Thermo-Responsive Hydrogel Containing Microfluidic Chitosan Nanoparticles Loaded with Opuntia ficus-indica Extract for Periodontitis Treatment
Abstract
:1. Introduction
2. Results and Discussion
2.1. OFI Extract
2.2. Preparation and Physicochemical Characterization of OFI-Loaded Nanoparticles (OFI-NPs)
2.3. Preparation and Characterization of the F127-Based Formulations Containing OFI-NPs
2.4. OFI Release and Antibacterial Activity of OFI@tgel
2.5. OFI@tgel Antibiofilm Activities
2.6. OFI@tgel Cellular Internalization and Antioxidant Capacity
2.7. OFI@tgel Modulate the Macrophage Polarization
3. Materials and Methods
3.1. Preparation of OFI Extract
3.2. Chromatographic Analysis of OFI Extract
3.3. Synthesis of OFI-Loaded Nanoparticles (OFI-NPs)
3.4. Physicochemical Characterization and Biocompatibility Assessment of OFI-NPs
3.5. Preparation and Characterization of OFI-NP Loaded Hydrogel (OFI@tgel)
3.6. Antibacterial Studies
3.6.1. Bacterial Strains and Culture Conditions
3.6.2. Antibacterial Activity of OFI Extract against Pathogenic Bacteria
3.6.3. Antibiofilm Activity
3.6.4. Quorum Sensing (QS) Interfering
3.7. In Vitro Cell Studies
3.7.1. Human Gingival Fibroblast (HGF) Proliferation
3.7.2. In Vitro ROS Scavenging Staining
3.7.3. Enzyme-Linked Immunoabsorbent Assay (ELISA)
3.7.4. OFI@tgel Cellular Uptake
3.7.5. Macrophage Polarization to M2 Phenotype
3.8. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kozak, M.; Pawlik, A. The Role of the Oral Microbiome in the Development of Diseases. Int. J. Mol. Sci. 2023, 24, 5231. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, A.; Söder, B.; Meurman, J.; Lundmark, A.; Hu, Y.O.O.; Neogi, U.; Yucel-Lindberg, T. Composition of subgingival microbiota associated with periodontitis and diagnosis of malignancy—A cross-sectional study. Front. Microbiol. 2023, 14, 1172340. [Google Scholar] [CrossRef] [PubMed]
- Di Stefano, M.; Polizzi, A.; Santonocito, S.; Romano, A.; Lombardi, T.; Isola, G. Impact of Oral Microbiome in Periodontal Health and Periodontitis: A Critical Review on Prevention and Treatment. Int. J. Mol. Sci. 2022, 23, 5142. [Google Scholar] [CrossRef] [PubMed]
- Toledano, M.; Osorio, M.T.; Vallecillo-Rivas, M.; Toledano-Osorio, M.; Rodríguez-Archilla, A.; Toledano, R.; Osorio, R. Efficacy of local antibiotic therapy in the treatment of peri-implantitis: A systematic review and meta-analysis. J. Dent. 2021, 113, 103790. [Google Scholar] [CrossRef]
- Jepsen, K.; Jepsen, S. Antibiotics/antimicrobials: Systemic and local administration in the therapy of mild to moderately advanced periodontitis. Periodontology 2000 2016, 71, 82–112. [Google Scholar] [CrossRef]
- Elashiry, M.; Morandini, A.C. Selective Antimicrobial Therapies for Periodontitis: Win the “Battle and the War”. Int. J. Mol. Sci. 2021, 22, 6459. [Google Scholar] [CrossRef]
- Kim, T.H.; Heo, S.Y.; Chandika, P.; Kim, Y.M.; Kim, H.W.; Kang, H.W.; Je, J.Y.; Qian, Z.J.; Kim, N.; Jung, W.K. A literature review of bioactive substances for the treatment of periodontitis: In vitro, in vivo and clinical studies. Heliyon 2024, 10, e24216. [Google Scholar] [CrossRef]
- Madrigal-Santillán, E.; Portillo-Reyes, J.; Madrigal-Bujaidar, E.; Sánchez-Gutiérrez, M. Opuntia spp. in Human Health: A Comprehensive Summary on Its Pharmacological, Therapeutic and Preventive Properties. Part 2. Plants 2022, 11, 2333. [Google Scholar] [CrossRef]
- Boateng, J.S.; Matthews, K.H.; Stevens, H.N.; Eccleston, G.M. Wound healing dressings and drug delivery systems: A review. J. Pharm. Sci. 2008, 97, 2892–2923. [Google Scholar] [CrossRef]
- Di Salle, A.; Spagnuolo, G. Effects of various prophylactic procedures on titanium surfaces and biofilm formation. J. Periodontal Implant. Sci. 2018, 48, 373–382. [Google Scholar] [CrossRef]
- Majedi, F.S.; Hasani-Sadrabadi, M.M.; Emami, S.H.; Taghipoor, M.; Dashtimoghadam, E.; Bertsch, A.; Moaddel, H.; Renaud, P. Microfluidic synthesis of chitosan-based nanoparticles for fuel cell applications. Chem. Commun. 2012, 48, 7744–7746. [Google Scholar] [CrossRef]
- Aragona, M.; Lauriano, E.R.; Pergolizzi, S.; Faggio, C. Opuntia ficus-indica (L.) Miller as a source of bioactivity compounds for health and nutrition. Nat. Prod. Res. 2018, 32, 2037–2049. [Google Scholar] [CrossRef] [PubMed]
- El-Mostafa, K.; El Kharrassi, Y.; Badreddine, A.; Andreoletti, P.; Vamecq, J.; El Kebbaj, M.S.; Latruffe, N.; Lizard, G.; Nasser, B.; Cherkaoui-Malki, M. Nopal cactus (Opuntia ficus-indica) as a source of bioactive compounds for nutrition, health and disease. Molecules 2014, 19, 14879–14901. [Google Scholar] [CrossRef]
- Giraldo-Silva, L.; Ferreira, B. Opuntia ficus-indica Fruit: A Systematic Review of Its Phytochemicals and Pharmacological Activities. Plants 2023, 12, 543. [Google Scholar] [CrossRef] [PubMed]
- Bellumori, M.; Innocenti, M.; Andrenelli, L.; Melani, F.; Cecchi, L.; Pandino, G.; Mauromicale, G.; La Malfa, S.; Mulinacci, N. Composition of discarded Sicilian fruits of Opuntia ficus indica L.: Phenolic content, mineral profile and antioxidant activity in peel, seeds and whole fruit. Food Chem. 2023, 428, 136756. [Google Scholar] [CrossRef] [PubMed]
- Scarano, P.; Tartaglia, M.; Zuzolo, D.; Prigioniero, A.; Guarino, C.; Sciarrillo, R. Recovery and Valorization of Bioactive and Functional Compounds from the Discarded of Opuntia ficus-indica (L.) Mill. Fruit Peel. Agronomy 2022, 12, 388. [Google Scholar] [CrossRef]
- Mena, P.; Tassotti, M.; Andreu, L.; Nuncio-Jáuregui, N.; Legua, P.; Del Rio, D.; Hernández, F. Phytochemical characterization of different prickly pear (Opuntia ficus-indica (L.) Mill.) cultivars and botanical parts: UHPLC-ESI-MS(n) metabolomics profiles and their chemometric analysis. Food Res. Int. 2018, 108, 301–308. [Google Scholar] [CrossRef]
- Amaya-Cruz, D.M.; Pérez-Ramírez, I.F.; Delgado-García, J.; Mondragón-Jacobo, C.; Dector-Espinoza, A.; Reynoso-Camacho, R. An integral profile of bioactive compounds and functional properties of prickly pear (Opuntia ficus indica L.) peel with different tonalities. Food Chem. 2019, 278, 568–578. [Google Scholar] [CrossRef]
- García-Cayuela, T.; Gómez-Maqueo, A.; Guajardo-Flores, D.; Welti-Chanes, J.; Cano, M.P. Characterization and quantification of individual betalain and phenolic compounds in Mexican and Spanish prickly pear (Opuntia ficus-indica L. Mill) tissues: A comparative study. J. Food Compos. Anal. 2019, 76, 1–13. [Google Scholar] [CrossRef]
- Talcott, S.T.; Passeretti, S.; Duncan, C.E.; Gorbet, D.W. Polyphenolic content and sensory properties of normal and high oleic acid peanuts. Food Chem. 2005, 90, 379–388. [Google Scholar] [CrossRef]
- Pessoa, A.; Sipoli, C.C.; de la Torre, L.G. Effects of diffusion and mixing pattern on microfluidic-assisted synthesis of chitosan/ATP nanoparticles. Lab Chip 2017, 17, 2281–2293. [Google Scholar] [CrossRef] [PubMed]
- Greco, A.; Gabold, B.; Chen, S.; Wang, X.; Xu, Z.; Hartschuh, A.; Chiesa, E.; Genta, I.; Ried, C.L.; Merdan, T.; et al. Microfluidic mixing as platform technology for production of chitosan nanoparticles loaded with different macromolecules. Eur. J. Pharm. Biopharm. 2023, 188, 170–181. [Google Scholar] [CrossRef] [PubMed]
- Karnik, R.; Gu, F.; Basto, P.; Cannizzaro, C.; Dean, L.; Kyei-Manu, W.; Langer, R.; Farokhzad, O.C. Microfluidic platform for controlled synthesis of polymeric nanoparticles. Nano Lett. 2008, 8, 2906–2912. [Google Scholar] [CrossRef] [PubMed]
- Jahn, A.; Stavis, S.M.; Hong, J.S.; Vreeland, W.N.; DeVoe, D.L.; Gaitan, M. Microfluidic Mixing and the Formation of Nanoscale Lipid Vesicles. ACS Nano 2010, 4, 2077–2087. [Google Scholar] [CrossRef]
- Schütze, F.; Stempfle, B.; Jüngst, C.; Wöll, D.; Zumbusch, A.; Mecking, S. Fluorescent conjugated block copolymer nanoparticles by controlled mixing. Chem. Commun. 2012, 48, 2104–2106. [Google Scholar] [CrossRef]
- Siavashy, S.; Soltani, M.; Ghorbani-Bidkorbeh, F.; Fallah, N.; Farnam, G.; Mortazavi, S.A.; Shirazi, F.H.; Tehrani, M.H.H.; Hamedi, M.H. Microfluidic platform for synthesis and optimization of chitosan-coated magnetic nanoparticles in cisplatin delivery. Carbohydr. Polym. 2021, 265, 118027. [Google Scholar] [CrossRef]
- Beconcini, D.; Fabiano, A.; Zambito, Y. Chitosan-Based Nanoparticles Containing Cherry Extract from Prunus avium L. to Improve the Resistance of Endothelial Cells to Oxidative Stress. Nutrients 2018, 10, 1598. [Google Scholar] [CrossRef]
- Omwenga, E.O.; Hensel, A.; Shitandi, A.; Goycoolea, F.M. Chitosan nanoencapsulation of flavonoids enhances their quorum sensing and biofilm formation inhibitory activities against an E.coli Top 10 biosensor. Colloids Surf. B Biointerfaces 2018, 164, 125–133. [Google Scholar] [CrossRef]
- Manikandan, A.; Sathiyabama, M. Preparation of Chitosan nanoparticles and its effect on detached rice leaves infected with Pyricularia grisea. Int. J. Biol. Macromol. 2016, 84, 58–61. [Google Scholar] [CrossRef]
- Quintero-García, M.; Gutiérrez-Cortez, E.; Bah, M. Comparative Analysis of the Chemical Composition and Physicochemical Properties of the Mucilage Extracted from Fresh and Dehydrated Opuntia ficus indica Cladodes. Foods 2021, 10, 2137. [Google Scholar] [CrossRef]
- Zheng, H.; Zhou, Y. Advances in hydrogels for the treatment of periodontitis. J. Mater. Chem. B 2023, 11, 7321–7333. [Google Scholar] [CrossRef] [PubMed]
- Moon, H.J.; Park, M.H.; Joo, M.K.; Jeong, B. Temperature-responsive compounds as in situ gelling biomedical materials. Chem. Soc. Rev. 2012, 41, 4860–4883. [Google Scholar] [CrossRef]
- Barichello, J.M.; Morishita, M.; Takayama, K.; Nagai, T. Absorption of insulin from pluronic F-127 gels following subcutaneous administration in rats. Int. J. Pharm. 1999, 184, 189–198. [Google Scholar] [CrossRef] [PubMed]
- Valentino, A.; Di Cristo, F.; Bosetti, M.; Amaghnouje, A.; Bousta, D.; Conte, R.; Calarco, A. Bioactivity and Delivery Strategies of Phytochemical Compounds in Bone Tissue Regeneration. Appl. Sci. 2021, 11, 5122. [Google Scholar] [CrossRef]
- Johan, F.; Renvert, S.; Anderberg, P.; Isaksson, U.; Berglund, J. Measurement of body temperature in the oral cavity with a temperature sensor integrated with a powered toothbrush. SN Appl. Sci. 2022, 5, 22. [Google Scholar] [CrossRef]
- Li, M.; Lv, J.; Yang, Y.; Cheng, G.; Guo, S.; Liu, C.; Ding, Y. Advances of Hydrogel Therapy in Periodontal Regeneration—A Materials Perspective Review. Gels 2022, 8, 624. [Google Scholar] [CrossRef]
- Zhou, Y.; Yang, Y.; Liu, R.; Zhou, Q.; Lu, H.; Zhang, W. Research Progress of Polydopamine Hydrogel in the Prevention and Treatment of Oral Diseases. Int. J. Nanomed. 2023, 18, 2623–2645. [Google Scholar] [CrossRef]
- Pham, D.T.; Phewchan, P. Development of Metronidazole-loaded In situ Thermosensitive Hydrogel for Periodontitis Treatment. Turk. J. Pharm. Sci. 2021, 18, 510–516. [Google Scholar] [CrossRef]
- Saini, R.; Marawar, P.P.; Shete, S.; Saini, S. Periodontitis, a true infection. J. Glob. Infect. Dis. 2009, 1, 149–150. [Google Scholar] [CrossRef]
- Pourmajed, R.; Jabbari Amiri, M.; Karami, P.; Khaledi, A. Antimicrobial Effect of Opuntia ficus-indica Extract on Escherichia coli Isolated from Patients with Urinary Tract Infection. Iran. J. Public Health 2021, 50, 634–636. [Google Scholar] [CrossRef]
- Dhaouadi, K.; Raboudi, F.; Funes, L.; Pamies, D.; Estevan, C.; Mohamed Hédi, H.; Sami, F. Polyphenolic Extract of Barbary-Fig (Opuntia ficus-indica) Syrup: RP–HPLC–ESI–MS Analysis and Determination of Antioxidant, Antimicrobial and Cancer-Cells Cytotoxic Potentials. Food Anal. Methods 2013, 6, 45–53. [Google Scholar] [CrossRef]
- Welegerima, G.; Zemene, A. Antibacterial activity of opuntia ficus indica skin fruit extracts. Biotechnol. Int. 2017, 10, 74–83. [Google Scholar]
- How, K.Y.; Song, K.P.; Chan, K.G. Porphyromonas gingivalis: An Overview of Periodontopathic Pathogen below the Gum Line. Front. Microbiol. 2016, 7, 53. [Google Scholar] [CrossRef] [PubMed]
- Abdulkareem, A.A.; Al-Taweel, F.B.; Al-Sharqi, A.J.B.; Gul, S.S.; Sha, A.; Chapple, I.L.C. Current concepts in the pathogenesis of periodontitis: From symbiosis to dysbiosis. J. Oral Microbiol. 2023, 15, 2197779. [Google Scholar] [CrossRef]
- Di Cristo, F.; Valentino, A. PLA Nanofibers for Microenvironmental-Responsive Quercetin Release in Local Periodontal Treatment. Molecules 2022, 27, 2205. [Google Scholar] [CrossRef] [PubMed]
- Stewart, P.S.; Franklin, M.J. Physiological heterogeneity in biofilms. Nat. Rev. Microbiol. 2008, 6, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Bakadia, B.M.; Boni, B.O.O.; Ahmed, A.A.Q.; Zheng, R.; Shi, Z.; Ullah, M.W.; Lamboni, L.; Yang, G. In Situ Synthesized Porous Bacterial Cellulose/Poly(vinyl alcohol)-Based Silk Sericin and Azithromycin Release System for Treating Chronic Wound Biofilm. Macromol. Biosci. 2022, 22, e2200201. [Google Scholar] [CrossRef]
- Bjarnsholt, T. The role of bacterial biofilms in chronic infections. Apmis 2013, 121, 1–58. [Google Scholar] [CrossRef]
- Pouget, C.; Dunyach-Remy, C.; Pantel, A.; Schuldiner, S.; Sotto, A.; Lavigne, J.P. Biofilms in Diabetic Foot Ulcers: Significance and Clinical Relevance. Microorganisms 2020, 8, 1580. [Google Scholar] [CrossRef]
- Rosman, C.W.K.; van der Mei, H.C.; Sjollema, J. Influence of sub-inhibitory concentrations of antimicrobials on micrococcal nuclease and biofilm formation in Staphylococcus aureus. Sci. Rep. 2021, 11, 13241. [Google Scholar] [CrossRef]
- Silva, E.; Teixeira, J.A.; Pereira, M.O.; Rocha, C.M.R.; Sousa, A.M. Evolving biofilm inhibition and eradication in clinical settings through plant-based antibiofilm agents. Phytomedicine 2023, 119, 154973. [Google Scholar] [CrossRef]
- Szafrański, S.P.; Deng, Z.L.; Tomasch, J.; Jarek, M.; Bhuju, S.; Rohde, M.; Sztajer, H.; Wagner-Döbler, I. Quorum sensing of Streptococcus mutans is activated by Aggregatibacter actinomycetemcomitans and by the periodontal microbiome. BMC Genom. 2017, 18, 238. [Google Scholar] [CrossRef]
- Sultan, M.; Arya, R.; Kim, K.K. Roles of Two-Component Systems in Pseudomonas aeruginosa Virulence. Int. J. Mol. Sci. 2021, 22, 12152. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T.; Huang, J.; Liu, Z.; Xu, Z.; Zhang, L.H. Molecular Mechanisms Underlying the Regulation of Biofilm Formation and Swimming Motility by FleS/FleR in Pseudomonas aeruginosa. Front. Microbiol. 2021, 12, 707711. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Jiang, W.; Jiang, Y.; Dong, J. Anti-biofilm activities of coumarin as quorum sensing inhibitor for Porphyromonas gingivalis. J. Oral Microbiol. 2022, 14, 2055523. [Google Scholar] [CrossRef] [PubMed]
- Fahrenfeld, N.; Ma, Y.; O’Brien, M.; Pruden, A. Reclaimed water as a reservoir of antibiotic resistance genes: Distribution system and irrigation implications. Front. Microbiol. 2013, 4, 130. [Google Scholar] [CrossRef]
- Di Salle, A.; Viscusi, G. Antimicrobial and Antibiofilm Activity of Curcumin-Loaded Electrospun Nanofibers for the Prevention of the Biofilm-Associated Infections. Molecules 2021, 26, 4866. [Google Scholar] [CrossRef]
- Chen, H.; Cheng, R.; Zhao, X.; Zhang, Y.; Tam, A.; Yan, Y.; Shen, H.; Zhang, Y.S.; Qi, J.; Feng, Y.; et al. An injectable self-healing coordinative hydrogel with antibacterial and angiogenic properties for diabetic skin wound repair. NPG Asia Mater. 2019, 11, 3. [Google Scholar] [CrossRef]
- Wolfe, K.L.; Liu, R.H. Cellular antioxidant activity (CAA) assay for assessing antioxidants, foods, and dietary supplements. J. Agric. Food Chem. 2007, 55, 8896–8907. [Google Scholar] [CrossRef]
- Kilmukhametova, Y.H.; Batig, V.M.; Ostafiichuk, M.A.; Tokar, O.M.; Glushchenko, T.A.; Batih, I.V.; Sheremet, M.I. Indicators of antioxidant protection of blood in necrotizing ulcerative gingivitis in experimental animals. J. Med. Life 2021, 14, 68–74. [Google Scholar] [CrossRef]
- Sun, X.; Gao, J.; Meng, X.; Lu, X.; Zhang, L.; Chen, R. Polarized Macrophages in Periodontitis: Characteristics, Function, and Molecular Signaling. Front. Immunol. 2021, 12, 763334. [Google Scholar] [CrossRef] [PubMed]
- Lira-Junior, R.; Holmström, S.B.; Clark, R.; Zwicker, S.; Majster, M.; Johannsen, G.; Axtelius, B.; Åkerman, S.; Svensson, M.; Klinge, B.; et al. S100A12 Expression Is Modulated during Monocyte Differentiation and Reflects Periodontitis Severity. Front. Immunol. 2020, 11, 86. [Google Scholar] [CrossRef]
- Garaicoa-Pazmino, C.; Fretwurst, T.; Squarize, C.H. Characterization of macrophage polarization in periodontal disease. J. Clin. Periodontol. 2019, 46, 830–839. [Google Scholar] [CrossRef]
- Zheng, X.F.; Hong, Y.X.; Feng, G.J.; Zhang, G.F.; Rogers, H.; Lewis, M.A.; Williams, D.W.; Xia, Z.F.; Song, B.; Wei, X.Q. Lipopolysaccharide-induced M2 to M1 macrophage transformation for IL-12p70 production is blocked by Candida albicans mediated up-regulation of EBI3 expression. PLoS ONE 2013, 8, e63967. [Google Scholar] [CrossRef] [PubMed]
- Conte, R.; De Luca, I. Hyaluronic Acid Hydrogel Containing Resveratrol-Loaded Chitosan Nanoparticles as an Adjuvant in Atopic Dermatitis Treatment. Funct. Biomater. 2023, 14, 82. [Google Scholar] [CrossRef] [PubMed]
- Di Cristo, F.; Valentino, A. Polylactic Acid/Poly(vinylpyrrolidone) Co-Electrospun Fibrous Membrane as a Tunable Quercetin Delivery Platform for Diabetic Wounds. Pharmaceutics 2023, 15, 805. [Google Scholar] [CrossRef]
- Spagnuolo, G.; De Luca, I.; Iaculli, F.; Barbato, E.; Valletta, A.; Calarco, A.; Valentino, A.; Riccitiello, F. Regeneration of dentin-pulp complex: Effect of calcium-based materials on hDPSCs differentiation and gene expression. Dent. Mater. Off. Publ. Acad. Dent. Mater. 2023, 39, 485–491. [Google Scholar] [CrossRef]
- Valentino, A.; Conte, R. Thermo-Responsive Gel Containing Hydroxytyrosol-Chitosan Nanoparticles (Hyt@tgel) Counteracts the Increase of Osteoarthritis Biomarkers in Human Chondrocytes. Antioxidants 2022, 11, 1210. [Google Scholar] [CrossRef]
- Wang, Y.; Yao, D.; Li, L.; Qian, Z.; He, W.; Ding, R.; Liu, H. Effect of Electrospun Silk Fibroin-Silk Sericin Films on Macrophage Polarization and Vascularization. ACS Biomater. Sci. Eng. 2020, 6, 3502–3512. [Google Scholar] [CrossRef]
- Unuvar Purcu, D.; Korkmaz, A.; Gunalp, S. Effect of stimulation time on the expression of human macrophage polarization markers. PLoS ONE 2022, 17, e0265196. [Google Scholar] [CrossRef]
Phenol | Concentration (mg/100 g) |
---|---|
Trans Ferulic Acid | 10.10 ± 0.91 |
Kaempeferol | 8.50 ± 0.36 |
Quercetin | 7.90 ± 0.31 |
Kaempferol-3-O-Glucoside | 7.10 ± 0.32 |
Quercetin-3-O Hexose Deoxyhexose | 6.99 ± 0.29 |
Isorhamnetin | 6.83 ± 0.28 |
Isorhamnetin Rutinoside | 6.39 ± 0.25 |
Ferulic Acid | 6.29 ± 0.27 |
Rutin | 6.20 ± 0.21 |
Caffeic Acid | 5.40 ± 0.24 |
Sinapic Acid | 4.83 ± 0.19 |
Chlorogenic Acid | 3.06 ± 0.12 |
P Coumarci Acid | 2.52 ± 0.17 |
Syringic Acid | 1.71 ± 0.14 |
Kaempferol-3-O-Hexose Deohyhexose | 1.31 ± 0.09 |
Hydroxytyrosol | 0.79 ± 0.07 |
Apigenin | <0.10 |
Luteoilin | <0.10 |
Gallocathechin/Epigallocathechin | <0.1 |
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
16SrRNA | CCTACGGGAGGCAGCAGTAG | CAACAGAGCTTTACGATCCGAAA |
rhlA | AGCTGGGACGAATACACCA | GACTCCAGGTCGAGGAAATG |
rhlB | GAGCGACGAACTGACCTACC | GTTGAACTTGGGGTGTACCG |
ComC | GACTTTAAAGAAATTAAGACTG | AAGCTTGTGTAAAACTTCTGT |
ComD | CTCTGATTGACCATTCTTCTGG | CATTCTGAGTTTATGCCCCTC |
kgp | AGGAACGACAAACGCCTCTA | GTCACCAACCAAAGCCAAGA |
rgpA | CACCGAAGTTCAAACCCCTA | GAGGGTGCAATCAGGACATT |
rgpB | GCTCGGTCAGGCTCTTTGTA | GGGTAAGCAGATTGGCGATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Conte, R.; Valentino, A.; De Luca, I.; Soares Pontes, G.; Calarco, A.; Cerruti, P. Thermo-Responsive Hydrogel Containing Microfluidic Chitosan Nanoparticles Loaded with Opuntia ficus-indica Extract for Periodontitis Treatment. Int. J. Mol. Sci. 2024, 25, 9374. https://doi.org/10.3390/ijms25179374
Conte R, Valentino A, De Luca I, Soares Pontes G, Calarco A, Cerruti P. Thermo-Responsive Hydrogel Containing Microfluidic Chitosan Nanoparticles Loaded with Opuntia ficus-indica Extract for Periodontitis Treatment. International Journal of Molecular Sciences. 2024; 25(17):9374. https://doi.org/10.3390/ijms25179374
Chicago/Turabian StyleConte, Raffaele, Anna Valentino, Ilenia De Luca, Gemilson Soares Pontes, Anna Calarco, and Pierfrancesco Cerruti. 2024. "Thermo-Responsive Hydrogel Containing Microfluidic Chitosan Nanoparticles Loaded with Opuntia ficus-indica Extract for Periodontitis Treatment" International Journal of Molecular Sciences 25, no. 17: 9374. https://doi.org/10.3390/ijms25179374