Organic vs. Conventional Milk: Uncovering the Link to Antibiotic Resistance in Bacillus cereus sensu lato
Abstract
:1. Introduction
2. Results
2.1. Bacillus cereus s.l. Presence in Conventional and Organic Milk
2.2. Antibiotic Resistance in B. cereus s.l. from Conventional and Organic Milk
2.3. Antibiotic Minimum Inhibitory Concentrations (MIC)
2.4. Toxicity
2.5. Phylogenetic Relatedness vs. Antibiotic Resistance Profiles
3. Discussion
4. Materials and Methods
4.1. Bacterial Isolation and Identification
4.2. Antibiotic Resistance
4.3. PCR and qPCR Analyses
4.4. Toxigenicity Assessment
4.5. Phylogenetic Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Antibiotic Group | Antibiotic | B. cereus s.l. (%) | ||
---|---|---|---|---|
Sensitive | Intermediate | Resistant | ||
Penicillins | Penicillin | 0 | 0 | 100 |
Ampicillin | 16.3 | 21.3 | 62.4 | |
Amoxicillin | 0 | 5.7 | 94.3 | |
Amoxicillin with clavulanic acid | 8.4 | 9.2 | 82.4 | |
Cephalosporins | Ceftriaxone | 8.4 | 48.2 | 43.4 |
Carbapenems | Meropenem | 98.4 | 1.6 | 0 |
Macrolides | Erythromycin | 78 | 18.6 | 3.4 |
Azithromycin | 81.2 | 13.2 | 5.6 | |
Clarithromycin | 100 | 0 | 0 | |
Tetracyclines | Tetracycline | 69.8 | 19.8 | 10.4 |
Lincosamides | Clindamycin | 93 | 5.7 | 1.3 |
Aminoglycosides | Gentamicin | 100 | 0 | 0 |
Streptomycin | 63.9 | 36.1 | 0 | |
Fluoroquinolones | Ciprofloxacin | 100 | 0 | 0 |
Levofloxacin | 100 | 0 | 0 | |
Oxazolidinones | Linezolid | 100 | 0 | 0 |
Glycopeptides | Vancomycin | 97.3 | 2.7 | 0 |
Phenicols | Chloramphenicol | 100 | 0 | 0 |
Rifamycins | Rifampicin | 100 | 0 | 0 |
References
- Park, K.M.; Kim, H.J.; Jeong, M.; Koo, M. Enterotoxin Genes, Antibiotic Susceptibility, and Biofilm Formation of Low-Temperature-Tolerant Bacillus cereus Isolated from Green Leaf Lettuce in the Cold Chain. Foods 2020, 9, 249. [Google Scholar] [CrossRef] [PubMed]
- Święcicka, I.; Bideshi, D.K.; Federici, B.A. Novel Isolate of Bacillus thuringiensis subsp. thuringiensis That Produces a Quasi-Cuboidal Crystal of Cry1Ab21 Toxic to Larvae of Trichoplusia ni. Appl. Environ. Microbiol. 2008, 74, 923–930. [Google Scholar]
- Messelhäußer, U.; Ehling-Schulz, M. Bacillus cereus—A Multifaceted Opportunistic Pathogen. Curr. Clin. Microbiol. Rep. 2018, 5, 120–125. [Google Scholar] [CrossRef]
- Ehling-Schulz, M.; Lereclus, D.; Koehler, T.M. The Bacillus cereus Group: Bacillus Species with Pathogenic Potential. Microbiol. Spectr. 2019, 7, GPP3-0032-2018. [Google Scholar] [CrossRef]
- Fiedoruk, K.; Drewnowska, J.M.; Mahillon, J.; Zambrzycka, M.; Swiecicka, I. Pan-Genome Portrait of Bacillus mycoides Provides Insights into the Species Ecology and Evolution. Microbiol. Spectr. 2021, 9, e00311-21. [Google Scholar] [CrossRef]
- Liu, Y.; Lai, Q.; Shao, Z. Genome Analysis-Based Reclassification of Bacillus weihenstephanensis as a Later Heterotypic Synonym of Bacillus mycoides. Int. J. Syst. Evol. Microbiol. 2018, 68, 106–112. [Google Scholar] [CrossRef]
- Bartoszewicz, M.; Czyżewska, U. Spores and Vegetative Cells of Phenotypically and Genetically Diverse Bacillus cereus sensu lato Are Common Bacteria in Fresh Water of Northeastern Poland. Can. J. Microbiol. 2017, 63, 370–379. [Google Scholar] [CrossRef]
- Święcicka, I.; Mahillon, J. Diversity of Commensal Bacillus cereus sensu lato Isolated from the Common Sow Bug (Porcellio scaber, Isopoda). FEMS Microbiol. Ecol. 2006, 56, 132–140. [Google Scholar] [CrossRef]
- Bartoszewicz, M.; Hansen, B.M.; Święcicka, I. The Members of the Bacillus cereus Group Are Commonly Present Contaminants of Fresh and Heat-Treated Milk. Food Microbiol. 2008, 25, 588–596. [Google Scholar] [CrossRef]
- Kulkova, I.; Dobrzyński, J.; Kowalczyk, P.; Jaroszuk-Ściseł, J.; Grąz, M. Plant Growth Promotion Using Bacillus cereus. Int. J. Mol. Sci. 2023, 24, 9759. [Google Scholar] [CrossRef]
- Jovanovic, J.; Ornelis, V.F.M.; Madder, A.; Rajkovic, A. Bacillus cereus Food Intoxication and Toxicoinfection. Compr. Rev. Food Sci. Food Saf. 2021, 20, 3719–3761. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, J.; Maćkiw, E.; Korsak, D.; Postupolski, J. Characteristic and Antimicrobial Resistance of Bacillus cereus Group Isolated from Food in Poland. Pol. J. Food Nutr. Sci. 2022, 3, 297–304. [Google Scholar] [CrossRef]
- Farina, D.; Bianco, A.; Manzulli, V.; Castellana, S.; Parisi, A.; Caruso, M.; Fraccalvieri, R.; Serrecchia, L.; Rondinone, V.; Pace, L.; et al. Antimicrobial and Phylogenomic Characterization of Bacillus cereus Group Strains Isolated from Different Food Sources in Italy. Antibiotics 2024, 13, 898. [Google Scholar] [CrossRef] [PubMed]
- Hernández, A.G.C.; Ortiz, V.G.; Gómez, J.L.A.; López, M.Á.R.; Morales, J.A.R.; Macías, A.F.; Hidalgo, E.Á.; Ramírez, J.N.; Gallardo, F.J.F.; Gutiérrez, M.C.G.; et al. Detection of Bacillus cereus sensu lato Isolates Posing Potential Health Risks in Mexican Chili Powder. Microorganisms 2021, 9, 2226. [Google Scholar] [CrossRef] [PubMed]
- Bartoszewicz, M.; Czyżewska, U. Comparison of the Antibiotic Resistance between Genetically Diverse and Toxigenic Bacillus cereus sensu lato from Milk, Pepper, and Natural Habitats. J. Appl. Microbiol. 2021, 130, 370–381. [Google Scholar] [CrossRef]
- Fiedler, G.; Schneider, C.; Igbinosa, E.O.; Kabisch, J.; Brinks, E.; Becker, B.; Kroll, C.; Ziehm, D.; Fries, R. Antibiotics Resistance and Toxin Profiles of Bacillus cereus-Group Isolates from Fresh Vegetables from German Retail Markets. BMC Microbiol. 2019, 19, 250. [Google Scholar] [CrossRef]
- Coorevits, A.; De Jonghe, V.; Vandroemme, J.; Reekmans, R.; Heyrman, J.; Messens, W.; De Vos, P.; Heyndrickx, M. Comparative Genomics of Dairy-Associated Bacillus cereus Strains. Syst. Appl. Microbiol. 2008, 31, 126–140. [Google Scholar] [CrossRef]
- Jolley, K.A.; Bray, J.E.; Maiden, M.C.J. Open-Access Bacterial Population Genomics: BIGSdb Software, the PubMLST.org Website, and Their Applications. Wellcome Open Res. 2018, 3, 124. [Google Scholar] [CrossRef]
- Lin, Y.; Alstrup, M.; Pang, J.K.Y.; Maróti, G.; Er-Rafik, M.; Tourasse, N.; Økstad, O.A.; Kovács, Á.T. Adaptation of Bacillus thuringiensis to Plant Colonization Affects Differentiation and Toxicity. mSystems 2021, 6, e00864-21. [Google Scholar] [CrossRef]
- Serra, C.R.; Almeida, E.M.; Guerreiro, I.; Santos, R.; Merrifield, D.L.; Tavares, F.; Oliva-Teles, A. Selection of Carbohydrate-Active Probiotics from the Gut of Carnivorous Fish Fed Plant-Based Diets. Sci. Rep. 2019, 9, 6384. [Google Scholar] [CrossRef]
- Raymond, B.; Wyres, K.L.; Sheppard, S.K.; Ellis, R.J.; Bonsall, M.B. Environmental Factors Determining the Epidemiology and Population Genetic Structure of the Bacillus cereus Group in the Field. PLoS Pathog. 2010, 6, e1000905. [Google Scholar] [CrossRef] [PubMed]
- Drewnowska, J.M.; Święcicka, I. Eco-Genetic Structure of Bacillus cereus sensu lato Populations from Different Environments in Northeastern Poland. PLoS ONE 2013, 8, e80175. [Google Scholar] [CrossRef] [PubMed]
- Fiedoruk, K.; Drewnowska, J.; Daniluk, T.; Mahillon, J.; Zambrzycka, M.; Święcicka, I. Ribosomal Background of the Bacillus cereus Group Thermotypes. Sci. Rep. 2017, 7, 46430. [Google Scholar] [CrossRef] [PubMed]
- Patiño-Navarrete, R.; Sanchis, V. Evolutionary Processes and Environmental Factors Underlying the Genetic Diversity and Lifestyles of Bacillus cereus Group Bacteria. Res. Microbiol. 2017, 168, 309–318. [Google Scholar] [CrossRef]
- Bartoszewicz, M.; Marjańska, P.S. Milk-Originated Bacillus cereus sensu lato Strains Harbouring Bacillus anthracis-Like Plasmids Are Genetically and Phenotypically Diverse. Food Microbiol. 2017, 65, 48–57. [Google Scholar] [CrossRef]
- Biggel, M.; Jessberger, N.; Kovac, J.; Johler, S. Recent Paradigm Shifts in the Perception of the Role of Bacillus thuringiensis in Foodborne Disease. Food Microbiol. 2022, 104, 104991. [Google Scholar] [CrossRef]
- Ceuppens, S.; Boon, N.; Uyttendaele, M. Diversity of Bacillus cereus Group Strains Is Reflected in Their Broad Range of Pathogenicity and Diverse Ecological Lifestyles. FEMS Microbiol. Ecol. 2013, 84, 433–450. [Google Scholar] [CrossRef]
- Chon, J.-W.; Kim, J.-H.; Lee, S.-J.; Hyeon, J.-Y.; Seo, K.-H. Toxin Profile, Antibiotic Resistance, and Phenotypic and Molecular Characterization of Bacillus cereus in Sunsik. Food Microbiol. 2012, 32, 217–222. [Google Scholar] [CrossRef]
- Park, K.M.; Jeong, M.; Park, K.J.; Koo, M. Prevalence, Enterotoxin Genes, and Antibiotic Resistance of Bacillus cereus Isolated from Raw Vegetables in Korea. J. Food Prot. 2018, 81, 1590–1597. [Google Scholar] [CrossRef]
- Magnusson, M.; Christiansson, A.; Svensson, B. Bacillus cereus Spores During Housing of Dairy Cows: Factors Affecting Contamination of Raw Milk. J. Dairy Sci. 2007, 90, 2745–2754. [Google Scholar] [CrossRef]
- Lu, M.; Ruirui, Z.; Lei, D.; Haiyan, H.; Huimin, L.; Nan, Z.; Jiaqi, W.; Jianbo, C. Characterization and Spoilage Potential of Bacillus cereus Isolated from Farm Environment and Raw Milk. Front. Microbiol. 2022, 13, 940611. [Google Scholar] [CrossRef]
- Park, Y.B.; Kim, J.B.; Shin, S.W.; Kim, J.C.; Cho, S.H.; Lee, B.K.; Ahn, J.; Kim, J.M. Prevalence, Genetic Diversity, and Antibiotic Susceptibility of Bacillus cereus Strains Isolated from Rice and Cereals Collected in Korea. J. Food Prot. 2009, 72, 612–617. [Google Scholar] [CrossRef] [PubMed]
- Arslan, S.; Eyi, A.; Küçüksari, R. Toxigenic Genes, Spoilage Potential, and Antimicrobial Resistance of Bacillus cereus Group Strains from Ice Cream. Anaerobe 2014, 25, 42–46. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Tenover, F.C.; Koehler, T.M. β-Lactamase Gene Expression in a Penicillin-Resistant Bacillus anthracis Strain. Antimicrob. Agents Chemother. 2004, 48, 4873–4877. [Google Scholar] [CrossRef]
- Sadaf, A.; Sinha, R.; Khare, S.K. Structure and Functional Characterization of a Distinctive β-Lactamase from an Environmental Strain EMB20 of Bacillus cereus. Appl. Biochem. Biotechnol. 2018, 184, 197–211. [Google Scholar] [CrossRef]
- Ghazaei, C. Phenotypic and Molecular Detection of Beta-Lactamase Enzyme Produced by Bacillus cereus Isolated from Pasteurized and Raw Milk. J. Med. Bacteriol. 2019, 8, 17–22. [Google Scholar]
- Hanafiah, A.; Sukri, A.; Yusoff, H.; Chan, C.S.; Hazrin-Chong, N.H.; Salleh, S.A.; Neoh, H.-M. Insights into the Microbiome and Antibiotic Resistance Genes from Hospital Environmental Surfaces: A Prime Source of Antimicrobial Resistance. Antibiotics 2024, 13, 127. [Google Scholar] [CrossRef]
- Modrie, P.; Beuls, E.; Mahillon, J. Differential Plasmid Transfer Dynamics of pAW63 Plasmid among Members of the Bacillus cereus Group in Food Microcosm. J. Appl. Microbiol. 2010, 108, 888–897. [Google Scholar] [CrossRef]
- Rossi, F.; Rizzotti, L.; Felis, G.E.; Torriani, S. Horizontal Gene Transfer among Microorganisms in Food: Current Knowledge and Future Perspectives. Food Microbiol. 2014, 42, 232–243. [Google Scholar] [CrossRef]
- Priest, F.G.; Barker, M.; Baillie, L.W.J.; Holmes, E.C.; Maiden, M.C.J. Population Structure and Evolution of the Bacillus cereus Group. J. Bacteriol. 2004, 186, 7959–7970. [Google Scholar] [CrossRef]
- Bianco, A.; Normanno, G.; Capozzi, L.; Del Sambro, L.; Dambrosio, A. High Genetic Diversity and Virulence Potential in Bacillus cereus sensu lato Isolated from Milk and Cheeses in Apulia Region, Southern Italy. Foods 2023, 12, 1548. [Google Scholar] [CrossRef] [PubMed]
- Lindbäck, T.; Granum, P.E. Bacillus cereus Phospholipases, Enterotoxins, and Other Hemolysins. In The Comprehensive Sourcebook of Bacterial Protein Toxins, 4th ed.; Alouf, J.E., Ladant, D., Popoff, M.R., Eds.; Academic Press: London, UK, 2015; pp. 857–869. [Google Scholar]
- Bartoszewicz, M.; Kraszewska, A.; Modzelewska, E.; Bideshi, D.K.; Święcicka, I. Natural Isolates of Bacillus thuringiensis Display Genetic and Psychrotrophic Properties Characteristic of Bacillus weihenstephanensis. J. Appl. Microbiol. 2009, 106, 1967–1984. [Google Scholar] [CrossRef] [PubMed]
- CLSI Standard M100; Performance Standards for Antimicrobial Susceptibility Testing. 31st ed. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021.
- European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 12.0; EUCAST: Växjö, Sweden, 2022; Available online: https://www.eucast.org (accessed on 20 November 2024).
- Reiter, L.; Kolstø, A.B.; Piehler, A.P. Reference Genes for Quantitative, Reverse-Transcription PCR in Bacillus cereus Group Strains Throughout the Bacterial Life Cycle. J. Microbiol. Methods 2011, 86, 210–217. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Feil, E.J.; Li, B.C.; Aanensen, D.M.; Hanage, W.P.; Spratt, B.G. eBURST: Inferring Patterns of Evolutionary Descent among Clusters of Related Bacterial Genotypes from Multi-Locus Sequence Typing Data. J. Bacteriol. 2004, 186, 1518–1530. [Google Scholar] [CrossRef]
- Nei, M.; Gojobori, T. Simple Methods for Estimating the Numbers of Synonymous and Nonsynonymous Nucleotide Substitutions. Mol. Biol. Evol. 1986, 3, 418–426. [Google Scholar] [CrossRef]
- Tajima, F. Statistical Methods to Test for Nucleotide Mutation Hypothesis by DNA Polymorphism. Genetics 1989, 123, 585–595. [Google Scholar] [CrossRef]
Gene | Primer | Product Size [bp] |
hblA | F: AAGCAATGGAATACAATGGG R: AGAATCTAAATCATGCCACTGC | 1154 |
nheA | F: TACGCTAAGGAGGGGCA R: GTTTTTATTGCTTCATCGGCT | 499 |
cytK | F: GTAACTTTCATTGATGATCC R: GAATACTAAATAATTGTTTCC | 505 |
ces | F: GGTGACACATTATCATATAAGGTG R: GTAAGCGAACCTGTCTGTAACAACA | 1271 |
cspA | F: GAGGAAATAATTATGACAGTT R: CTT(C/T)TTGGCCTTCTTCTAA | 160 |
glp | F: GCGTTTGTGCTGGTGTAAGT R: CTGCAATCGGAAGGAAGAAG | 372 |
gmk | F: ATTTAAGTGAGGAAGGGTAGG R: GCAATGTTCACCAACCACAA | 504 |
ilv | F: CGGGGCAAACATTAAGAGAA R: GGTTCTGGTCGTTTCCATTC | 393 |
pta | F: GCAGAGCGTTTAGCAAAAGAA R: TGCAATGCGAGTTGCTTCTA | 414 |
pur | F: CTGCTGCGAAAAATCACAAA R: CTCACGATTCGCTGCAATAA | 348 |
pyc | F: GCGTTAGGTGGAAACGAAAG R: CGCGTCCAAGTTTATGGAAT | 363 |
tpi | F: GCCCAGTAGCACTTAGCGAC R: CCGAAACCGTCAAGAATGAT | 435 |
repX | F: CCATATCGTGCGATTCTTG R: GAGCAAATTCACTCGCATCA | 583 |
repA | F: TAAATCTAAAAA(C/T)TC(A/G)AAAGCTG R: GGCATTCTGAAGAA(A/C/G)CCAAA | 576 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bartoszewicz, M.; Czyżewska, U.; Zambrzycka, M.; Święcicka, I. Organic vs. Conventional Milk: Uncovering the Link to Antibiotic Resistance in Bacillus cereus sensu lato. Int. J. Mol. Sci. 2024, 25, 13528. https://doi.org/10.3390/ijms252413528
Bartoszewicz M, Czyżewska U, Zambrzycka M, Święcicka I. Organic vs. Conventional Milk: Uncovering the Link to Antibiotic Resistance in Bacillus cereus sensu lato. International Journal of Molecular Sciences. 2024; 25(24):13528. https://doi.org/10.3390/ijms252413528
Chicago/Turabian StyleBartoszewicz, Marek, Urszula Czyżewska, Monika Zambrzycka, and Izabela Święcicka. 2024. "Organic vs. Conventional Milk: Uncovering the Link to Antibiotic Resistance in Bacillus cereus sensu lato" International Journal of Molecular Sciences 25, no. 24: 13528. https://doi.org/10.3390/ijms252413528
APA StyleBartoszewicz, M., Czyżewska, U., Zambrzycka, M., & Święcicka, I. (2024). Organic vs. Conventional Milk: Uncovering the Link to Antibiotic Resistance in Bacillus cereus sensu lato. International Journal of Molecular Sciences, 25(24), 13528. https://doi.org/10.3390/ijms252413528