TaMIR397-6A and -6B Homoeologs Encode Active miR397 Contributing to the Regulation of Grain Size in Hexaploid Wheat
Abstract
:1. Introduction
2. Results
2.1. Identification of TaMIR397 Homoeologs in Wheat
2.2. TamiR397a Exhibits Differential Expression in Various Tissues
2.3. Inhibition of TamiR397a Perturbs Wheat Kernel Development
2.4. Overexpression of TamiR397a Increases the Grain Size and Weight
2.5. TamiR397a Is Involved in the Regulation of Grain Filling
2.6. Differentially Expressed Genes in the OE and ST Wheat Grains
2.7. Identification of TamiR397a Targets in Wheat Grains
3. Discussion
4. Materials and Methods
4.1. Wheat Planting and Sampling
4.2. Gene Cloning and Functional Identification of TaMIR397a
4.3. Bioinformatics Analysis
4.4. Quantitative Expression Analysis
4.5. Genetic Transformation and Identification of the Transgenic Plants
4.6. Characterization of Wheat Grain Filling
4.7. Transcriptome and Target Gene Analysis
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.; Chen, J.; Yin, C.; Wang, Z.; Wu, H.; Shen, K.; Zhang, Z.; Kang, L.; Xu, S.; Bi, A.; et al. A high-resolution genotype-phenotype map identifies the TaSPL17 controlling grain number and size in wheat. Genome Biol. 2023, 24, 196. [Google Scholar] [CrossRef]
- Bentley, A.R.; Donovan, J.; Sonder, K.; Baudron, F.; Lewis, J.M.; Voss, R.; Rutsaert, P.; Poole, N.; Kamoun, S.; Saunders, D.G.O.; et al. Near- to long-term measures to stabilize global wheat supplies and food security. Nat. Food 2022, 3, 483–486. [Google Scholar] [CrossRef] [PubMed]
- Mirosavljevic, M.; Momcilovic, V.; Drazic, T.; Acin, V.; Jockovic, B.; Mikic, S.; Brbaklic, L.; Zivancev, D.; Zoric, M.; Przulj, N. Genetic progress in grain yield and associated changes in spikelet and grain traits in historical set of Pannonian wheat cultivars. Euphytica 2024, 220, 10. [Google Scholar] [CrossRef]
- Brinton, J.; Simmonds, J.; Uauy, C. Ubiquitin-related genes are differentially expressed in isogenic lines contrasting for pericarp cell size and grain weight in hexaploid wheat. BMC Plant Biol. 2018, 18, 22. [Google Scholar] [CrossRef]
- Chi, Q.; Guo, L.J.; Ma, M.; Zhang, L.J.; Mao, H.D.; Wu, B.W.; Liu, X.L.; Ramirez-Gonzalez, R.H.; Uauy, C.; Appels, R.; et al. Global transcriptome analysis uncovers the gene co-expression regulation network and key genes involved in grain development of wheat (Triticum aestivum L.). Funct. Integr. Genom. 2019, 19, 853–866. [Google Scholar] [CrossRef]
- Yang, M.M.; Liu, Y.; Dong, J.; Zhao, W.C.; Kashyap, S.; Gao, X.; Rustgi, S.; Wen, S.S. Probing early wheat grain development via transcriptomic and proteomic approaches. Funct. Integr. Genom. 2020, 20, 63–74. [Google Scholar] [CrossRef] [PubMed]
- Bhati, K.K.; Alok, A.; Kumar, A.; Kaur, J.; Tiwari, S.; Pandey, A.K. Silencing of ABCC13 transporter in wheat reveals its involvement in grain development, phytic acid accumulation and lateral root formation. J. Exp. Bot. 2016, 67, 4379–4389. [Google Scholar] [CrossRef]
- Fahy, B.; Siddiqui, H.; David, L.C.; Powers, S.J.; Borrill, P.; Uauy, C.; Smith, A.M. Final grain weight is not limited by the activity of key starch-synthesising enzymes during grain filling in wheat. J. Exp. Bot. 2018, 69, 5461–5475. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.G.; Guo, H.H.; Sun, M.Z. Signal transduction during wheat grain development. Planta 2015, 241, 789–801. [Google Scholar] [CrossRef]
- Gu, Y.S.; Han, S.C.; Chen, L.; Mu, J.Y.; Duan, L.N.; Li, Y.X.; Yan, Y.M.; Li, X.H. Expression and regulation of genes involved in the reserve starch biosynthesis pathway in hexaploid wheat (Triticum aestivum L.). Crop J. 2021, 9, 440–455. [Google Scholar] [CrossRef]
- Wang, Y.L.; Sun, G.L. Molecular prospective on the wheat grain development. Crit. Rev. Biotechnol. 2023, 43, 38–49. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Sharma, N.; Sopory, S.K.; Sanan-Mishra, N. miRNAs and genes as molecular regulators of rice grain morphology and yield. Plant Physiol. Biochem. 2024, 207, 108363. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Wang, X.; Li, Y.; Cui, Y.; Yan, X.; Gao, J.; Ouyang, J.; Li, S. Pleiotropic effects of miR5504 underlying plant height, grain yield and quality in rice. Plant Cell Physiol. 2024, 65, 781–789. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zhang, X.; Cheng, Y.; Du, X.; Teotia, S.; Miao, C.; Sun, H.; Fan, G.; Tang, G.; Xue, H.; et al. The miR167-OsARF12 module regulates rice grain filling and grain size downstream of miR159. Plant Commun. 2023, 4, 100604. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.F.; Peng, T.; Sun, H.Z.; Teotia, S.; Wen, H.L.; Du, Y.X.; Zhang, J.; Li, J.Z.; Tang, G.L.; Xue, H.W.; et al. miR1432-OsACOT (Acyl-CoA thioesterase) module determines grain yield via enhancing grain filling rate in rice. Plant Biotechnol. J. 2019, 17, 712–723. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.Z.; Shen, Y.; Li, H.Y.; Yang, J.K.; Cai, X.X.; Zheng, G.P.; Zhu, Y.M.; Jia, B.W.; Sun, X.L. The multiple roles of OsmiR535 in modulating plant height, panicle branching and grain shape. Plant Sci. 2019, 283, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.F.; Zhao, X.L.; Dai, Z.Y.; Ma, F.L.; Miao, X.X.; Shi, Z.Y. OsmiR396/growth regulating factor modulate rice grain size through direct regulation of embryo-specific miR408. Plant Physiol. 2021, 186, 519–533. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.C.; Yu, Y.; Wang, C.Y.; Li, Z.Y.; Liu, Q.; Xu, J.; Liao, J.Y.; Wang, X.J.; Qu, L.H.; Chen, F.; et al. Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching. Nat. Biotechnol. 2013, 31, 848–852. [Google Scholar] [CrossRef] [PubMed]
- Han, R.; Jian, C.; Lv, J.; Yan, Y.; Chi, Q.; Li, Z.; Wang, Q.; Zhang, J.; Liu, X.; Zhao, H. Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.). BMC Genom. 2014, 15, 289. [Google Scholar] [CrossRef]
- Sun, F.L.; Guo, G.H.; Du, J.K.; Guo, W.W.; Peng, H.R.; Ni, Z.F.; Sun, Q.X.; Yao, Y.Y. Whole-genome discovery of miRNAs and their targets in wheat (Triticum aestivum L.). BMC Plant Biol. 2014, 14, 142. [Google Scholar] [CrossRef]
- Hou, G.; Du, C.; Gao, H.; Liu, S.; Sun, W.; Lu, H.; Kang, J.; Xie, Y.; Ma, D.; Wang, C. Identification of microRNAs in developing wheat grain that are potentially involved in regulating grain characteristics and the response to nitrogen levels. BMC Plant Biol. 2020, 20, 87. [Google Scholar] [CrossRef]
- Meng, F.; Liu, H.; Wang, K.; Liu, L.; Wang, S.; Zhao, Y.; Yin, J.; Li, Y. Development-associated microRNAs in grains of wheat (Triticum aestivum L.). BMC Plant Biol. 2013, 13, 140. [Google Scholar] [CrossRef]
- Zhang, S.; Ghatak, A.; Bazargani, M.M.; Bajaj, P.; Varshney, R.K.; Chaturvedi, P.; Jiang, D.; Weckwerth, W. Spatial distribution of proteins and metabolites in developing wheat grain and their differential regulatory response during the grain filling process. Plant J. 2021, 107, 669–687. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.N.; Zhang, Z.H.; Zhang, R.J.; Yang, C.F.; Zhang, X.B.; Chang, S.Y.; Chen, Q.; Rossi, V.; Zhao, L.; Xiao, J.; et al. Type I MADS-box transcription factor TaMADS-GS regulates grain size by stabilizing cytokinin signalling during endosperm cellularization in wheat. Plant Biotechnol. J. 2024, 22, 200–215. [Google Scholar] [CrossRef]
- Nadaud, I.; Girousse, C.; Debiton, C.; Chambon, C.; Bouzidi, M.F.; Martre, P.; Branlard, G. Proteomic and morphological analysis of early stages of wheat grain development. Proteomics 2010, 10, 2901–2910. [Google Scholar] [CrossRef]
- Shewry, P.R.; Mitchell, R.A.C.; Tosi, P.; Wan, Y.F.; Underwood, C.; Lovegrove, A.; Freeman, J.; Toole, G.A.; Mills, E.N.C.; Ward, J.L. An integrated study of grain development of wheat (cv. Hereward). J. Cereal Sci. 2012, 56, 21–30. [Google Scholar] [CrossRef]
- Chen, X.L.; Ji, Y.; Zhao, W.Y.; Niu, H.Y.; Yang, X.; Jiang, X.K.; Zhang, Y.P.; Lei, J.; Yang, H.; Chen, R.B.; et al. Fructose-6-phosphate-2-kinase/fructose-2,6-bisphosphatase regulates energy metabolism and synthesis of storage products in developing rice endosperm. Plant Sci. 2023, 326, 111503. [Google Scholar] [CrossRef] [PubMed]
- Gasparis, S.; Miłoszewski, M.M. Genetic basis of grain size and weight in rice, wheat, and barley. Int. J. Mol. Sci. 2023, 24, 16921. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.L.; Ren, Y.L.; Liu, L.L.; Wang, F.; Zhang, H.; Tian, P.; Pan, T.; Wang, Y.F.; Jing, R.N.; Liu, T.Z.; et al. Ubiquitin specific protease 15 has an important role in regulating grain width and size in rice. Plant Physiol. 2019, 180, 381–391. [Google Scholar] [CrossRef]
- Yu, Z.B.; Hong, L.W.; Li, Q.S.Q. Signatures of mRNA alternative polyadenylation in Arabidopsis leaf development. Front. Genet. 2022, 13, 863253. [Google Scholar] [CrossRef]
- Schapire, A.L.; Valpuesta, V.; Botella, M.A. TPR proteins in plant hormone signaling. Plant Signal. Behav. 2006, 1, 229–230. [Google Scholar] [CrossRef] [PubMed]
- Xin, P.F.; Schier, J.; Sefrnová, Y.; Kulich, I.; Dubrovsky, J.G.; Vielle-Calzada, J.P.; Soukup, A. The Arabidopsis TETRATRICOPEPTIDE-REPEAT THIOREDOXIN-LIKE (TTL) family members are involved in root system formation via their interaction with cytoskeleton and cell wall remodeling. Plant J. 2022, 112, 946–965. [Google Scholar] [CrossRef] [PubMed]
- Kihira, M.; Taniguchi, K.; Kaneko, C.; Ishii, Y.; Aoki, H.; Koyanagi, A.; Kusano, H.; Suzui, N.; Yin, Y.G.; Kawachi, N.; et al. Arabidopsis thaliana FLO2 is involved in efficiency of photoassimilate translocation, which is associated with leaf growth and aging, yield of seeds and seed quality. Plant Cell Physiol. 2017, 58, 440–450. [Google Scholar] [CrossRef] [PubMed]
- Song, X.H.; Chen, Z.H.; Du, X.; Li, B.; Fei, Y.Y.; Tao, Y.J.; Wang, F.Q.; Xu, Y.; Li, W.Q.; Wang, J.; et al. Generation of new rice germplasms with low amylose content by CRISPR/CAS9-targeted mutagenesis of the FLOURY ENDOSPERM 2 gene. Front. Plant Sci. 2023, 14, 1138523. [Google Scholar] [CrossRef]
- Hina, A.; Khan, N.; Kong, K.; Lv, W.; Karikari, B.; Abbasi, A.; Zhao, T. Exploring the role of FBXL gene family in Soybean: Implications for plant height and seed size regulation. Physiol. Plant. 2024, 176, e14191. [Google Scholar] [CrossRef]
- Sun, X.; Xie, Y.; Xu, K.; Li, J. Regulatory networks of the F-box protein FBX206 and OVATE family proteins modulate brassinosteroid biosynthesis to regulate grain size and yield in rice. J. Exp. Bot. 2024, 75, 789–801. [Google Scholar] [CrossRef]
- Zhang, S.L.; Tian, Z.L.; Li, H.P.; Guo, Y.T.; Zhang, Y.Q.; Roberts, J.A.; Zhang, X.B.; Miao, Y.C. Genome-wide analysis and characterization of F-box gene family in Gossypium hirsutum L. BMC Genom. 2019, 20, 993. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.X.; Ma, H.; Nei, M.; Kong, H.Z. Evolution of F-box genes in plants: Different modes of sequence divergence and their relationships with functional diversification. Proc. Natl. Acad. Sci. USA 2009, 106, 835–840. [Google Scholar] [CrossRef] [PubMed]
- Hong, M.J.; Kim, J.B.; Seo, Y.W.; Kim, D.Y. F-Box genes in the wheat genome and expression profiling in wheat at different developmental stages. Genes 2020, 11, 1154. [Google Scholar] [CrossRef]
- Saxena, H.; Negi, H.; Sharma, B. Role of F-box E3-ubiquitin ligases in plant development and stress responses. Plant Cell Rep. 2023, 42, 1133–1146. [Google Scholar] [CrossRef]
- Zhu, Q. Growth analysis on the process of grain filling in rice. Acta Agron. Sin. 1988, 14, 182–193. [Google Scholar]
- Li, Q.; Du, L.; Feng, D.; Yun, R.; Zhexin, L.; Kong, F.l.; Yuan, J. Grain-filling characteristics and yield differences of maize cultivars with contrasting nitrogen efficiencies. Crop J. 2020, 8, 990–1001. [Google Scholar] [CrossRef]
Gene ID | Description | Fold Change | Target Aligned Fragment |
---|---|---|---|
TraesCS5B03G0937500 | TPR-domain-containing protein | −10.5 | GUUCUUGGAGGCUGCACUCAC |
TraesCS5B03G0709900 | F-box domain-containing protein | −3.2 | ACUUAACAAUGCUGCAUCCAC |
NewGene_945 | Putative long non-coding RNA | −2.0 | CUUCA-CAAUUCUGCAUUCAG |
TraesCS2B03G0934700 | ATP-dependent DNA helicase | −1.8 | CGUCAUCAGCGAUGUACUCUU |
TraesCS2D03G0440600LC | Monosaccharide transporter | −1.7 | CCUCGUCGGCGCCGCGCUCAA |
TraesCS3A03G0831400 | TaLaccase3 | −1.7 | GUUCAUCAACUCUGCGCUCAA |
TraesCS4B03G0327300 | ATPase family | −1.6 | ACUUCUCAACGCUGUACGCGC |
TraesCS7B03G0395000 | Lysine-specific demethylase JMJ30 | −1.6 | AGACCUCGGCGAUGCGCUCAA |
TraesCS3B03G0720100 | Kinesin-like protein KIN-6 | −1.6 | UGCCAGUGACGCUGCAUUAAA |
TraesCS1B03G0669000 | Aminotransferase classes I and II | −1.6 | GCUCGUGGACGCCGCGCUCGG |
TraesCS4B03G0965700 | ATPase 11, plasma membrane-type | −1.5 | GAUCAUCAGCGCUGUUCUAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, P.; Wu, Y.; Zhang, J.; Si, J.; Wang, X.; Jiao, Z.; Meng, X.; Zhang, L.; Meng, F.; Li, Y. TaMIR397-6A and -6B Homoeologs Encode Active miR397 Contributing to the Regulation of Grain Size in Hexaploid Wheat. Int. J. Mol. Sci. 2024, 25, 7696. https://doi.org/10.3390/ijms25147696
Wang P, Wu Y, Zhang J, Si J, Wang X, Jiao Z, Meng X, Zhang L, Meng F, Li Y. TaMIR397-6A and -6B Homoeologs Encode Active miR397 Contributing to the Regulation of Grain Size in Hexaploid Wheat. International Journal of Molecular Sciences. 2024; 25(14):7696. https://doi.org/10.3390/ijms25147696
Chicago/Turabian StyleWang, Putong, Yujie Wu, Junhui Zhang, Jiao Si, Xiaoteng Wang, Zhongfa Jiao, Xiaodan Meng, Li Zhang, Fanrong Meng, and Yongchun Li. 2024. "TaMIR397-6A and -6B Homoeologs Encode Active miR397 Contributing to the Regulation of Grain Size in Hexaploid Wheat" International Journal of Molecular Sciences 25, no. 14: 7696. https://doi.org/10.3390/ijms25147696
APA StyleWang, P., Wu, Y., Zhang, J., Si, J., Wang, X., Jiao, Z., Meng, X., Zhang, L., Meng, F., & Li, Y. (2024). TaMIR397-6A and -6B Homoeologs Encode Active miR397 Contributing to the Regulation of Grain Size in Hexaploid Wheat. International Journal of Molecular Sciences, 25(14), 7696. https://doi.org/10.3390/ijms25147696