Exploiting Glycyrrhiza glabra L. (Licorice) Flavanones: Licoflavanone’s Impact on Breast Cancer Cell Bioenergetics
Abstract
:1. Introduction
2. Results and Discussion
2.1. Antitumoral Potential of Glabranin, Pinocembrin, and Licoflavanone
2.2. Glabranin, Pinocembrin, and Licoflavanone Induce ROS Accumulation and Apoptosis
2.3. Effect of the Three Different Natural Compounds on Cell Motility of MDA-MB-231 Cells
2.4. Glabranin, Pinocembrin, and Licoflavanone Reduce Macrophage Activation Induced by Breast Cancer-Conditioned Media
2.5. Licoflavanone Modulates the Metabolic Profile of MCF-7 and MDA-MB-231 Cells
2.6. Glabranin, Pinocembrin, and Licoflavanone Significantly Inhibits CSC Propagation and Survival by Reducing Stemness Marker Expression
2.7. Structural Elucidation of Licoflavanone, Glabranin and Pinocembrin
3. Materials and Methods
3.1. Cell Cultures
3.2. Viability Assay
3.3. Apoptosis Assay
3.4. Intracellular ROS Assessment
3.5. Wound-Healing Scratch Assay
3.6. Nitric Oxide Assessment in RAW 264.7 Cells Stimulated by Tumor-Conditioned Medium
3.7. Metabolic Flux Analysis with the Seahorse XFe96
3.8. Mammospheres Formation Efficiency
3.9. qPCR Analysis of Gene Expression
3.10. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sharifi-Rad, J.; Quispe, C.; Herrera-Bravo, J.; Belén, L.H.; Kaur, R.; Kregiel, D.; Uprety, Y.; Beyatli, A.; Yeskaliyeva, B.; Kırkın, C.; et al. Glycyrrhiza Genus: Enlightening Phytochemical Components for Pharmacological and Health-Promoting Abilities. Oxidative Med. Cell. Longev. 2021, 2021, 7571132. [Google Scholar] [CrossRef] [PubMed]
- Wahab, S.; Annadurai, S.; Abullais, S.S.; Das, G.; Ahmad, W.; Ahmad, M.F.; Kandasamy, G.; Vasudevan, R.; Ali, M.S.; Amir, M. Glycyrrhiza glabra (Licorice): A Comprehensive Review on Its Phytochemistry, Biological Activities, Clinical Evidence and Toxicology. Plants 2021, 10, 2751. [Google Scholar] [CrossRef]
- El-Saber Batiha, G.; Magdy Beshbishy, A.; El-Mleeh, A.; Abdel-Daim, M.M.; Prasad Devkota, H. Traditional Uses, Bioactive Chemical Constituents, and Pharmacological and Toxicological Activities of Glycyrrhiza glabra L. (Fabaceae). Biomolecules 2020, 10, 352. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, H.; Yasuma, M.; Hiraoka, N.; Ikeshiro, Y.; Yamamoto, H.; Yeşilada, E.; Sezik, E.; Honda, G.; Tabata, M. Flavonoid Variation in the Leaves of Glycyrrhiza glabra. Phytochemistry 1996, 42, 701–704. [Google Scholar] [CrossRef]
- Siracusa, L.; Saija, A.; Cristani, M.; Cimino, F.; D’Arrigo, M.; Trombetta, D.; Rao, F.; Ruberto, G. Phytocomplexes from Liquorice (Glycyrrhiza glabra L.) Leaves—Chemical Characterization and Evaluation of Their Antioxidant, Anti-Genotoxic and Anti-Inflammatory Activity. Fitoterapia 2011, 82, 546–556. [Google Scholar] [CrossRef]
- Frattaruolo, L.; Carullo, G.; Brindisi, M.; Mazzotta, S.; Bellissimo, L.; Rago, V.; Curcio, R.; Dolce, V.; Aiello, F.; Cappello, A.R. Antioxidant and Anti-Inflammatory Activities of Flavanones from Glycyrrhiza glabra L. (Licorice) Leaf Phytocomplexes: Identification of Licoflavanone as a Modulator of NF-kB/MAPK Pathway. Antioxidants 2019, 8, 186. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Wu, L.; Yan, G.; Chen, Y.; Zhou, M.; Wu, Y.; Li, Y. Inflammation and Tumor Progression: Signaling Pathways and Targeted Intervention. Signal Transduct. Target. Ther. 2021, 6, 263. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Ma, C.; Zhang, Z.; Zhang, H.; Hu, H. NF-κB Signaling in Inflammation and Cancer. MedComm 2021, 2, 618–653. [Google Scholar] [CrossRef]
- Zinatizadeh, M.R.; Schock, B.; Chalbatani, G.M.; Zarandi, P.K.; Jalali, S.A.; Miri, S.R. The Nuclear Factor Kappa B (NF-kB) Signaling in Cancer Development and Immune Diseases. Genes Dis. 2021, 8, 287–297. [Google Scholar] [CrossRef]
- Ponte, L.G.S.; Pavan, I.C.B.; Mancini, M.C.S.; Da Silva, L.G.S.; Morelli, A.P.; Severino, M.B.; Bezerra, R.M.N.; Simabuco, F.M. The Hallmarks of Flavonoids in Cancer. Molecules 2021, 26, 2029. [Google Scholar] [CrossRef]
- Fiorillo, M.; Peiris-Pagès, M.; Sanchez-Alvarez, R.; Bartella, L.; Di Donna, L.; Dolce, V.; Sindona, G.; Sotgia, F.; Cappello, A.R.; Lisanti, M.P. Bergamot Natural Products Eradicate Cancer Stem Cells (CSCs) by Targeting Mevalonate, Rho-GDI-Signalling and Mitochondrial Metabolism. Biochim. Biophys. Acta (BBA)—Bioenerg. 2018, 1859, 984–996. [Google Scholar] [CrossRef] [PubMed]
- Snyder, V.; Reed-Newman, T.C.; Arnold, L.; Thomas, S.M.; Anant, S. Cancer Stem Cell Metabolism and Potential Therapeutic Targets. Front. Oncol. 2018, 8, 203. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Wang, K.; Wu, Y.; Chen, Y.; Chen, X.; Hu, C.W.; Hu, F. Pinocembrin Induces ER Stress Mediated Apoptosis and Suppresses Autophagy in Melanoma Cells. Cancer Lett. 2018, 431, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Gong, H. Pinocembrin Suppresses Proliferation and Enhances Apoptosis in Lung Cancer Cells in Vitro by Restraining Autophagy. Bioengineered 2021, 12, 6035–6044. [Google Scholar] [CrossRef]
- Kumar, M.A.S.; Nair, M.; Hema, P.S.; Mohan, J.; Santhoshkumar, T.R. Pinocembrin Triggers Bax-dependent Mitochondrial Apoptosis in Colon Cancer Cells. Mol. Carcinog. 2007, 46, 231–241. [Google Scholar] [CrossRef]
- Liu, J.; Song, C.; Liang, Z.; Long, X.; Guo, M.; Xu, J. Licoflavanone Exerts Anticancer Effects on Human Nasopharyngeal Cancer Cells via Caspase Activation, Suppression of Cell Migration and Invasion, and Inhibition of m-TOR/PI3K/AKT Pathway. Trop. J. Pharm. Res. 2022, 20, 1387–1393. [Google Scholar] [CrossRef]
- Coussens, L.M.; Werb, Z. Inflammation and Cancer. Nature 2002, 420, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Wang, J.; Deng, X.; Xiong, F.; Zhang, S.; Gong, Z.; Li, X.; Cao, K.; Deng, H.; He, Y.; et al. The Role of Microenvironment in Tumor Angiogenesis. J. Exp. Clin. Cancer Res. 2020, 39, 204. [Google Scholar] [CrossRef]
- Mantovani, A.; Allavena, P.; Marchesi, F.; Garlanda, C. Macrophages as Tools and Targets in Cancer Therapy. Nat. Rev. Drug Discov. 2022, 21, 799–820. [Google Scholar] [CrossRef]
- Duan, Z.; Luo, Y. Targeting Macrophages in Cancer Immunotherapy. Signal Transduct. Target. Ther. 2021, 6, 127. [Google Scholar] [CrossRef]
- Zhou, J.; Tang, Z.; Gao, S.; Li, C.; Feng, Y.; Zhou, X. Tumor-Associated Macrophages: Recent Insights and Therapies. Front. Oncol. 2020, 10, 188. [Google Scholar] [CrossRef] [PubMed]
- Gledhill, J.R.; Montgomery, M.G.; Leslie, A.G.W.; Walker, J.E. Mechanism of Inhibition of Bovine F 1 -ATPase by Resveratrol and Related Polyphenols. Proc. Natl. Acad. Sci. USA 2007, 104, 13632–13637. [Google Scholar] [CrossRef] [PubMed]
- Sekiya, M.; Hisasaka, R.; Iwamoto-Kihara, A.; Futai, M.; Nakanishi-Matsui, M. A Unique Mechanism of Curcumin Inhibition on F1 ATPase. Biochem. Biophys. Res. Commun. 2014, 452, 940–944. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Ramirez, V.D. Inhibition of Mitochondrial Proton F0F1-ATPase/ATP Synthase by Polyphenolic Phytochemicals. Br. J. Pharmacol. 2000, 130, 1115–1123. [Google Scholar] [CrossRef] [PubMed]
- Apostolou, P.; Toloudi, M.; Chatziioannou, M.; Ioannou, E.; Papasotiriou, I. Cancer Stem Cells Stemness Transcription Factors Expression Correlates with Breast Cancer Disease Stage. Curr. Stem Cell Res. Ther. 2012, 7, 415–419. [Google Scholar] [CrossRef] [PubMed]
- Luo, W.; Li, S.; Peng, B.; Ye, Y.; Deng, X.; Yao, K. Embryonic Stem Cells Markers SOX2, OCT4 and Nanog Expression and Their Correlations with Epithelial-Mesenchymal Transition in Nasopharyngeal Carcinoma. PLoS ONE 2013, 8, e56324. [Google Scholar] [CrossRef]
- Wu, C.-W.; Wang, M.-L.; Chiou, S.-H. Targeting Cancer Stem Cells: Emerging Role of Nanog Transcription Factor. OncoTargets Ther. 2013, 6, 1207–1220. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Lv, R.; Qi, W.; Wu, D.; Xu, Y.; Liu, W.; Mou, Y.; Wang, L. Snail Contributes to the Maintenance of Stem Cell-Like Phenotype Cells in Human Pancreatic Cancer. PLoS ONE 2014, 9, e87409. [Google Scholar] [CrossRef] [PubMed]
- Simons, R.; Gruppen, H.; Bovee, T.F.H.; Verbruggen, M.A.; Vincken, J.-P. Prenylated Isoflavonoids from Plants as Selective Estrogen Receptor Modulators (phytoSERMs). Food Funct. 2012, 3, 810. [Google Scholar] [CrossRef]
- Kakarala, M.; Brenner, D.E.; Korkaya, H.; Cheng, C.; Tazi, K.; Ginestier, C.; Liu, S.; Dontu, G.; Wicha, M.S. Targeting Breast Stem Cells with the Cancer Preventive Compounds Curcumin and Piperine. Breast Cancer Res. Treat. 2010, 122, 777–785. [Google Scholar] [CrossRef]
- Choi, H.; Kim, S.-L.; Kim, J.-H.; Deng, H.-Y.; Yun, B.-S.; Lee, D.-S. Triterpene Acid (3-O-p-Coumaroyltormentic Acid) Isolated from Aronia Extracts Inhibits Breast Cancer Stem Cell Formation through Downregulation of c-Myc Protein. Int. J. Mol. Sci. 2018, 19, 2528. [Google Scholar] [CrossRef]
- Curcio, M.; Brindisi, M.; Cirillo, G.; Frattaruolo, L.; Leggio, A.; Rago, V.; Nicoletta, F.P.; Cappello, A.R.; Iemma, F. Smart Lipid–Polysaccharide Nanoparticles for Targeted Delivery of Doxorubicin to Breast Cancer Cells. Int. J. Mol. Sci. 2022, 23, 2386. [Google Scholar] [CrossRef]
- Nigro, A.; Frattaruolo, L.; Fava, M.; De Napoli, I.; Greco, M.; Comandè, A.; De Santo, M.; Pellegrino, M.; Ricci, E.; Giordano, F.; et al. Bortezomib-Loaded Mesoporous Silica Nanoparticles Selectively Alter Metabolism and Induce Death in Multiple Myeloma Cells. Cancers 2020, 12, 2709. [Google Scholar] [CrossRef] [PubMed]
- Brindisi, M.; Frattaruolo, L.; Mancuso, R.; Palumbo Piccionello, A.; Ziccarelli, I.; Catto, M.; Nicolotti, O.; Altomare, C.D.; Gabriele, B.; Cappello, A.R. Anticancer Potential of Novel α,β-Unsaturated γ-Lactam Derivatives Targeting the PI3K/AKT Signaling Pathway. Biochem. Pharmacol. 2021, 190, 114659. [Google Scholar] [CrossRef]
- Frattaruolo, L.; Durante, M.; Cappello, M.S.; Montefusco, A.; Mita, G.; Cappello, A.R.; Lenucci, M.S. The Ability of Supercritical CO2 Carrot and Pumpkin Extracts to Counteract Inflammation and Oxidative Stress in RAW 264.7 Macrophages Stimulated with LPS or MDA-MB-231 Cell-Conditioned Media. Food Funct. 2023, 14, 10083–10096. [Google Scholar] [CrossRef] [PubMed]
- Brindisi, M.; Fiorillo, M.; Frattaruolo, L.; Sotgia, F.; Lisanti, M.P.; Cappello, A.R. Cholesterol and Mevalonate: Two Metabolites Involved in Breast Cancer Progression and Drug Resistance through the ERRα Pathway. Cells 2020, 9, 1819. [Google Scholar] [CrossRef] [PubMed]
- Mazzotta, S.; Frattaruolo, L.; Brindisi, M.; Ulivieri, C.; Vanni, F.; Brizzi, A.; Carullo, G.; Cappello, A.R.; Aiello, F. 3-Amino-Alkylated Indoles: Unexplored Green Products Acting as Anti-Inflammatory Agents. Future Med. Chem. 2020, 12, 5–17. [Google Scholar] [CrossRef]
- Martinez-Outschoorn, U.E.; Peiris-Pagés, M.; Pestell, R.G.; Sotgia, F.; Lisanti, M.P. Cancer Metabolism: A Therapeutic Perspective. Nat. Rev. Clin. Oncol. 2017, 14, 11–31. [Google Scholar] [CrossRef]
- Galluzzi, L.; Kepp, O.; Heiden, M.G.V.; Kroemer, G. Metabolic Targets for Cancer Therapy. Nat. Rev. Drug Discov. 2013, 12, 829–846. [Google Scholar] [CrossRef]
- Aramini, B.; Masciale, V.; Grisendi, G.; Bertolini, F.; Maur, M.; Guaitoli, G.; Chrystel, I.; Morandi, U.; Stella, F.; Dominici, M.; et al. Dissecting Tumor Growth: The Role of Cancer Stem Cells in Drug Resistance and Recurrence. Cancers 2022, 14, 976. [Google Scholar] [CrossRef]
- Porporato, P.E.; Filigheddu, N.; Pedro, J.M.B.-S.; Kroemer, G.; Galluzzi, L. Mitochondrial Metabolism and Cancer. Cell Res. 2018, 28, 265–280. [Google Scholar] [CrossRef] [PubMed]
- Kicinska, A.; Jarmuszkiewicz, W. Flavonoids and Mitochondria: Activation of Cytoprotective Pathways? Molecules 2020, 25, 3060. [Google Scholar] [CrossRef] [PubMed]
Compound | IC50 (µM) | ||
---|---|---|---|
MCF-7 | MDA-MB-231 | MCF-10A | |
Glabranin | 68.21 | 32.50 | 113.7 |
95% CI: 54.09 to 86.81 | 95% CI: 23.38 to 44.45 | 95% CI: 61.26 to 247.8 | |
Pinocembrin | 64.43 | 48.38 | 234.5 |
95% CI: 48.01 to 87.69 | 95% CI: 37.09 to 63.02 | 95% CI: 92.37 to 2637 | |
Licoflavanone | 19.18 | 10.97 | 41.38 |
95% CI: 13.21 to 27.34 | 95% CI: 6.751 to 16.16 | 95% CI: 19.66 to 88.79 |
Primer | Forward | Reverse |
---|---|---|
SNAIL | CGAGTGGTTCTTCTGCGCTA | GGGCTGCTGGAAGGTAAACT |
OCT4 | AGCGACTATGCACAACGAGA | CCATAGCCTGGGTACCAAA |
NANOG | CTCCAACATCCTGAACCTCAGC | CGTCACACCATTGCTATTCTTCG |
SOX2 | GGCCTCGAGCTGGGAATCGC | GCCCACTCGGGGTCTTGCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Frattaruolo, L.; Lauria, G.; Aiello, F.; Carullo, G.; Curcio, R.; Fiorillo, M.; Campiani, G.; Dolce, V.; Cappello, A.R. Exploiting Glycyrrhiza glabra L. (Licorice) Flavanones: Licoflavanone’s Impact on Breast Cancer Cell Bioenergetics. Int. J. Mol. Sci. 2024, 25, 7907. https://doi.org/10.3390/ijms25147907
Frattaruolo L, Lauria G, Aiello F, Carullo G, Curcio R, Fiorillo M, Campiani G, Dolce V, Cappello AR. Exploiting Glycyrrhiza glabra L. (Licorice) Flavanones: Licoflavanone’s Impact on Breast Cancer Cell Bioenergetics. International Journal of Molecular Sciences. 2024; 25(14):7907. https://doi.org/10.3390/ijms25147907
Chicago/Turabian StyleFrattaruolo, Luca, Graziantonio Lauria, Francesca Aiello, Gabriele Carullo, Rosita Curcio, Marco Fiorillo, Giuseppe Campiani, Vincenza Dolce, and Anna Rita Cappello. 2024. "Exploiting Glycyrrhiza glabra L. (Licorice) Flavanones: Licoflavanone’s Impact on Breast Cancer Cell Bioenergetics" International Journal of Molecular Sciences 25, no. 14: 7907. https://doi.org/10.3390/ijms25147907