Genome Studies in Amaranthus cruentus L. and A. hypochondriacus L. Based on Repeatomic and Cytogenetic Data
Abstract
1. Introduction
2. Results
2.1. Comparative Analyses of the Repetitive DNA Sequences Identified in Genomes of the Studied Species
2.2. BLAST Similarity of the Identified SatDNAs
2.3. Chromosomal Structural Variations
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Chromosome Spread Preparation
4.3. Sequence Analysis and Identification of DNA Repeats
4.4. Multicolor Fluorescence in Situ Hybridization
4.5. Chromosome Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Assad, R.; Reshi, Z.A.; Jan, S.; Rashid, I. Biology of Amaranths. Bot. Rev. 2017, 83, 382–436. [Google Scholar] [CrossRef]
- Chakraborty, S.; Chakraborty, N.; Agrawal, L.; Ghosh, S.; Narula, K.; Shekhar, S.; Naik, P.S.; Pande, P.C.; Chakrborti, S.K.; Datta, A. Next-generation protein-rich potato expressing the seed protein gene AmA1 is a result of proteome rebalancing I transgenic tuber. Proc. Natl. Acad. Sci. USA 2010, 107, 17533–17538. [Google Scholar] [CrossRef] [PubMed]
- Palmeros-Suarez, P.A.; MassangeSánchez, J.A.; Martínez-Gallardo, N.A.; Montero-Vargas, J.M.; Gomez-Leyva, J.F.; Delano-Frier, J.P. The overexpression of an Amaranthus hypochondriacus NF-YC gene modifies growth and confers water deficit stress resistance in Arabidopsis. Plant Sci. 2015, 240, 25–40. [Google Scholar] [CrossRef]
- Massange-Sanchez, J.A.; Palmeros-Suarez, P.A.; Martinez-Gallardo, N.A.; Castrillon-Arbelaez, P.A.; Aviles-Arnaut, H.; Alatorre-Cobos, F.; Tiessen, A.; Delano-Frier, J.P. The novel and taxonomically restricted Ah24 gene from grain amaranth (Amaranthus hypochondriacus) has a dual role in development and defense. Front. Plant Sci. 2015, 6, 602. [Google Scholar] [CrossRef]
- Hajyzade, M. Genome-wide identification and characterisation of abiotic stress responsive mTERF gene family in Amaranthus hypochondriacus. Phyton-IJEB 2023, 92, 1649–1664. [Google Scholar] [CrossRef]
- Marin, D.I.; Bolohan, C.; Mihalache, M.; Rusu, T. Research on Amaranthus cruentus L. and Amararanthus hypochondriacus L. species grown in south-eastern Romania (Moara Domneasca-Ilfov). Sci. Pap. Ser. A Agron. 2011, 54297–54303. Available online: https://api.semanticscholar.org/CorpusID:110079875 (accessed on 16 December 2024).
- Martinez-Lopez, A.; Millan-Linares, M.C.; Noelia, M.; Rodriguez-Martin, N.M.; Francisco Millan, F.; Sergio Montserrat-de la Paz, S. Nutraceutical value of kiwicha (Amaranthus caudatus L.). J. Funct. Foods 2020, 65, 103735. [Google Scholar] [CrossRef]
- Cunha-Chiamolera, T.P.L.; Chileh-Chelh, T.; Urrestarazu, M.; Ezzaitouni, M.; López-Ruiz, R.; Gallón-Bedoya, M.; Rincón-Cervera, M.Á.; Guil-Guerrero, J.L. Crop productivity, phytochemicals, and bioactivities of wild and grown in controlled environment slender Amaranth (Amaranthus viridis L.). Agronomy 2024, 14, 2038. [Google Scholar] [CrossRef]
- Tucker, J.B. Amaranth: The Once and Future Crop. BioScience 1986, 36, 9–13. [Google Scholar] [CrossRef]
- Santiago, P.D.; Tenbergen, K.; Velez-Jimenez, E.; Cardador-Martínez, M.A. Functional attributes of Amaranth. Austin J. Nutr. Food Sci. 2014, 2, 1–6. [Google Scholar]
- Nazeer, S.; Yaman Firincioglu, S. Amaranth in animal nutrition. J. Agric. Food Environ. Anim. Sci. 2022, 3, 195–211. [Google Scholar]
- Maldonado-Cervantes, E.; Jeong, H.J.; Leon-Galvan, F.; Barrera-Pacheco, A.; De Leon-Rodriguez, A.; Gonzalez de Mejia, E.; de Lumen, B.O.; Barba de la Rosa, A.P. Amaranth lunasin-like peptide internalizes into the cell nucleus and inhibits chemical carcinogen-induced transformation of NIH-3T3 cells. Peptides 2010, 31, 1635–1642. [Google Scholar] [CrossRef]
- Tufts, H.R.; Harris, C.S.; Bukania, Z.N.; Johns, T. Antioxidant and anti-inflammatory activities of Kenyan leafy green vegetables, wild fruits, and medicinal plants with potential relevance for kwashiorkor. Evid. Based Complement. Alternat. Med. 2015, 2015, 807158. [Google Scholar] [CrossRef] [PubMed]
- Lado, M.B.; Burini, J.; Rinaldi, G.; Anon, M.C.; Tironi, V.A. Effects of the dietary addition of Amaranth (Amaranthus mantegazzianus) protein isolate on antioxidant status, lipid profiles and blood pressure of rats. Plant Foods Hum. Nutr. 2015, 70, 371–379. [Google Scholar] [CrossRef]
- Sabbione, A.C.; Rinaldi, G.; Anon, M.С.; Scilingo, A.A. Antithrombotic effects of Amaranthus hypochondriacus proteins in rats. Plant Foods Hum. Nutr. 2016, 71, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Sauer, J.D. The grain amaranths and their relatives: A revised taxonomic and geographic survey. Ann. Mo. Bot. Gard. 1967, 54, 102–137. [Google Scholar] [CrossRef]
- Sammour, R.H.; Radwan, S.A.; Mira, M. Genetic diversity in genus Amaranthus: From morphology to genomic DNA. RRBS 2012, 6, 351–360. [Google Scholar]
- Sammour, R.H.; Mira, M.; Radwan, S.A. Phenotypic and isoenzymatic variations in Amaranthus species. Int. J. Agric. Biol. 2021, 26, 587–596. [Google Scholar]
- Hassan, W.A.; Al-shaye, N.A.; Alghamdi, S.; Korany, S.M.; Iamonico, D. Taxonomic revision of the genus Amaranthus (Amaranthaceae) in Saudi Arabia. Phytotaxa 2022, 576, 135–157. [Google Scholar] [CrossRef]
- Yeshitila, M.; Gedebo, A.; Tesfaye, B.; Degu, H.D. Agro-morphological genetic diversity assessment of Amaranthus genotypes from Ethiopia based on qualitative traits. CABI Agric. Biosci. 2024, 5, 95. [Google Scholar] [CrossRef]
- Mosyakin, S.L.; Robertson, K.R. New infrageneric taxa and combinations in Amaranthus L. (Amaranthaceae). Ann. Bot. Fenn. 1996, 33, 275–281. [Google Scholar]
- Costea, M.; Sanders, A.; Waines, G. Preliminary results toward a revision of the Amaranthus hybridus complex (Amaranthaceae). SIDA 2001, 19, 931–974. [Google Scholar]
- Saunders, R.M.; Becker, R. Amaranthus: A potential food and feed resource. Adv. Cereal Sci. Technol. 1984, 6, 357–396. [Google Scholar]
- Mlakar, S.G.; Turinek, M.; Jakop, M.; Bavec, M.; Bavec, F. Nutrition value and use of grain amaranth: Potential future application in bread making. Agricultura 2009, 6, 43–53. [Google Scholar]
- Sheikh, S.M.; Singh, O. Pseudocereals and millets: The lost crops of Kashmir. Genet. Resour. Crop Evol. 2013, 60, 1191–1199. [Google Scholar] [CrossRef]
- Sammour, R.H.; Mira, M.; Radwan, S.; Fahmey, S. Genetic diversity and phylogenetic relationships between and within Amaranthus spp. using RAPD markers. Rev. Mex. Biodiv. 2020, 91, e913254. [Google Scholar] [CrossRef]
- Mallory, M.A.; Hall, R.V.; McNabb, A.R.; Pratt, D.B.; Jellen, E.N.; Maughan, P.J. Development and characterization of microsatellite markers for the grain amaranths. Crop Sci. 2008, 48, 1098–1106. [Google Scholar] [CrossRef]
- Maughan, P.J.; Sisneros, N.; Luo, M.; Kudrna, D.; Ammiraju, J.S.S.; Wing, R.A. Construction of an Amaranthus hypochondriacus bacterial artificial chromosome library and genomic sequencing of herbicide target genes. Crop Sci. 2008, 48, 85–94. [Google Scholar] [CrossRef]
- Maughan, P.J.; Smith, S.M.; Fairbanks, D.J.; Jellen, E.N. Development, characterization, and linkage mapping of single nucleotide polymorphisms in the grain amaranths (Amaranthus spp.). Plant Gen. 2011, 4, 92–101. [Google Scholar] [CrossRef]
- Thapa, R.; Edwards, M.; Blair, M.W. Relationship of cultivated grain amaranth species and wild relative accessions. Genes 2021, 12, 1849. [Google Scholar] [CrossRef] [PubMed]
- Sunil, M.; Hariharan, A.K.; Nayak, S.; Gupta, S.; Nambisan, S.R.; Gupta, R.P.; Panda, B.; Choudhary, B.; Srinivasan, S. The draft genome and transcriptome of Amaranthus hypochondriacus: A C4 dicot producing high-lysine edible pseudo-cereal. DNA Res. 2014, 21, 585–602. [Google Scholar] [CrossRef] [PubMed]
- Clouse, J.W.; Adhikary, D.; Page, J.T.; Ramaraj, T.; Deyholos, M.K.; Udall, J.A.; Fairbanks, D.J.; Jellen, E.N.; Maughan, P.J. The Amaranth genome: Genome, transcriptome, and physical map assembly. Plant Genome 2016, 9, 1–14. [Google Scholar] [CrossRef]
- Lightfoot, D.J.; Jarvis, D.E.; Ramaraj, T.; Lee, R.; Jellen, E.N.; Maughan, P.J. Single-molecule sequencing and Hi-C-based proximity-guided assembly of amaranth (Amaranthus hypochondriacus) chromosomes provide insights into genome evolution. BMC Biol. 2017, 15, 74. [Google Scholar] [CrossRef] [PubMed]
- Deb, S.; Jayaprasad, S.; Ravi, S.; Rao, K.R.; Whadgar, S.; Hariharan, N.; Dixit, S.; Sunil, M.; Choudhary, B.; Stevanato, P.; et al. Classification of grain amaranths using chromosome-level genome assembly of Ramdana, A. hypochondriacus. Front. Plant Sci. 2020, 11, 579529. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Vaistij, F.E.; Li, Y.; Jansen van Rensburg, W.S.; Harvey, S.; Bairu, M.W.; Venter, S.L.; Mavengahama, S.; Ning, Z.; Graham, I.A.; et al. A chromosome-level Amaranthus cruentus genome assembly highlights gene family evolution and biosynthetic gene clusters that may underpin the nutritional value of this traditional crop. Plant J. 2021, 107, 613–628. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Xu, D.; Wang, S.; Wang, A.; Lei, L.; Jiang, F.; Yang, B.; Yuan, L.; Chen, R.; Zhang, Y.; et al. Chromosome-scale Amaranthus tricolor genome provides insights into the evolution of the genus Amaranthus and the mechanism of betalain biosynthesis. DNA Res. 2022, 30, dsac050. [Google Scholar] [CrossRef]
- Kietlinski, K.D.; Jimenez, F.; Jellen, E.N.; Maughan, P.J.; Smith, S.M.; Pratt, D.B. Relationships between the weedy (Amaranthaceae) and the grain amaranths. Crop Sci. 2014, 54, 220–228. [Google Scholar] [CrossRef]
- Gonçalves-Dias, J.; Stetter, M.G. PopAmaranth: A population genetic genome browser for grain amaranths and their wild relatives. G3 2021, 11, jkab103. [Google Scholar] [CrossRef] [PubMed]
- Lanoue, K.Z.; Wolf, P.G.; Browning, S.; Hood, E.E. Phylogenetic analysis of restriction-site variation in wild and cultivated Amaranthus species (Amaranthaceae). TAG 1996, 93, 722–732. [Google Scholar] [CrossRef] [PubMed]
- Prajitha, V.; Thoppil, J.E. Cytogenetic characterization of Amaranthus caudatus L. and Amaranthus hybridus subsp. cruentus (L.). Thell. Cytotechnology 2018, 70, 95–101. [Google Scholar] [CrossRef]
- Toma, F.N.; Bonna, I.J.; Hossen, R.; Alam, S.S.; Sultana, S.S. Comparative chromosome analysis of three Amaranthus species. Cytologia 2019, 84, 147–151. [Google Scholar] [CrossRef]
- Grant, F.W. Cytogenetic studies in Amaranthus I. Cytogenetical aspects of sex determination in dioecious species. Can. J. Bot. 1959, 37, 413–417. [Google Scholar] [CrossRef]
- Grant, F.W. Cytogenetic studies in Amaranthus III. Chromosome numbers and phylogenetic aspects. Can. J. Genet. Cytol. 1959, 1, 313–318. [Google Scholar] [CrossRef]
- Greizerstein, E.J.; Poggio, L. Karyological studies in grain Amaranths. Cytology 1994, 59, 25–30. [Google Scholar] [CrossRef]
- Kolano, B.; Saracka, K.; Broda-Cnota, A.; Maluszynska, J. Localization of ribosomal DNA and CMA3/DAPI heterochromatin in cultivated and wild Amaranthus species. Sci. Hortic. 2013, 164, 249–255. [Google Scholar] [CrossRef]
- Bonasora, M.G.; Poggio, L.; Greizerstein, E.J. Cytogenetic studies in four cultivated Amaranthus (Amaranthaceae) species. Comp. Cytogenet. 2013, 7, 53–61. [Google Scholar] [CrossRef] [PubMed]
- Flavell, R.B. Repetitive DNA and chromosome evolution in plants. Philos. Trans. R. Soc. B Biol. Sci. 1986, 312, 227–242. [Google Scholar]
- Mehrotra, S.; Goyal, V. Repetitive sequences in plant nuclear DNA: Types, distribution, evolution and function. Genom. Proteom. Bioinform. 2014, 12, 164–171. [Google Scholar] [CrossRef] [PubMed]
- Novák, P.; Neumann, P.; Pech, J.; Steinhaisl, J.; Macas, J. RepeatExplorer: A galaxybased web server for genome-wide characterization of eukaryotic repetitive elements from next-generation sequence reads. Bioinformatics 2013, 29, 792. [Google Scholar] [CrossRef] [PubMed]
- Novak, P.; Robledillo, L.A.; Koblizkova, A.; Vrbova, I.; Neumann, P.; Macas, J. TAREAN: A computational tool for identification and characterization of satellite DNA from unassembled short reads. Nucleic Acids Res. 2017, 45, e111. [Google Scholar] [CrossRef]
- Macas, J.; Novák, P.; Pellicer, J.; Cížková, J.; Koblížková, A.; Neumann, P.; Fuková, I.; Doležel, J.; Kelly, L.J.; Leitch, I.J. In depth characterization of repetitive DNA in 23 plant genomes reveals sources of genome size variation in the legume tribe Fabeae. PLoS ONE 2015, 10, e0143424. [Google Scholar] [CrossRef] [PubMed]
- Muravenko, O.V.; Yurkevich, O.Y.; Kalnyuk, J.V.; Samatadze, T.E.; Zoshchuk, S.A.; Amosova, A.V. Integration of repeatomic and cytogenetic data on satellite DNA for the genome analysis in the genus Salvia (Lamiaceae). Plants 2022, 11, 2244. [Google Scholar] [CrossRef] [PubMed]
- Yurkevich, O.Y.; Samatadze, T.E.; Selyutina, I.Y.; Suprun, N.A.; Suslina, S.N.; Zoshchuk, S.A.; Amosova, A.V.; Muravenko, O.V. Integration of genomic and cytogenetic data on tandem DNAs for analyzing the genome diversity within the genus Hedysarum L. (Fabaceae). Front. Plant Sci. 2022, 13, 865958. [Google Scholar] [CrossRef] [PubMed]
- Samatadze, T.E.; Yurkevich, O.Y.; Khazieva, F.M.; Basalaeva, I.V.; Savchenko, O.M.; Zoshchuk, S.A.; Morozov, A.I.; Amosova, A.V.; Muravenko, O.V. Genome studies in four species of Calendula L. (Asteraceae) using satellite DNAs as chromosome markers. Plants 2023, 12, 4056. [Google Scholar] [CrossRef]
- Kubis, S.; Schmidt, T.; Heslop-Harrison, J.S. Repetitive DNA elements as a major component of plant genomes. Ann. Bot. 1998, 82, 45–55. [Google Scholar] [CrossRef]
- SanMiguel, P.; Bennetzen, J.L. Evidence that a recent increase in maize genome size was caused by the massive amplification of intergene retrotranposons. Ann. Bot. 1998, 82, 37–44. [Google Scholar] [CrossRef]
- Finnegan, D.J. Eukaryotic transposable elements and genome evolution. Trends Genet. 1989, 5, 103–107. [Google Scholar] [CrossRef]
- Bennetzen, J.L.; Wang, H. The contributions of transposable elements to the structure, function, and evolution of plant genomes. Annu. Rev. Plant Biol. 2014, 65, 505–530. [Google Scholar] [CrossRef]
- Makałowski, W.; Gotea, V.; Pande, A.; Makałowska, I. Transposable elements: Classification, identification, and their use as a tool for comparative genomics. In Evolutionary Genomics. Methods in Molecular Biology; Anisimova, M., Ed.; Humana: New York, NY, USA, 2019; Volume 1910, pp. 170–270. [Google Scholar]
- Neumann, P.; Novák, P.; Hoštáková, N.; Macas, J. Systematic survey of plant LTR-retrotransposons elucidates phylogenetic relationships of their polyprotein domains and provides a reference for element classification. Mob. DNA 2019, 10, 1. [Google Scholar] [CrossRef]
- Vitte, C.; Panaud, O. LTR retrotransposons and flowering plant genome size: Emergence of the increase/decrease model. Cytogenet. Genome Res. 2005, 110, 91–107. [Google Scholar] [CrossRef]
- Baucom, R.; Estill, J.; Chaparro, C.; Upshaw, N.; Jogi, A.; Deragon, J.-M.; Westerman, R.P.; SanMiguel, P.J.; Bennetzen, J.L. Exceptional diversity, non-random distribution, and rapid evolution of retroelements in the B73 maize genome. PLoS Genet. 2009, 5, e1000732. [Google Scholar] [CrossRef]
- Zhang, Q.-J.; Gao, L.-I. Rapid and recent evolution of LTR retrotransposons drives rice genome evolution during the speciation of AA-genome Oryza species. G3 2017, 7, 1875–1885. [Google Scholar] [CrossRef]
- McCann, J.; Macas, J.; Novák, P.; Stuessy, T.F.; Villasenor, J.L.; Weiss-Schneweiss, H. Differential genome size and repetitive DNA evolution in diploid species of Melampodium sect Melampodium (Asteraceae). Front. Plant Sci. 2020, 11, 362. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Zheng, Z.; Li, Y.; Hu, H.; Wang, Z.; Du, X. Which factors contribute most to genome size variation within angiosperms? Ecol. Evol. 2021, 11, 2660–2668. [Google Scholar] [CrossRef] [PubMed]
- Becher, H.; Powell, R.F.; Brown, M.R.; Metherell, C.; Pellicer, J.; Leitch, I.J.; Twyford, A.D. The nature of intraspecific and interspecific genome size variation in taxonomically complex eyebrights. Ann. Bot. 2021, 128, 639–651. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Li, X.; Zhou, X.; Li, M.; Zhang, F.; Schwarzacher, T.; Heslop-Harrison, J.S. The repetitive DNA landscape in Avena (Poaceae): Chromosome and genome evolution defined by major repeat classes in whole-genome sequence reads. BMC Plant Biol. 2019, 19, 226. [Google Scholar] [CrossRef] [PubMed]
- Plohl, M.; Meštrovic, N.; Mravinac, B. Satellite DNA evolution. In Repetitive DNA; Garrido-Ramos, M.A., Ed.; Karger: Granada, Spain, 2012; pp. 126–152. [Google Scholar]
- Garrido-Ramos, M.A. Satellite DNA in plants: More than just rubbish. Cytogenet. Genome Res. 2015, 146, 153–170. [Google Scholar] [CrossRef]
- Sharma, S.; Raina, S.N. Organization and evolution of highly repeated satellite DNA sequences in plant chromosomes. Cytogenet. Genome Res. 2005, 109, 15–26. [Google Scholar]
- Ugarkovic, D. Functional elements residing within satellite DNAs. EMBO Rep. 2005, 6, 1035–1039. [Google Scholar] [CrossRef] [PubMed]
- Heslop-Harrison, J.S. Comparative genome organization in plants: From sequence and markers to chromatin and chromosomes. Plant Cell 2000, 12, 617–636. [Google Scholar] [CrossRef]
- Ruiz-Ruano, F.J.; López-León, M.D.; Cabrero, J.; Camacho, J.P.M. High-throughput analysis of the satellitome illuminates satellite DNA evolution. Sci. Rep. 2016, 6, 28333. [Google Scholar] [CrossRef] [PubMed]
- Lower, S.S.; McGurk, M.P.; Clark, A.G.; Barbash, D.A. Satellite DNA Evolution: Old Ideas, New Approaches. Curr. Opin. Genet. Dev. 2018, 49, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Subirana, J.A.; Messeguer, X. DNA satellites are transcribed as part of the non-coding genome in eukaryotes and bacteria. Genes. 2021, 12, 1651. [Google Scholar] [CrossRef] [PubMed]
- May, B.P.; Lippman, Z.B.; Fang, Y.; Spector, D.L.; Martienssen, R.A. Differential regulation of strand-specific transcripts from Arabidopsis centromeric satellite repeats. PLoS Genet. 2005, 1, e79. [Google Scholar] [CrossRef]
- Setiawan, A.B.; Teo, C.H.; Kikuchi, S.; Sassa, H.; Kato, K.; Koba, T. Centromeres of Cucumis melo L. comprise Cmcent and two novel repeats, CmSat162 and CmSat189. PLoS ONE 2020, 15, e0227578. [Google Scholar] [CrossRef]
- Biscotti, M.A.; Olmo, E.; Heslop-Harrison, J.S. Repetitive DNA in eukaryotic genomes. Chromosome Res. 2015, 23, 415–420. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Yi, C.; Bao, W.; Liu, B.; Cui, J.; Yu, H.; Cao, X.; Gu, M.; Liu, M.; Cheng, Z. The transcribed 165-bp CentO satellite is the major functional centromeric element in the wild rice species Oryza punctata. Plant Physiol. 2005, 139, 306–315. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Małuszyńska, J.; Pando, L.G.; Kolano, B. Molecular cytogenetic studies in Chenopodium quinoa and Amaranthus caudatus. Acta Soc. Bot. Pol. 2001, 70, 85–90. [Google Scholar] [CrossRef]
- Pal, M.; Ohri, D.; Subrahmanyam, G.V. A new basic chromosome number for Amaranthus (Amaranthaceae). Cytologia 2000, 65, 13–16. [Google Scholar] [CrossRef][Green Version]
- Srivastava, R.; Roy, B.K. A new chromosome number for Amaranthus blitum. JNBR 2014, 3, 111–114. [Google Scholar]
- Pal, M.; Pandley, R.M.; Khoshoo, T.M. Evolution and improvements of cultivated Amaranths IX. Cytogenetic relationships between the two basic chromosome numbers. J. Hered. 1982, 73, 353–356. [Google Scholar] [CrossRef]
- Layat, E.; Sáez-Vásquez, J.; Tourmente, S. Regulation of Pol I-Transcribed 45S rDNA and Pol III-Transcribed 5S rDNA in Arabidopsis. Plant Cell Physiol. 2012, 53, 267–276. [Google Scholar] [CrossRef]
- Rogers, S.O.; Bendich, A.J. Ribosomal RNA genes in plants: Variability in copy number and in intergenic spacer. Plant Mol. Biol. 1987, 9, 509–520. [Google Scholar] [CrossRef] [PubMed]
- Garcia, S.; Kovařík, A.; Leitch, A.R.; Garnatje, T. Cytogenetic features of rRNA genes across land plants: Analysis of the plant rDNA database. Plant J. 2017, 89, 1020–1030. [Google Scholar] [CrossRef] [PubMed]
- Amosova, A.V.; Gnutikov, A.A.; Rodionov, A.V.; Loskutov, I.G.; Nosov, N.N.; Yurkevich, O.Y.; Samatadze, T.E.; Zoshchuk, S.A.; Muravenko, O.V. Genome Variability in artificial allopolyploid hybrids of Avena sativa L. and Avena macrostachya Balansa ex Coss. et Durieu based on marker sequences of satellite DNA and the ITS1–5.8S rDNA region. Int. J. Mol. Sci. 2024, 25, 5534. [Google Scholar] [CrossRef]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, 71–74. [Google Scholar] [CrossRef] [PubMed]
- Gerlach, W.L.; Bedbrook, J.R. Cloning and characterization of ribosomal RNA genes from wheat and barley. Nucleic Acids Res. 1979, 7, 1869–1885. [Google Scholar] [CrossRef]
- Gerlach, W.L.; Dyer, T.A. Sequence organization of the repeating units in the nucleus of wheat which contain 5S rRNA genes. Nucleic Acids Res. 1980, 8, 4851–4855. [Google Scholar] [CrossRef] [PubMed]
Repeat Name | Genome Proportion, % | |
---|---|---|
A. cruentus | A. hypochondriacus | |
Retrotransposons (Class I) | 11.06 | 10.07 |
Ty1 Copia | 4.28 | 4.00 |
Ale | 0.29 | 0.29 |
Angela | 0.12 | 0.13 |
Bianca | 0.12 | 0.11 |
Ikeros | 0.05 | - |
Ivana | 0.06 | 0.06 |
SIRE | 1.43 | 1.62 |
TAR | 0.86 | 0.86 |
Tork | 1.35 | 0.93 |
Ty3-Gypsy | 5.37 | 3.06 |
Non-chromovirus Athila | 1.44 | 1.07 |
Non-chromovirus Tat-Retand | 0.53 | 0.41 |
Chromovirus CRM | 0.49 | 0.28 |
Chromovirus Tekay | 2.90 | 1.30 |
Chromovirus Reina | 0.01 | - |
LINE | 0.54 | 0.66 |
Unclassified LTR elements | 0.87 | 2.35 |
Transposons (Class II) | 3.52 | 3.07 |
CACTA | 0.82 | 1.24 |
MuDR_Mutator | 1.46 | 0.77 |
hAT | 0.53 | 0.39 |
PIF_Harbinger | 0.06 | 0.05 |
Tc1_Mariner | 0.42 | 0.38 |
Helitron | 0.23 | 0.24 |
Ribosomal DNA | 5.06 | 3.54 |
Unclassified repeats | 11.5 | 15.21 |
DNA satellite | 0.27 | 0.16 |
Putative satDNA families | 6 high confident | 7 low confident |
3 high confident | 4 low confident |
Tandem Repeat/Cluster Proportion, % A. cruentus A. hypochondriacus | Repeat Length, bp | BLAST Similarity | |
---|---|---|---|
AmC4/1.0 (88% identity with AmH51 99% identity with AmH9) | AmH51/0.45 AmH9/0.14 (85% identity with AmH51) | 169 * | AmC4 88% identity/38% cover with A. tricolor uncharacterized LOC130799021, ncRNA, Sequence ID: XR_009039170.1 Gene ID: 130799021, Exon 3 |
AmC9/0.55 AmC27/0.23 (86% identity with AmC9) | AmH4/1.5 (100% identity with AmC9) | 42 * | AmC9 95% identity/9% cover with A. tricolor uncharacterized LOC130813864, transcript variant X2, ncRNA, Sequence ID: XR_009042247.1 Gene ID: 130813864, Exon 7 |
AmC12/0.47 | AmH26/0.24 (97% identity/ 41% cover with AmC12) | 3008 (AmC12) 3949 (AmH26) | AmC12 92% identity/100% cover with A. tricolor uncharacterized LOC130817693, mRNA, Sequence ID: XM_057683543.1 Gene ID: 130817693, Exon 1, 2; Intron 1 |
Tandem Repeat/Genome Proportion [%] | Sequences of the Generated Oligonucleotide FISH Probes |
---|---|
CL4/1.0 | AmC4 ACACTATTTGGTATATATTATTGTGTTGAAGTAGTTAGAATCGAAAATAATTGTCATATGCTTGAAATTAAGTGTTAAGTTGCGTTTTTAAGGGTTTTGAACTATTTTTGTCACTTTCGCGCGTAAAATAGCTTAAACTTGGTTTGTTATGCACGAAACTTGGCACACA |
CL9/0.55 | AmC9 CATTGTTCATTGATCATTGATCCTTGTTCATTGTTCATCGTT |
CL12/0.47 | AmC12_1 TTTTGAAGTTGAGTGTGATGCATCTGGGGTAGGTATTGGAGGTGTCCTAACTCAAAACA ACAAACCTCTTGCTTATTTT AmC12_1196 ACGTGTGCATATAGTTTGGTTATTGTTCGACACGTAGCCAACCTATATCATCTTGGTATCAGAGCCAAGGCTACGCTCC AmC12_2443 GGCAAGGTATGTTCTCTTATTATTGATGGAGGAAGTTGCACTAATGTTGCTTCAAAGACTATGGTGGACAAGCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Amosova, A.V.; Yurkevich, O.Y.; Semenov, A.R.; Samatadze, T.E.; Sokolova, D.V.; Artemyeva, A.M.; Zoshchuk, S.A.; Muravenko, O.V. Genome Studies in Amaranthus cruentus L. and A. hypochondriacus L. Based on Repeatomic and Cytogenetic Data. Int. J. Mol. Sci. 2024, 25, 13575. https://doi.org/10.3390/ijms252413575
Amosova AV, Yurkevich OY, Semenov AR, Samatadze TE, Sokolova DV, Artemyeva AM, Zoshchuk SA, Muravenko OV. Genome Studies in Amaranthus cruentus L. and A. hypochondriacus L. Based on Repeatomic and Cytogenetic Data. International Journal of Molecular Sciences. 2024; 25(24):13575. https://doi.org/10.3390/ijms252413575
Chicago/Turabian StyleAmosova, Alexandra V., Olga Yu. Yurkevich, Alexey R. Semenov, Tatiana E. Samatadze, Diana V. Sokolova, Anna M. Artemyeva, Svyatoslav A. Zoshchuk, and Olga V. Muravenko. 2024. "Genome Studies in Amaranthus cruentus L. and A. hypochondriacus L. Based on Repeatomic and Cytogenetic Data" International Journal of Molecular Sciences 25, no. 24: 13575. https://doi.org/10.3390/ijms252413575
APA StyleAmosova, A. V., Yurkevich, O. Y., Semenov, A. R., Samatadze, T. E., Sokolova, D. V., Artemyeva, A. M., Zoshchuk, S. A., & Muravenko, O. V. (2024). Genome Studies in Amaranthus cruentus L. and A. hypochondriacus L. Based on Repeatomic and Cytogenetic Data. International Journal of Molecular Sciences, 25(24), 13575. https://doi.org/10.3390/ijms252413575