (Xoo) in Korea. Phytopathology 2003, 93, S66. [Google Scholar]
- Reddy, A. Bacterial blight: Crop loss assessment and disease management. In Proceedings of the International Workshop on Bacterial Blight of Rice, 14–18 March 1988; International Rice Research Institute: Manila, Philippines, 1989; pp. 79–88. [Google Scholar]
- Shin, M.; Shin, H.; Jun, B.; Choi, B. Effects of inoculation of compatible and incompatible bacterial blight races on grain yield and quality of two rice cultivars. Korean J. Breed. Sci. 1992, 24, 264–267. [Google Scholar]
- Khan, M.A.; Naeem, M.; Iqbal, M. Breeding approaches for bacterial leaf blight resistance in rice (Oryza sativa L.), current status and future directions. Eur. J. Plant Pathol. 2014, 139, 27–37. [Google Scholar] [CrossRef]
- Zhang, F.; Huang, L.; Zhang, F.; Ali, J.; Cruz, C.V.; Zhuo, D.; Du, Z.; Li, Z.; Zhou, Y. Comparative transcriptome profiling of a rice line carrying Xa39 and its parents triggered by Xanthomonas oryzae pv. oryzae provides novel insights into the broad-spectrum hypersensitive response. BMC Genom. 2015, 16, 111. [Google Scholar]
- Dossa, G.S.; Sparks, A.H.; Cruz, C.V.; Oliva, R. Decision tools for bacterial blight resistance gene deployment in rice-based agricultural ecosystems. Front. Plant Sci. 2015, 6, 305. [Google Scholar] [CrossRef] [PubMed]
- Huang, N.; Angeles, E.R.; Domingo, J.; Magpantay, G.B.; Singh, S.K.; Zhang, G.; Kumaravadivel, N.; Bennett, J.; Khush, G.S. Pyramiding of bacterial blight resistance genes in rice: Marker-assisted selection using RFLP and PCR. Theor. Appl. Genet. 1997, 95, 313–320. [Google Scholar] [CrossRef]
- Jeung, J.; Heu, S.; Shin, M.; Cruz, C.M.; Jena, K.K. Dynamics of Xanthomonas oryzae pv. oryzae Populations in Korea and Their Relationship to Known Bacterial Blight Resistance Genes. Phytopathology 2006, 96, 867–875. [Google Scholar]
- Zeng, X.; Luo, Y.; Vu, N.T.; Shen, S.; Xia, K.; Zhang, M. CRISPR/Cas9-mediated mutation of OsSWEET14 in rice cv. Zhonghua11 confers resistance to Xanthomonas oryzae pv. oryzae without yield penalty. BMC Plant Biol. 2020, 20, 313. [Google Scholar]
- Oliva, R.; Ji, C.; Atienza-Grande, G.; Huguet-Tapia, J.C.; Perez-Quintero, A.; Li, T.; Eom, J.; Li, C.; Nguyen, H.; Liu, B.; et al. Broad-spectrum resistance to bacterial blight in rice using genome editing. Nat. Biotechnol. 2019, 37, 1344–1350. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Moon, H.; Park, C. CRISPR/Cas9-targeted mutagenesis of Os8N3 in rice to confer resistance to Xanthomonas oryzae pv. oryzae. Rice 2019, 12, 67. [Google Scholar]
- Wu, Q.; Lin, J.; Liu, J.; Wang, X.; Lim, W.; Oh, M.J.; Park, J.; Rajashekar, C.B.; Whitham, S.A.; Cheng, N.; et al. Ectopic expression of Arabidopsis glutaredoxin AtGRXS17 enhances thermotolerance in tomato. Plant Biotechnol. J. 2012, 10, 945–955. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar]
- Vierstra, R.D. The ubiquitin-26S proteasome system at the nexus of plant biology. Nat. Rev. Mol. Cell Biol. 2009, 10, 385–397. [Google Scholar] [CrossRef] [PubMed]
- Shu, K.; Yang, W. E3 Ubiquitin Ligases: Ubiquitous Actors in Plant Development and Abiotic Stress Responses. Plant Cell Physiol. 2017, 58, 1461–1476. [Google Scholar] [CrossRef] [PubMed]
- Smalle, J.A.; Vierstra, R.D. The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant Biol. 2004, 55, 555–590. [Google Scholar] [CrossRef] [PubMed]
- Du, H.; Zeng, X.; Zhao, M.; Cui, X.; Wang, Q.; Yang, H.; Cheng, H.; Yu, D. Efficient targeted mutagenesis in soybean by TALENs and CRISPR/Cas9. J. Biotechnol. 2016, 217, 90–97. [Google Scholar] [CrossRef]
- Vierstra, R.D. The Expanding Universe of Ubiquitin and Ubiquitin-like Modifiers. Plant Physiol. 2012, 160, 2–14. [Google Scholar] [CrossRef]
- Zhang, Y.; Liang, Z.; Zong, Y.; Wang, Y.; Liu, J.; Chen, K.; Qiu, J.; Gao, C. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA. Nat. Commun. 2016, 7, 12617. [Google Scholar] [CrossRef] [PubMed]
- Singh, M.; Kumar, M.; Albertsen, M.C.; Young, J.K.; Cigan, A.M. Concurrent modifications in the three homeologs of Ms45 gene with CRISPR-Cas9 lead to rapid generation of male sterile bread wheat (Triticum aestivum L.). Plant Mol. Biol. 2018, 97, 371–383. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.; Wang, X.; He, Y.; Xu, H.; Wang, L. Clock component OsPRR73 positively regulates rice salt tolerance by modulating OsHKT2;1-mediated sodium homeostasis. EMBO J. 2021, 40, e105086. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Liu, Y.; Wang, F.; Li, T.; Chen, Z.; Kong, D.; Bi, J.; Zhang, F.; Luo, X.; Wang, J.; et al. Enhanced rice salinity tolerance via CRISPR/Cas9-targeted mutagenesis of the OsRR22 gene. Mol. Breed. New Strateg. Plant Improv. 2019, 39, 47. [Google Scholar] [CrossRef]
- Bos, J.I.; Armstrong, M.R.; Gilroy, E.M.; Boevink, P.C.; Hein, I.; Taylor, R.M.; Zhendong, T.; Engelhardt, S.; Vetukuri, R.R.; Harrower, B.; et al. Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1. Proc. Natl. Acad. Sci. USA 2010, 107, 9909–9914. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, K.; Yamaguchi, K.; Sakamoto, K.; Yoshimura, S.; Inoue, K.; Tsuge, S.; Kojima, C.; Kawasaki, T. Bacterial effector modulation of host E3 ligase activity suppresses PAMP-triggered immunity in rice. Nat. Commun. 2014, 5, 5430. [Google Scholar] [CrossRef] [PubMed]
- Lowder, L.G.; Zhang, D.; Baltes, N.J.; Paul, J.W., 3rd; Tang, X.; Zheng, X.; Voytas, D.F.; Hsieh, T.F.; Zhang, Y.; Qi, Y. A CRISPR/Cas9 Toolbox for Multiplexed Plant Genome Editing and Transcriptional Regulation. Plant Physiol. 2015, 169, 971–985. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y.; et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef] [PubMed]
- Mao, X.; Yu, C.; Li, L.; Wang, M.; Yang, L.; Zhang, Y.; Zhang, Y.; Wang, J.; Li, C.; Reynolds, M.P.; et al. How Many Faces Does the Plant U-Box E3 Ligase Have? Int. J. Mol. Sci. 2022, 23, 2285. [Google Scholar] [CrossRef]
- Zeng, L.R.; Qu, S.; Bordeos, A.; Yang, C.; Baraoidan, M.; Yan, H.; Xie, Q.; Nahm, B.H.; Leung, H.; Wang, G.L. Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 2004, 16, 2795–2808. [Google Scholar] [CrossRef]
- Katoh, S.; Tsunoda, Y.; Murata, K.; Minami, E.; Katoh, E. Active site residues and amino acid specificity of the ubiquitin carrier protein-binding RING-H2 finger domain. J. Biol. Chem. 2005, 280, 41015–41024. [Google Scholar] [CrossRef] [PubMed]
- Koiwai, H.; Tagiri, A.; Katoh, S.; Katoh, E.; Ichikawa, H.; Minami, E.; Nishizawa, Y. RING-H2 type ubiquitin ligase EL5 is involved in root development through the maintenance of cell viability in rice. Plant J. Cell Mol. Biol. 2007, 51, 92–104. [Google Scholar] [CrossRef] [PubMed]
- Tu, D.; Li, W.; Ye, Y.; Brunger, A.T. Structure and function of the yeast U-box-containing ubiquitin ligase Ufd2p. Proc. Natl. Acad. Sci. USA 2007, 104, 15599–15606. [Google Scholar] [CrossRef] [PubMed]
- Johnsson, N.; Varshavsky, A. Split ubiquitin as a sensor of protein interactions in vivo. Proc. Natl. Acad. Sci. USA 1994, 91, 10340–10344. [Google Scholar] [CrossRef]
- Roux, K.J.; Kim, D.I.; Raida, M.; Burke, B. A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J. Cell Biol. 2012, 196, 801–810. [Google Scholar] [CrossRef]
- Grefen, C.; Blatt, M.R. A 2in1 cloning system enables ratiometric bimolecular fluorescence complementation (rBiFC). Biotechniques 2012, 53, 311–314. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Bae, S.; Kim, J. Cas-Designer: A web-based tool for choice of CRISPR-Cas9 target sites. Bioinformatics 2015, 31, 4014–4016. [Google Scholar] [CrossRef]
- Lee, H.; Jee, M.G.; Jang, D.; Cho, Y. High-efficiency and Rapid Agrobacterium-mediated genetic transformation method using germinating rice seeds. J. Plant Biotechnol. 2011, 38, 251–257. [Google Scholar] [CrossRef]
- Kim, H.; Choi, J.; Won, K. A stable DNA-free screening system for CRISPR/RNPs-mediated gene editing in hot and sweet cultivars of Capsicum annuum. BMC Plant Biol. 2020, 20, 449. [Google Scholar] [CrossRef]
- Park, J.; Lim, K.; Kim, J.; Bae, S. Cas-analyzer: An online tool for assessing genome editing results using NGS data. Bioinformatics 2016, 33, 286–288. [Google Scholar] [CrossRef]
- Kim, M.; Ko, S.; Jung, Y.; Kang, K.; Lee, Y.; Cho, Y. Knockout Mutants of OsPUB7 Generated Using CRISPR/Cas9 Revealed Abiotic Stress Tolerance in Rice. Int. J. Mol. Sci. 2023, 24, 5338. [Google Scholar] [CrossRef] [PubMed]
- Kauffman, H.E.; Reddy, A.P.; Hsieh, S.P.; Merca, S.D. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
- IRRI. Standard Evaluation System for Rice, 4th ed.; International Rice Research Institute Manila: Los Baños, Philippines, 1996. [Google Scholar]
- Dametto, A.; Buffon, G.; dos Reis Blasi, A.; Sperotto, R.A. Ubiquitination pathway as a target to develop abiotic stress tolerance in rice. Plant Signal. Behav. 2015, 10, e1057369. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Xue, H. The ubiquitin-proteasome system in plant responses to environments. Plant Cell Environ. 2019, 42, 2931–2944. [Google Scholar] [CrossRef]
- Stone, S.L.; Hauksdottir, H.; Troy, A.; Herschleb, J.; Kraft, E.; Callis, J. Functional Analysis of the RING-Type Ubiquitin Ligase Family of Arabidopsis. Plant Physiol. 2005, 137, 13–30. [Google Scholar] [CrossRef]
Target gene | sgRNA | RGEN Target (5′ to 3′) | Direction | Cleavage * Position (%) | GC Contents (%, w/o PAM) | Out-of-Frame Score | Mismatches (bp) | ||
---|---|---|---|---|---|---|---|---|---|
0 | 1 | 2 | |||||||
OsPUB9 | sgRNA1 | TGCGAAGTTTGATATTGCAGTGG | + | 50.2 | 40 | 88.8 | 1 | 0 | 0 |
sgRNA2 | TTTGATATTGCAGTGGTGTGAGG | + | 53.1 | 40 | 79.9 | 1 | 0 | 0 |
Rice Line | Plant Height (cm) | Culm Length (cm) | Panicle Length (cm) | No. of Tiller |
---|---|---|---|---|
Dongjin (WT) | 114.0 ± 1.26 | 94.3 ± 1.60 | 19.3 ± 0.90 | 12 ± 0.50 |
GE.PUB9-3-5 ns | 115.7 ± 1.03 | 91.9 ± 2.71 | 19.8 ± 0.25 | 11 ± 0.81 |
GE.PUB9-3-6 ns | 123.5 ± 1.47 | 91.8 ± 2.37 | 19.0 ± 0.76 | 11 ± 0.82 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, M.-S.; Le, V.T.; Jung, Y.J.; Kang, K.-K.; Cho, Y.-G. OsPUB9 Gene Edited by CRISPR/Cas9 Enhanced Resistance to Bacterial Leaf Blight in Rice (Oryza sativa L.). Int. J. Mol. Sci. 2024, 25, 7145. https://doi.org/10.3390/ijms25137145
Kim M-S, Le VT, Jung YJ, Kang K-K, Cho Y-G. OsPUB9 Gene Edited by CRISPR/Cas9 Enhanced Resistance to Bacterial Leaf Blight in Rice (Oryza sativa L.). International Journal of Molecular Sciences. 2024; 25(13):7145. https://doi.org/10.3390/ijms25137145
Chicago/Turabian StyleKim, Me-Sun, Van Trang Le, Yu Jin Jung, Kwon-Kyoo Kang, and Yong-Gu Cho. 2024. "OsPUB9 Gene Edited by CRISPR/Cas9 Enhanced Resistance to Bacterial Leaf Blight in Rice (Oryza sativa L.)" International Journal of Molecular Sciences 25, no. 13: 7145. https://doi.org/10.3390/ijms25137145
APA StyleKim, M. -S., Le, V. T., Jung, Y. J., Kang, K. -K., & Cho, Y. -G. (2024). OsPUB9 Gene Edited by CRISPR/Cas9 Enhanced Resistance to Bacterial Leaf Blight in Rice (Oryza sativa L.). International Journal of Molecular Sciences, 25(13), 7145. https://doi.org/10.3390/ijms25137145