Next Article in Journal
Suppression of Pathological Allergen-Specific B Cells by Protein-Engineered Molecules in a Mouse Model of Chronic House Dust Mite Allergy
Previous Article in Journal
Alkaloids from Waltheria spp. (Malvaceae): Chemosystematic Aspects, Biosynthesis, Total Synthesis, and Biological Activities
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 24
10.3390/ijms252413660
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Lactobacillus agilis SNF7 Presents Excellent Antibacteria and Anti-Inflammation Properties in Mouse Diarrhea Induced by Escherichia coli

by
Mingque Feng
1,2,†,
Jia Cheng
1,†,
Yalan Su
1,
Jingdi Tong
1,
Xiangfu Wen
1,
Tianxiong Jin
1,
Meiyi Ren
1,
Deyuan Song
1,
Jinshang Song
1,
Xiaohan Li
1,
Qinna Xie
1 and
Mingchao Liu
1,3,*
1
College of Veterinary Medicine, Hebei Agricultural University, Baoding 071000, China
2
College of Veterinary Medicine, China Agricultural University, Beijing 100193, China
3
College of Animal Science and Technology, Hebei Agricultural University, Baoding 071000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(24), 13660; https://doi.org/10.3390/ijms252413660
Submission received: 7 November 2024 / Revised: 27 November 2024 / Accepted: 18 December 2024 / Published: 20 December 2024
(This article belongs to the Section Molecular Immunology)
Browse Figures
Versions Notes

Abstract

:
Escherichia coli (E. coli) is a common pathogen that causes diarrhea in newborns and animals. Antibiotics are typically used to treat bacterial diarrhea, a global intestinal health issue. Probiotics have gained interest as a potential substitute for antibiotics in the management of E. coli-induced diarrhea and present novel therapeutic options. In this study, the probiotic properties of Lactobacillus agilis SNF7 (L. agilis SNF7) isolated from feces were investigated, and whole genome sequencing was performed to evaluate the properties of the strain. Furthermore, we investigated the protective effects of L. agilis SNF7 in a mouse model of E. coli K99 infection. L. agilis SNF7 exhibits a high survival rate in artificial gastroenteric fluid and bile salt environments, along with an antagonistic effect against E. coli O111:K58 (B4), Staphylococcus aureus (S. aureus), and E. coli K99. Multiple genes with probiotic properties, including bacteriostasis, anti-inflammation, antioxidant, CAZyme, and the utilization of carbohydrate compounds, were identified in genome. L. agilis SNF7 prevented the gut barrier from being damaged by E. coli K99, reducing the clinical manifestations of the infection. Furthermore, L. agilis SNF7 reduced the expression of inflammatory cytokines (IL-6, IL-1β, and TNF-α) by inhibiting the phosphorylation of proteins linked to the NF-κB and MAPK signaling pathways. L. agilis SNF7 improved the intestinal microbial barrier, controlled the balance of the intestinal microecology, and reduced the entry of harmful microbes into the intestine. By controlling gut flora and reducing the inflammatory response, L. agilis SNF7 may be able to prevent and treat E. coli K99 infections. The application of L. agilis SNF7 in the creation of probiotic formulations to stop intestinal illnesses brought on by E. coli infections is clarified by this work.

1. Introduction

When administered in sufficient doses, probiotics have been established to be beneficial bacteria that are active in the body [1]. According to the reports, probiotics are crucial for enhancing health and preventing illness and bacterial overgrowth [2]. Through commensal microbes’ probiotic action, the gut microbiota plays a crucial role in preserving human intestinal homeostasis. Gut microbiota imbalance is linked to intestinal mucosal barrier damage and inflammation, or dysbiosis, which frequently affect host immunity [3,4].
In the intestines of both humans and animals, lactic acid bacteria (LAB) are a significant autochthonous microbiota [5]. They constitute key probiotics that are essential for young animals’ health in preventing infections, and the host does not establish an immune response to them in long-term co-evolution [6,7]. Additionally, isolated Lactobacillus strains were shown to exhibit an inhibitory impact against pathogenic organisms such as Salmonella Typhimurium and E. coli K88 in in vitro investigations [8]. Lactobacillus salivarius alleviated the inflammation response through reducing inflammation-related cytokines and displayed a potency in the enhancement of IPEC-J2 cell integrity [9]. Therefore, LAB have a high research value as probiotics. An essential first step in regulating the gut microbiota and overall health is the first colonization of bacteria in the human gut. One study examined the presence of LAB in newborns’ feces during the first week of life and discovered that Lactobacillus agilis (L. agilis) had colonized the neonatal gut [10]. Notably, numerous studies demonstrating L. agilis show strong probiotic characterization and immunomodulatory and anti-intestinal inflammatory properties [11,12,13]. L. agilis preventative and therapeutic benefits for diarrhea-causing pathogenic bacterial infections, however, have not been explored.
Escherichia coli (E. coli) is believed to be a normal part of the gut microbiota that inhabits both human and animal digestive tracts. However, the breeding business suffers significant financial losses when enteropathogenic Escherichia coli causes diarrhea in young animals, particularly calf and newborn piglets [14]. Diarrhea is caused by an E. coli infection, which modifies the integrity of tight junctions and causes intestinal dysfunction and inflammation [15]. Antibiotic-resistant bacteria are common in livestock worldwide as a result of antibiotic abuse, which also results in drug residues, a breakdown of intestinal flora, and other conditions [16]. Nowadays, infections brought on by pathogenic E. coli are commonly treated in clinics with antibiotics. Finding antibiotic substitutes in animal husbandry is therefore essential, and probiotics stand out among the other options as effective treatments for E. coli infections.
In the present study, one strain of L. agilis was isolated from calf feces and designated as L. agilis SNF7. We explored the probiotic properties and biological characteristics of the L. agilis SNF7 strain. Additionally, a mouse model was developed to examine how L. agilis SNF7 prevented diarrhea caused by E. coli K99. In order to theoretically support the microecological preparation to prevent E. coli-induced diarrhea, the purpose of this study is to assess the efficacy of L. agilis SNF7 in treating and preventing E. coli K99 in mice.

2. Results

2.1. Colony Morphology and Genetic Analysis

Figure 1b shows the colonies are smooth, spherical, and milky white. After Gram staining, the microbial cells from that one colony were identified as Gram-positive bacilli. Furthermore, SNF7 was found to be 99% identical to Lactobacillus agilis by gene sequencing analysis.

2.2. Acid, Bile Salt, Gastric Fluid, and Intestinal Fluid Tolerance

For six hours, L. agilis SNF7 was cultured at various pH values (2, 3, 4, 5, and 6) or with bile salt (0.1%, 0.3%, and 0.5%). Strong acid tolerance was demonstrated by the L. agilis SNF7 strain (pH = 3; Figure 1c). The survival rate of L. agilis SNF7 reached 65.51%. L. agilis SNF7, on the other hand, demonstrated remarkable resistance to bile salt, achieving a survival rate of 68.82% (Figure 1d). In this study, L. agilis SNF7’s survival rate was evaluated in the simulated gastric and intestinal juice during a 4 h incubation period at 37 °C. The survival rates of L. agilis SNF7 were 61.58% and 68.62% with gastric and intestinal juices, respectively (Figure 1e).

2.3. Antibacterial Activity

The obtained results reveal that L. agilis SNF7 has positive antibacterial activity against E. coli O111:K58 (B4), S. aureus, and E. coli K99, with inhibition circle diameters of 22.73 ± 0.6, 19.93 ± 0.35, and 20.80 ± 0.89 mm, respectively (Figure 1f).
Different pH values have an impact on L. agilis SNF7’s antibacterial activity. The inhibitory action against E. coli K99 was considerably reduced when the supernatant was brought to a neutral condition (pH 7). Using proteinase K in the L. agilis SNF7 supernatants did not affect the antibacterial activity of L. agilis SNF7. When catalase was added to the L. agilis SNF7 supernatants, the inhibitory activity against E. coli K99 was significantly reduced in the treated supernatants compared to the untreated ones (Figure 1g) (p < 0.05). In this case, the production of organic acids and hydrogen peroxide may be the source of the inhibitory effect.

2.4. Antibiotic Susceptibility

Further research on L. agilis SNF7 demonstrated how susceptible this lactic acid bacterium is to several antibiotics (Figure 1k). The strain was entirely vulnerable to penicillin G, ampicillin, tetracycline, cefatriaxone, clindamycin, erythromycin, and chloramphenicol, but only moderately resistant to ciprofloxacin, and the strain was strongly resistant to kanamycin.

2.5. Hemolytic Activity

In this investigation, L. agilis SNF7 showed negative hemolysis (non-beta hemolysis) (Figure 1h).

2.6. The Biological Characteristics of L. agilis SNF7

The growth and acid production curves of L. agilis SNF7 in MRS broth at 37 °C are shown in Figure 1i,j. After inoculation, L. agilis SNF7 had exponential phase growth 2–12 h later and stationary phase growth 14 h later. As a result, the culture supernatant’s pH decreased significantly after 4 h and stayed rather constant after 12 h.

2.7. General Genome Features of L. agilis SNF7

Table 1 showed the basic information on genome of L. agilis SNF7.The single circular chromosome of L. agilis SNF7 had a G + C% composition of 41.63% and measured 2,214,422 base pairs (bps). The average length of the 2156 genes that were found was 900.23 bp. There were 24 rRNAs and 91 tRNAs on the chromosome.

2.8. Genomic Predictive Function of L. agilis SNF7

A total of 1643 genes were annotated in the GO classification for L. agilis SNF7 (Figure 2a), which can be split into three main categories: molecular function (1051, 54.0%), cellular component (372, 22.6%), and biological process (220, 13.4%). The analysis revealed that catalytic activity, binding activity, and transporter activity were the top-three most-annotated L. agilis SNF7 in the molecular function (MF) category; the sections on cells, membranes, cell parts, and membrane sections in the cellular component (CC) and the biological process (BP) categories had the highest annotation levels, with the highest annotation levels being found in the metabolic process, cellular process, single-organism process, and single-organism process. The sections on metabolic process, cellular process, single-organism process, localization, and biological control are highly annotated under the biological process (BP) category.
A total of 1211 genes of L. agilis SNF7 were functionally annotated in the KEGG database (Figure 2b), distributed in 48 pathways corresponding to four key functions: metabolism, genetic information processing, environmental information processing, and cellular processes. The majority of these genes (700) were enriched in amino acid metabolic pathways (86), carbohydrate metabolism (58), and purine metabolism (49), suggesting that L. agilis SNF7 may be involved in a variety of nutrient catabolism and energy metabolism processes in the host intestine. Apart from the metabolic pathways, certain genes that were encoded were associated with genetic information processing (171), environmental information processing (132), and cellular processes (46) pathways. These results imply that L. agilis SNF7 possesses the ability to swiftly adapt to its surroundings and maintain its survival, as well as having the capacity to perceive outside cues and effectively move materials between its internal and external environments.
Furthermore, a large number of antimicrobials, anti-inflammatory, and immunoregulatory related genes and their pathway information in the KEGG database have been annotated by L. agilis SNF7, which is showed in Table 2. The genome of L. agilis SNF7 contains genes related to metabolic processes like antibiotics and biodegradation; it also contains genes related to immunity and inflammation that can regulate immunity and inflammation, and it contains genes that can regulate pathogenic bacterial infection. L. agilis SNF7 is known to harbor six genes linked to antibiotic metabolism, which are involved in the biosynthesis of neomycin, streptomycin, acarbose, and valinomycin; 154 genes linked to metabolic processes, such as the synthesis and degradation of compounds related to antibacterial and anti-inflammatory properties; and 18 genes linked to the regulation of colonization by both pathogenic and self-bacteria.
Based on the eggNOG annotation (Figure 2c), a total of 1854 genes (85.99%) were annotated in the L. agilis SNF7 bacterium. These genes were spread over 20 COG categories. These consisted of 244 genes annotated for lipid transport and metabolism; 143 genes for translation, ribosome structure, and biogenesis; 141 genes for amino acid transport and metabolism; and 139 genes for carbohydrate transport and metabolism. Furthermore, 277 genes did not correspond to any particular activities.
Figure 2d displays the results of the CAZy database annotation. For L. agilis SNF7, a total of 85 genes were annotated. The glycosyltransferase (GT) gene of L. agilis SNF7 had the highest annotation, accounting for 35.48% of the genes related to carbohydrates; the glycoside hydrolase (GH) gene, which ranked second in the number of annotations, annotated 30.1% of the genes related to carbohydrate metabolism; the sugar esterase (CE), which catalyzes the de-esterification of different carbohydrate substrates; the carbohydrate binding module (CBM), which accounted for 15.05% of the total annotation results; and the auxiliary enzyme gene (AA), which had the least amount of annotations. According to the aforementioned findings, L. agilis SNF7 mostly uses glycoside hydrolases and glycosyltransferase-producing pathways to carry out the metabolism of carbohydrates.
The genome of L. agilis SNF7 has no plasmid elements. A total of four CRISPR repeat sequences in the genome and 11 Cas genes of 10 Cas types were detected (Table 3).

2.9. Safety Prediction of L. agilis SNF7

Two antibiotic resistance genes in total were assigned to L. agilis SNF7 from the CARD database (Table 4). They are the aminoglycoside resistance gene APH (7″)-Ia (GE000051) and the macrolide resistance gene mefA (GE000947).

2.10. Effects of L. agilis SNF7 on the Physiological Indexes of E. coli K99-Induced Diarrhea Mice

With the exception of the CN and PE groups, all groups experienced a high rate of diarrhea on the seventh day of the experiment, according to the mice’s diarrhea rate (Figure 3a). On the fourteenth day, following the termination of E. coli K99, the NC group’s diarrhea rate reduced the slowest. On the seventh day of modeling, the mice in each group’s fecal index peaked (Figure 3b). Following antibiotic treatment, the mice’s fecal index dropped the most. In the meantime, the TE group’s fecal rate also dropped noticeably. Additionally, even though there were not many mice with diarrhea, the PE group’s animals experienced diarrhea on the fourteenth day following the cessation of L. agilis SNF7 intervention.
To find out how L. agilis SNF7 affected diarrhea, the mice’s body weights were measured. According to the findings, mice treated with E. coli K99 had significantly lower body weights than mice that were not infected (p < 0.05), and there was no discernible difference between the mice in the PE and CIP groups (p > 0.05; Figure 3c). Although there was no discernible difference between the CIP, TE, and PE groups after 15 days (p > 0.05), the mice in the NC group still had considerably lower body weights than those in the CN group (p > 0.05; Figure 3d). Following E. coli K99 administration, the spleen index manifested a significant enhancement (p > 0.05); the application of L. agilis SNF7 and treatment with ciprofloxacin effectively restored the condition to control levels (Figure 3e). E. coli K99 administration also decreased the liver index (p > 0.05), although prevention and treatment did not significantly restore these changes (Figure 3f). But, none of the groups exhibited significant changes in the intestinal index (p < 0.05; Figure 3g).

2.11. Effects of L. agilis SNF7 on Intestinal Physical Barriers of E. coli K99-Induced Diarrhea Mice

The experimental groups’ jejunum tissues stained with H&E showed clear structural changes (Figure 4a). The intestinal villi, which were made up of goblet cells and columnar epithelial cells, were quantitatively plentiful and the mucosal layer appeared structurally intact in the CK group. Compared with the CK group, the NC group exhibited significant damage. Following the administration of E. coli K99, certain intestinal villi were fragmented, mucosal epithelial cells exhibited hydropic degeneration, and the intestinal villous epithelium separated from the lamina propria. However, compared with the NC group, the intervention of L. agilis SNF7 and ciprofloxacin alleviated the morphological damage to the jejunal mucosa, decreased the number of intestinal villi epithelial cells, and decreased the degree of mucosal epithelial cell infiltration.
Following treatment with E. coli K99, each group’s animals showed a decrease in TJ protein and MUC2 expression levels (p < 0.05; Figure 4b–e). To varied degrees, the treatment of ciprofloxacin and L. agilis SNF7 reversed these decreases in the expression levels of claudin-1, occludin, ZO-1, and MUC2 (Figure 4f–i). Claudin-1, occludin, ZO-1, and MUC2 were all expressed at higher levels in the TE group than in the NC group, and claudin-1 was even more highly expressed than in the CK group (p < 0.05). In contrast to the NC group, the inhibition of L. agilis SNF7 only resulted in an increase in claudin-1 expression and did not substantially reverse the changes in occludin, ZO-1, and MUC2 expression. Similarly, the CIP group did not significantly restore the expression of occludin and claudin-1, although they did increase the expressions of ZO-1 and MUC2. In comparison to the animals in the PE group, the mice in the TE group exhibited an effectively enhanced barrier function overall.

2.12. Effects of L. agilis SNF7 on E. coli-Induced Inflammatory Factor Secretion in Mice Jejunum Tissues

The mRNA levels of IL-6, TNF-α, and IL-1β were clearly higher in mice treated with NC than in the CK group (p < 0.05; Figure 5a–c). Conversely, the TE and PE groups’ L. agilis SNF7 intervention decreased the levels of IL-6, TNF-α, and IL-1β in mice treated with E. coli K99 (p < 0.05), while the mRNA levels of IL-1β were higher than those in the CK group (p < 0.05). At the same time, ciprofloxacin intervention decreased IL-6, TNF-α, and IL-1β levels in mice treated with E. coli K99 (p < 0.05); however, TNF-α mRNA levels were higher than those in the CK group (p < 0.05).
ELISA was used to identify the release of inflammatory factors IL-6, TNF-α, and IL-1β in the jejunum tissues of mice infected with E. coli K99 (Figure 5d–f). The NC group had considerably higher levels of IL-6, TNF-α, and IL-1β than the CK group (p < 0.05). In comparison to the NC group, the CIP, TE, and PE groups had significantly lower levels of inflammatory factors (IL-6, TNF-α, and IL-1β) (p < 0.05).

2.13. Effect of L. agilis SNF7 on NF-κB and MAPK Signaling Pathways in E. coli K99-Induced Diarrhea Mice

The ratios of p-IκB/IκB, p-p65/p65, p-p38/p38, p-JNK/JNK, and p-ERK/ERK were significantly increased in the NC group (p < 0.05) in comparison to the mice in the CK group. In contrast to the NC group, the CIP, TE, and PE groups displayed significantly lower ratios of p-p-IκB/IκB, p-p65/p65, p-p38/p38, p-JNK/JNK, and p-ERK/ERK (Figure 6).

2.14. Modulation Effect of L. agilis SNF7 on the Gut Microbiota in E. coli K99-Induced Diarrhea Mice

With 286 overlapping microorganisms found among the five groups, the Venn diagram graphically represents the overlay of OTUs among groups, as seen in Figure 7a. The OTUs in the TE and PE groups were more prevalent than those in the NC and CIP groups. Comparative analysis of the α-diversity of the microbial communities in the three groups revealed that the NC and CIP groups had significant suppressions in their richness and diversity, while the L. agilis SNF7 group improved these parameters (Figure 7b). Distinct clustering separations between the CK, NC, and CIP groups were shown by the findings of Principal Coordinate Analysis (PCoA) and Non-metric Multidimensional Scaling (NMDS) (Figure 7c,d), indicating different gut microbiota topologies.
We then looked into the changes in gut microbiota compositions brought on by the administration of L. agilis SNF7 and E. coli K99. Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, and Verrucomicrobia are the most prevalent phyla (Figure 8a,b). At the phylum level, Bacteroidetes and TM7 showed a considerable decline, while Verrucomicrobia and Proteobacteria showed a sharp increase in the NC group relative to the healthy group. The L. agilis SNF7 significantly decreased the relative abundance of Proteobacteria and Verrucomicrobia in contrast to the NC group, while increasing the relative abundance of Bacteroidetes and TM7 (Figure 8c,d). At the genus level, the abundances of Lactobacillus and Adlercreutzia in NC were lower than in the CK group, the phenomenon partly reversed by the TE and PE groups (Figure 8e,j). Lactobacillus and Allobaculum were undetectable in the CIP group (Figure 8e,g). No substantial difference in the majority of genus (such as Lactobacillus, Akkermansia, Oscillospira, Allobaculum, and Ruminococcus) among the TE, PE and CK groups was observed; however, Desulfovibrio was higher in the PE group compared to the CK group (Figure 8i), and Prevotella was lower in the PE group compared to the CK group (Figure 8k).

3. Discussion

The gut microbiota, the most intricate and physiologically varied microbial community in the host, has progressively acquired vital functions as a result of co-evolution with the host over thousands of years, thus playing a key role in preserving the health of the host [17,18,19]. Symbiotic microorganisms in the intestinal microbiota resist the colonization of pathogenic microorganisms in the intestinal tract, through the synthesis of bacteriostatic substances, competition for nutrients, and the seizure of adherence sites, thereby preventing the occurrence of intestinal diseases caused by pathogenic bacterial infections [20,21,22,23]. In this study, we evaluated the potential probiotic properties and performed a genome-wide analysis of L. agilis SNF7 isolated from the feces of healthy calves. Furthermore, our investigation revealed that L. agilis SNF7 has the ability to alleviate diarrhea caused by E. coli.
To evaluate a possible probiotic candidate, it is necessary to consider a strain’s capacity to inhibit the growth of infections, tolerance to the gastrointestinal environment, ability to multiply rapidly, and harmlessness to the host. The culture supernatant of L. agilis SNF7 exhibited strong bacteriostatic activity against E. coli O111:K58 (B4), S. aureus, and E. coli K99 in vitro, which may be attributed to the secretion of organic acids and hydrogen peroxide by L. agilis SNF7. This characteristic might provide the chosen probiotic strains the edge over their rivals in the host gut. The survival of probiotic bacteria through the gastrointestinal tract is crucial to exert a positive effect when administered to animals. Some strains of LAB, including Lactobacilli and Lactococcus, have high survival rates in gastrointestinal conditions [24,25]. Likewise, L. agilis SNF7 remained viable in extremely acidic or bile salt concentration conditions; it was able to withstand up to 61.58% and 68.62% in artificial gastric and intestinal fluids, respectively. Additionally, in suitable conditions, L. agilis SNF7 can rapidly reach a logarithmic growth period for reproduction and cause a rapid decrease in environmental pH to inhibit the growth of pathogenic microorganisms. Hemolysis and antimicrobial susceptibility are two crucial indicators in the probiotics’ harmlessness evaluation [26]. Not only is L. agilis SNF7 susceptible to a broad spectrum of antibiotics, but also it is not hemolytic, fulfilling one of the criteria used to select probiotic bacteria. L. agilis SNF7 presented antibiotic resistance to kanamycin, which might be an advantage considering a joint use for probiotic therapy in the future. Given these in vitro characteristics from our investigation, which aligns with the criteria used in previous studies to assess potential probiotic candidates [27,28], we believe that L. agilis SNF7 represents a viable substitute for antibiotics in the clinical treatment of E. coli line diarrhea.
A thorough assessment of the strain is necessary before an isolated probiotic for use in veterinary production, and this assessment is based on the complete genome sequence. Probiotics have unique health advantages, and whole genome sequencing is useful for a deeper investigation of the protective mechanisms of various strains. Based on the whole genome sequence of L. agilis SNF7, we discovered that L. agilis SNF7 has a strong capacity for utilizing carbohydrates, which serves as a foundation for the strain’s ability to survive in a variety of conditions. Furthermore, genes linked to antibacterial substance production have been discovered in L. agilis SNF7, which may prevent the growth of pathogenic microbes or even kill them. In addition to bacteriostatic substances, L. agilis SNF7 also contains genes encoding a variety of metabolites, including ascorbic acid, terpenoids, nicotinic acid and nicotinamide, secondary bile acids, taurine and hypotaurine, etc. Nicotinamide, in particular, is the primary precursor of nicotinamide adenine dinucleotide (NAD+), which activates Sirtuin 1 (SIRT1), a protein that inhibits the NF-κB signaling pathway and reduces the release of inflammatory factors [29,30]. In the intestinal tract, secondary bile acids possess antibacterial properties that can prevent the growth of pathogenic microorganisms and preserve the equilibrium of gut flora [31], which is consistent with our earlier findings about the antibacterial activity of L. agilis SNF7 in vitro. In a word, L. agilis SNF7 exhibits potent antibacterial, antioxidant, anti-inflammatory, and immunomodulatory properties by the production of the aforementioned many metabolites. Apart from metabolite synthesis, 18 bacterial chemotaxis-related genes were annotated in the L. agilis SNF7 genome. L. agilis SNF7 has an advantage in gut colonization due to its motility and chemotaxis. While bacterial chemotaxis does not possess an antibacterial property, it may impact the localization and survival of bacteria within the host by controlling bacterial movement and distribution, thereby resisting the pathogenic microbial colonization of the host [32,33]. Lactic acid bacteria have been shown to interact with host cell sugar molecules by expressing certain surface proteins that improve their adherence [23]. Through a mechanism of competitive exclusion, this adhesion not only aids in the colonization of lactobacilli in the intestine, but also inhibits the adherence of harmful bacteria. Although L. agilis SNF7’s adhesion capabilities were not assessed in our work, it is possible that it may adhere to host cells efficiently based on the examination of its genomic sequence. L. agilis SNF7 may be able to colonize the intestine and contribute to the prevention of infection and pathogen adherence thanks to this adhesion ability. The discovery of the CRISPR-Cas system in the genome of L. agilis SNF7 implies that the host genome’s immunological self-defense systems can defend against intrusive foreign substances [34]. The CARD database, an integrated database of genes linked to antibiotic resistance, is a valuable resource for researching antibiotic resistance in human, animal, and environmental flora, as well as for deciphering the mechanisms underlying antibiotic resistance [35]. The CARD database predicted the aminoglycoside resistance gene APH (7″)-Ia and the macrolide resistance gene mefA in the L. agilis SNF7 genome. Additionally, L. agilis SNF7 exhibits resistance to aminoglycosides and macrolides via antibiotic inactivation and antibiotic efflux pumps, respectively. A possible advantage for L. agilis SNF7’s use in the probiotic industry is that its genome-wide content of resistance genes is generally low. Additionally, the existence of these two resistance genes opens the door to the possibility of using L. agilis SNF7 when combined with antibiotics.
E. coli is the main cause of diarrhea in newborn animals, resulting in dehydration, diarrhea, and even death in affected animals. Antibiotic overuse in the treatment of E. coli-induced diarrhea results in drug residues and the emergence of pathogen resistance. According to a study, E. coli isolates from Spain’s diarrhea samples were resistant to over four different antibiotics [36]. Diarrheagenic Escherichia coli showed 38% resistance to 10 antibiotics in Hohhot, China [37]. Because of their potential to help avoid harmful infections, probiotics have attracted a lot of interest. Lactic acid bacteria can be given to calves at an early age of their growth to help with feed efficiency, daily weight gain, and diarrhea incidence [38]. The intestinal damage and diarrhea brought on by E. coli K99 were considerably reduced by multispecies probiotics (Saccharomyces cerevisiae, Lactobacillus acidophilus S5, and Bacillus subtilis) [38]. Therefore, in order to investigate the protective effects of L. agilis SNF7 and clarify its mechanism of action, our study created an E. coli K99-infected mouse model. After a week of gavage with E. coli K99, the experimental group of mice showed symptoms such as diarrhea, weight loss, liver shrinkage, and splenomegaly, demonstrating that the E. coli K99 infection model was successfully established compared to the control group. The diarrhea, weight loss, and organ index abnormality values were all reduced in mice in the TE and PE groups that received L. agilis SNF7 supplements. Further evidence of L. agilis SNF7’s effectiveness in reducing infection symptoms in mice was provided by the decline in the fecal score. These findings are consistent with Wang et al.’s study, which found that Lactobacillus casei LC2W increased food intake and significantly decreased the rates of diarrhea and weight loss in infected mice [39].
The intestinal barrier is an essential component of the body that is responsible for both digestion and nutrition absorption. It also serves as the body’s first line of defense against external pathogens [40]. The intestinal epithelial microvilli and mucosal lining were damaged in our study, indicating that E. coli K99 compromised the integrity of the colon barrier in mice. On the other hand, L. agilis SNF7-treated mice demonstrated considerably improved colon tissue pathology, less severe inflammatory infiltration, better-preserved intestinal epithelial structures, and reduced intestinal damage, supporting the findings of Wu et al. [41]. Maintaining the integrity of the intestinal barrier depends on tight junctions (TJs), a type of intercellular connection made up of structural proteins, such Claudin, occludin, Zos, and so on [39]. Infection with E. coli K99 markedly decreased ZO-1, occludin, and Claudin-1 expression. On the other hand, treatment with L. agilis SNF7 successfully reversed these alterations. This is consistent with previous studies that revealed Lactobacillus salivarius can counteract the colon’s decreased TJ protein expression [42]. Mucin is secreted by goblet cells in the intestinal tissues. When mucin is absent, pathogenic microbes can directly contact the intestinal epithelial cells in the organism, which can result in intestinal inflammation brought on by bacterial infections [43]. Our experiment revealed that the supplementation of mice with L. agilis SNF7 prevented an E. coli K99-induced decrease in MUC2 expression. Consistent with our findings, the intervention of Lactobacillus paracasei might promote the number of goblet cells and MUC2 expression in the intestine, hence maintaining the integrity of the colonic mucosal layer [44]. Thus, we postulated that, by upregulating the expression of tight junction proteins and mucins, L. agilis SNF7 may enhance the integrity of the mouse intestinal barrier against pathogenic bacterial infection.
Proinflammatory cytokines play an important role in the development of intestinal inflammatory diseases caused by pathogenic microorganisms [45]. Consistent with our results, E. coli invasion of the organism can result in an increased expression of pro-inflammatory cytokines in animal tissues, including IL-1β, IL-6, and TNF-α [46]. Notably, the treatment with L. agilis SNF7 prevented these elevations in the concentrations of IL-1β, IL-6, and TNF-α in the colon tissue. The findings show that the number of cytokines produced by the intestinal epithelial cells after infection with ETEC is significantly reduced when Lactobacillus plantarum was pretreated [47]. The NF-κB signaling pathway, which is one of the most-studied signaling pathways in inflammatory responses, regulates the immune response by modulating gene expression involved in immune and inflammatory responses [48]. As a crucial signal transduction pathway in the cytoplasm, the MAPK signaling pathway is involved in many different cellular processes, including immune defenses, apoptotic responses, cellular inflammation, and stress, which is especially crucial for epithelial cellular immunity and plays a key role in controlling inflammatory processes [49]. In this study, the activation of the NF-κB and MAPK signaling pathways was observed in the mouse intestinal tissues infected with E. coli K99. However, the activation of the NF-κB and MAPK signaling pathways was inhibited by L. agilis SNF7 intervention. Similarly, by attenuating the phosphorylation of p38 MAPK and blocking the NF-κB signaling pathways, Lactobacillus salivarius lowers the expression of cytokines linked to inflammation [50]. Lactobacillus plantarum inhibits the activation of NF-κB and p38 MAPK signaling pathways through unique metabolites, hence reducing the production of pro-inflammatory cytokines [9]. Our comprehensive understanding of L. agilis SNF7’s antidiarrheal actions can be further enhanced by considering the possibility that the NF-κB and MAPKs signaling pathways are one of the molecular protective mechanisms that shield mice from E. coli K99-induced diarrhea.
Given the diverse and critical role of the gut microbiota in animal health, disruptions in microbial composition may have far-reaching detrimental consequences on the body’s immune system, leading to the development of different chronic inflammatory disorders [51]. The use of antibiotics may therefore worsen the dysbiosis of the gut microbiota, increasing the quantity of pathogenic bacteria that can cause a range of dangerous bacterial infections in humans and animals, ultimately resulting in the development of illnesses [52,53]. Probiotics can protect the host by altering the makeup and metabolism of the intestinal flora by preventing the growth and reproduction of pathogenic microorganisms in the gut [54]. In this investigation, we discovered that L. agilis SNF7 effectively prevented the E. coli K99 infection-induced reduction in microbial diversity in the mice’s gut microbiota. However, the general similarity between the microbial community structure of the mouse cecum and that of the control group was significantly altered by ciprofloxacin therapy. Changes in the quantity of specific bacteria within the intestinal microbial community frequently result in modifications to the organism’s health condition. For instance, the abundance of Actinobacteriota, Bacteroides, and Proteobacteria is a key indicator of the health of the human gut microbiota [55,56,57]. At the phylum level, a decrease in the relative abundance of the Actinobacteriota and Bacteroides and an increase in the relative abundance of the Brevibacteria phylum was observed following E. coli K99 infection, while L. agilis SNF7 administration prevented these modifications. L. agilis SNF7 also raised the relative abundance of Lactobacillus and Adlercreutzia. Notably, ciprofloxacin treatment led to highly significant decreases in the abundance of numerous beneficial intestinal bacteria. These observations align with the findings of Ran et al. Enterococcus faecalis protects against Salmonella infection by adjusting the abundance of gut microorganisms and their metabolic pathways [58]. The results show that L. johnsonii, L. plantarum, and L. rhamnosus elevate the relative abundance of gut microorganisms in the intestine of EHEC-infected mice [59].
According to our findings, L. agilis SNF7 is a probiotic that shows promise in the treatment and prevention of E. coli-induced diarrhea. However, more research is still needed to fully understand L. agilis SNF7’s long-term stability and colonization capacity in vivo. Furthermore, it is urgently necessary to investigate whether L. agilis SNF7 plays a role in transferring antibiotic resistance to other microorganisms in the microbiota.

4. Materials and Methods

4.1. Isolation and Identification of Probiotics in Calf Feces

The fecal samples were serially diluted and inoculated with De Man Rogosa and Sharpe agar (MRS; AOBOX, Beijing, China) after being resuspended in 9 mL of saline solution (0.9% [w/v] NaCl). Colonies were streaked on MRS agar plates based on morphological differences after 48 h at 37 °C. This process was repeated two or three times until a single pure colony of the same form was achieved. All bacterial isolates were categorized using Gram staining and microscopic analysis.
Following the manufacturer’s instructions, a DNA extraction kit (TransGen Biotech, Beijing, China) was used to extract the bacteria’s DNA, and a Nanodrop instrument (Nanodrop 2000 Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the concentration. The 16S rRNA gene was amplified from the strain’s genomic DNA using the universal primers 27F (5′-AGA GTT TGA TCC TGG CTC AG-3′) and 1492R (5′-CTA CGG CTA CCT TGT TAC GA-3′) in a polymerase chain reaction (PCR). The thermal cycling settings were 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 55 °C for 45 s, elongation at 72 °C for 90 s, and thermal retardation at 72 °C for 10 min. Additionally, Sangon Biotech Company (Shanghai, China) sequenced the PCR products, and the NCBI website’s nucleotide BLAST was used for analysis.

4.2. Strain Survival in the In Vitro-Simulated Gastrointestinal Conditions

We evaluated the probiotic bacteria’s ability to survive in vitro-mimicked gastrointestinal conditions. After being in MRS broth for 24 h at 37 °C, the bacterial isolates were centrifuged (4000× g/10 min). When the final cell count reached 108 CFU/mL, the resultant pellet was resuspended in MRS broth after being cleaned with phosphate buffered saline (PBS) buffer (20 mM, pH 7.2). Simulated intestinal fluid (the MRS broth added with 1 mg/mL of trypsin and pH 8.0), simulated gastric fluid (the MRS broth supplied with 1 mg/mL of pepsin and pH 3.0), and bile salt solution were all administered to the bacteria. The MRS broth served as a control for the bacteria. In short, 4750 μL of MRS broth and 250 μL of cell resuspension solution were mixed, and the mixture was incubated for 4 h at 37 °C. Following the measurement of the culture’s optical density at a 600 nm wavelength (OD600) using a spectrophotometer (DeNovix, Wilmington, DE, USA), survival rates (SRs) were calculated as follows:
SR = At/Ac × 100%
where Ac stands for the control group’s OD600 at 4 h and At for the treatment group’s OD600 at 4 h.

4.3. Antibacterial Activity of Probiotic Cell-Free Supernatant

The antibacterial properties of the bacterial strains obtained here were assessed using the well diffusion method. Staphylococcus aureus (CVCC186158), Escherichia coli K99 strain isolated from a calf’s diarrheal feces, and Escherichia coli O111:K58(B4) (CVCC1450) were used to measure the antibacterial activity. After being in MRS broth for 24 h at 37 °C, the bacterial isolates were centrifuged (12,000× g/10 min). After that, 200 µL of the supernatant was placed in wells with a diameter of 6 mm on a Mueller–Hinton (MHA) agar plate that had been pre-inoculated with the pathogen bacteria (100 µL, 106 CFU/mL). The control was sterile MRS broth. For 12 h, the inoculated MHA plates were kept in an incubator that was adjusted to 37 °C. The wells’ surrounding zone of inhibition diameters (mm) were measured.

4.4. Propertiy of Antibacterial Compounds Produced by the Probiotics Isolates

We determined whether the production of acid or the synthesis of bacteriocin was responsible for the antibacterial activity. To remove any possible acidic effects, 1 mol/mL of NaOH was used to bring the supernatant’s pH down to 7.0. Following a one-hour incubation period at 37 °C, the supernatant was subsequently treated separately with proteinase K (30 U/mg, 5 mg/mL) and catalase (5220 U/mg, 1 mg/mL). The well diffusion testing method was used to evaluate the supernatant’s efficacy against harmful microorganisms. The experiment’s control was the supernatant that had not been treated with any enzymes.

4.5. Antibiotic Susceptibility of the Probiotic Isolates

Antimicrobial susceptibilities of the isolated and identified bacterial against different antibiotics, including penicillin G (10 Units), ampicillin (10 μg), tetracycline (30 μg), cefatriaxone (30 µg), erythromycin (15 µg), clindamycin (2 μg), ciprofloxacin (5 μg), kanamycin (30 µg), and chloramphenicol (30 µg) were tested by the Kirby–Bauer Disc-Diffusion method according to the recommendation of the Clinical and Laboratory Standards Institute. The bacterial suspension, at 109 CFU/mL, was inoculated by swabbing on MRS agar. After drying, the standard antibiotic discs were placed on the surface of the agar. After incubation, the antibiotic susceptibilities of probiotic isolates were determined according to the values of inhibition zones. Antibiotic sensitivity was categorized as R, IR, or S. The inhibition zones were measured in millimeters, with zones larger than 20 mm considered sensitive and zones smaller than 14 mm considered resistant.

4.6. Hemolytic Activity of the Probiotic Isolates

Using a blood agar media, the lysis of sheep red blood cells by bacteria was examined. Spots on trypticase soy agar containing 5% (v/v) defibrinated sheep blood were used to inoculate the isolated organisms. A clean zone surrounding the colonies was then inspected after the plates had been incubated for 24 h at 37 °C. Positive hemolytic activity was defined as the development of a clear or semitransparent zone surrounding the site.

4.7. Growth and Acid Production Curves of the Probiotic Isolates

The bacterial isolates were subjected to MRS broth at 37 °C for 24 h. A spectrophotometer (DeNovix, USA) was then used to measure the OD600 values every two hours for 24 h after the suspension had been cultured in MRS broth (1%, v/v) at 37 °C. A FiveEasy standard pH meter (Mettler Toledo, Columbus, OH, USA) was used to monitor the bacterial culture’s pH every two hours until it was twenty-four hours along. The average value from three consecutive samples was used to plot the strain’s growth and acid production curves.

4.8. Genome Sequencing, Assembly, and Bioinformatic Analyses

Following the manufacturer’s instructions, genomic DNA was extracted using the EasyPure® Bacteria Genomic DNA Kit (TransGen Biotech, Beijing, China). A Nanodrop ND2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) was used to assess the concentration and purity of the collected DNA. Following the usual procedure supplied by Oxford Nanopore Technologies (ONT), the library was created using the SQK-LSK109 ligation kit (Oxford Nanopore Technologies, Oxford, UK) and measured using a Qubit fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Whole genome sequencing was carried out using the Ion PromethION48 System.
Canu v1.5 software was used to assemble the acquired reads for genome assembly, and circlator v1.5.5 was then used to cycle the assembly genome. Prodigal v2.6.3 was used for coding gene prediction in order to predict genomic components. Infernal v1.1.3 was used to predict ribosome RNA (rRNA) genes, whereas tRNAscan-SE v2.0 was used to predict transfer RNA (tRNA) genes. RepeatMasker was used to predict repetitive sequences. Using AntiSMASH v5.0.0, secondary metabolic gene clusters were predicted.
The predicted proteins were blasted (e-value: 1 × 10−5) against KEGG and eggNOG for functional annotations. The GO annotation was performed using Blast2go v2.5. Additionally, by blasting against the CAZy, TCDB, CARD, and PHI databases, the pathogenicity and drug resistance could be investigated.

4.9. Animal Experiments

Since Kunming mice have a comparatively robust immune system and are well-adaptable to lab settings, we decided to utilize them to create a diarrhea model. From Specific Pathogen Free (SPF) Biotechnology Co. (Beijing, China), thirty Kunming mice (15 males and 15 females; weight: 28–32 g; age: 4–6 weeks old) were acquired. The mice were kept at 20 °C ± 2 °C with a 12 h light and 12 h dark cycle, kept at 45% ± 10% humidity, and provided unlimited access to sterile food and water while being grown in a pathogen-free environment. Three mice were housed in each cage according to uniform sex and in the same group. The mice were randomly divided into five groups (n = 6; 3 males and 3 females) following a week of acclimatization.
Prior to the experiment, L. agilis SNF7 was static cultured for 24 h in a centrifuge tube with 10 milliliters of MRS broth medium. To keep out outside oxygen throughout the incubation time, the centrifuge tube was sealed with a sealing film. E. coli was inoculated with suspension culture in a centrifuge tube with 10 mL of LB broth medium for 12 h (220 r/min). It is important to note that, prior to gavage, the concentration of bacteria extracted from the medium was adjusted using saline. E. coli and L. agilis SNF7 concentrations were adjusted to 1 × 108 CFU/mL and 1 × 109 CFU/mL, respectively.
The following treatments were administered to the mice in several groups: The control group (CK) received NS orally from days 1 through 14. The mice in the model group (NC) received 0.2 mL of 1 × 108 CFU/mL E. coli K99 from days 1 through 7 and 0.9% physiological saline (NS) orally from days 8 through 14. On days 1 through 7, the mice in the ciprofloxacin treatment group (CIP) received 0.2 mL of 1 × 108 CFU/mL E. coli K99, and on days 8 through 14, they were administered 65 mg/kg of ciprofloxacin orally. On days 1 through 7, the mice in the treatment group (TE) received 0.2 mL of 1 × 108 CFU/mL E. coli K99, and on days 8 through 14, they received 0.2 mL of 1 × 109 CFU/m L. agilis SNF7 orally. The mice in the preventive group (PE) received 0.2 mL of L. agilis SNF7 (1 × 109 CFU/mL) on days 1 through 7 and 0.2 mL of E. coli K99 (1 × 108 16S rRNA Analysi) orally on days 8 through 14 (Figure 1a).
Days 0, 2, 4, 6, 8, 10, 12, and 14 were used to measure the mice’s body weight. Days 0, 3, 7, 11, and 14 were used to count the number of mice in each group who had diarrhea. Diarrhea rate was estimated as diarrhea mice/total mice in each group times 100%. After administering the serum, the small intestine and cecum contents of each mouse were collected and stored at −80 °C; they were slaughtered on day 15 after blood collection. The livers and spleen were then weighed.

4.10. Pathological Analysis

The tissue samples from the jejunum were preserved in a 4% paraformaldehyde fix solution. The intestinal tissues that were fixed were then prepared, cut, and embedded in paraffin. Sections that were 5 μm thick were dewaxed by immersing them in xylene and ethanol after being baked for one hour at 60 °C. Hematoxylin and eosin (HE) staining was applied to the sections. The sections of dyed tissue were examined closely using a light microscope (NIKON, Tokyo, Japan).

4.11. Immunohistochemical Analysis

In order to suppress endogenous peroxidase activity, a 3% hydrogen peroxide solution (Sinopharm, Beijing, China) was applied to the jejunum sections after they had undergone antigen repair for the immunohistochemical examination. After 30 min of room-temperature sealing with 3% BSA (Servicebio Technology, Wuhan, China), the tissues were incubated with a primary antibody for the entire night at 4 °C. The sections were examined under a microscope after being incubated with a secondary antibody and stained with hematoxylin and DAB (Servicebio Technology, Wuhan, China).

4.12. Enzyme-Linked Immunosorbent Assay

After weighing the jejunum tissue, precooled PBS (0.01 M, pH = 7.4) was added at a ratio of 1:9 (w/v) to create a 10% tissue homogenate. After centrifuging the homogenate for 10 min at 4 °C and 12,000 rpm, the supernatants were transferred into sterile tubes. ELISA kits (mlbio, Shanghai, China) were used to assess the levels of IL-1β, IL-6, and TNF-α. Other procedures were then carried out in accordance with the manufacturer’s instructions.

4.13. RNA Extraction and Quantitative Real-Time PCR

A NanoDrop device (Thermo Fisher Science, UK) was used to extract and quantitatively assess the total RNA of uterine tissue. cDNA synthesis was performed using the FastKing-RT SuperMix (Quanshijin, Beijing, China) kit. The SYBR Green qPCR Master Mix (Quanshijin, Beijing, China) was used to simplify the RT-qPCR using the CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). Using the instrument’s default melting curve acquisition software, the PCR amplification process involved predenaturing at 95 °C for 30 s, 95 °C for 10 s, 60 °C for 30 s, and 40 cycles. Sangon Biotech Co., Ltd. (Shanghai, China) produced the primers. The specific primers were IL-6 (5′-CTTCTTGGGACTGATGCTGGTGAC-3′; 5′-TCTGTTGGGAGTGGTATCCTCTGTG-3′), IL-1β (5′-CCTGGGCTGTCCTGATGAGAG-3′; 5′-TCCACGGGAAAGACACAGGTA-3′), TNF-α (5′-GGACTAGCCAGGAGGGAGAACAG-3′; 5′-CAATGTGTCCGTCGTGGATCT-3′), GAPDH (5′-CAATGTGTCCGTCGTGGATCT-3′; 5′-GTCCTCAGTGTAGCCCAAGATG-3′). Gene expression levels were normalized to the GADPH gene, employing the 2−∆∆Ct method.

4.14. 16S rRNA Analysis of the Contents of the Cecum

The V3–V4 region of the bacterial 16S rRNA gene was amplified after total genomic DNA was isolated from the colon content sample. Following purification, PCR products were labeled to facilitate the library assembly. The Illumina NovaSeq platform (Paisano Bio Ltd., Shanghai, China) was used to sequence the qualified libraries. Alpha diversity (Chao1 and Shannon indices) and beta diversity studies were performed after obtaining high-quality sequences.

4.15. Statistical Analysis

Standard error (SEM) or mean ± standard deviation (SD) was used to express the data. Using SPSS (V version 21.0), one-way analysis of variance (ANOVA) was used to assess significant differences (* p < 0.05, ** p < 0.01). GraphPad Prism 8.0 was used for the data’s graphical representation.

5. Conclusions

L. agilis SNF7 showed bacteriostatic ability against three pathogenic strains of E. coli, S. aureus, and E. coli K99 in vitro. It also demonstrated good tolerance to the gastrointestinal environment, sensitivity to the majority of antibiotics without hemolysis, good growth and reproduction properties, and the ability to produce acid. Genome analysis results indicate that L. agilis SNF7 shows the ability to utilize carbohydrates, amino acids, and glycosyltransferase function. Notably, the L. agilis SNF7 genome also has a large number of pathway genes linked to immunomodulation, anti-inflammation, bacteriostasis, and antioxidants. In addition, the L. agilis SNF7 strain showed a low genome-wide content of drug resistance genes. These characteristics make it a good candidate for probiotic applications. Our research demonstrated the potential protective effects of L. agilis SNF7 against E. coli K99 infection in mice. L. agilis SNF7 prevented the E. coli K99-induced weakening of the gut barrier and preserved the abundance of beneficial microbes. Moreover, it inhibited the increase in the concentration of pro-inflammatory cytokines by inhibiting the activation of the NF-κB and MAPKs signaling pathways. These insights underscore the potential of L. agilis SNF7 as a novel therapeutic agent in preventing and treating infections induced by E. coli K99.

Author Contributions

Conceptualization, J.C. and M.L.; Data curation, M.F. and J.S.; Formal analysis, M.R., D.S. and X.L.; Funding acquisition, M.L.; Methodology, M.F., J.C. and M.L.; Project administration, J.C. and M.L.; Software, Y.S.; Supervision, J.C.; Validation, J.T., X.W. and T.J.; Writing—original draft, M.F.; Writing—review and editing, M.F. and Q.X. All authors will be updated at each stage of manuscript processing, including submission, revision, and revision reminder, via emails from our system or the assigned Assistant Editor. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (NSFC) (Grant NO. 31902328) and the General Program of National Natural Science Foundation of China (Grant NO. 32373077).

Institutional Review Board Statement

The animal study was reviewed and approved by The Institutional Animal Experimental Ethical Inspection Form of Hebei Agricultural University, Baoding, China (protocol code 2024036) on 28 February 2024.

Data Availability Statement

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. The international scientific association for probiotics and prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014, 11, 506–514. [Google Scholar] [CrossRef] [PubMed]
  2. Marchesi, J.R.; Adams, D.H.; Fava, F.; Hermes, G.D.A.; Hirschfield, G.M.; Hold, G.; Quraishi, M.N.; Kinross, J.; Smidt, H.; Tuohy, K.M.; et al. The gut microbiota and host health: A new clinical frontier. Gut 2016, 65, 330–339. [Google Scholar] [CrossRef] [PubMed]
  3. Zhu, H.; Cao, C.; Wu, Z.; Zhang, H.; Sun, Z.; Wang, M.; Xu, H.; Zhao, Z.; Wang, Y.; Pei1, G.; et al. The probiotic L. casei Zhang slows the progression of acute and chronic kidney disease. Cell Metab. 2021, 33, 1926–1942. [Google Scholar] [CrossRef] [PubMed]
  4. Lynch, S.V.; Pedersen, O. The human intestinal microbiome in health and disease. N. Engl. J. Med. 2016, 375, 2369–2379. [Google Scholar] [CrossRef] [PubMed]
  5. Ni, X. Application progress of autochthonous microbiota in broiler feed. Feed Ind. 2021, 42, 1–4. [Google Scholar] [CrossRef]
  6. Duranti, S.; Lugli, G.A.; Milani, C.; James, K.; Mancabelli, L.; Turroni, F.; Alessandri, G.; Mangifesta, M.; Mancino, W.; Ossiprandi, M.C.; et al. Bifidobacterium bifidum and the infant gut microbiota: An intriguing case of microbe-host co-evolution. Environ. Microbiol. 2019, 21, 3683–3695. [Google Scholar] [CrossRef]
  7. O’Callaghan, A.; Sinderen, D. Bifidobacteria and their role as members of the human gut microbiota. Front. Microbiol. 2016, 7, 925. [Google Scholar] [CrossRef] [PubMed]
  8. Fan, P.; Kim, M.; Liu, G.; Zhai, Y.; Liu, T.; Driver, J.D.; Jeong, K.C. The gut microbiota of newborn calves and influence of potential probiotics on reducing diarrheic disease by inhibition of pathogen colonization. Front. Microbiol. 2021, 12, 772863. [Google Scholar] [CrossRef]
  9. Qiao, J.; Sun, Z.; Liang, D.; Li, H. Lactobacillus salivarius alleviates inflammation via NF-κB signaling in ETEC K88-induced IPEC-J2 cells. J. Anim. Sci. Biotechnol. 2020, 11, 76. [Google Scholar] [CrossRef] [PubMed]
  10. Al-Balawi, M.; Morsy, F.M. Enterococcus faecalis is a better competitor than other Lactic acid bacteria in the initial colonization of colon of healthy newborn babies at first week of their life. Front. Microbiol. 2020, 29, 2017. [Google Scholar] [CrossRef]
  11. Chen, L.; Bai, X.; Wang, T.; Liu, J.; Miao, X.; Zeng, B.; Li, D. Gut microbial diversity analysis of different native chickens and screening of chicken-derived probiotics. Animals 2023, 13, 3672. [Google Scholar] [CrossRef] [PubMed]
  12. Khan, A.N.; Yasmin, H.; Ghazanfar, S.; Hassan, M.N.; Keyani, R.; Khan, I.; Gohar, M.; Shahzad, A.; Hashim, M.J.; Ahmad, A. Antagonistic, Anti-oxidant, anti-inflammatory and anti-diabetic probiotic potential of Lactobacillus agilis isolated from the rhizosphere of the medicinal plants. Saudi J. Biol. Sci. 2021, 28, 6069–6076. [Google Scholar] [CrossRef]
  13. Chen, Y.M.; Limaye, A.; Chang, H.W.; Liu, J.R. Screening of Lactic acid bacterial strains with antiviral activity against porcine epidemic diarrhea. Probiotics Antimicrob. Proteins 2022, 14, 546–559. [Google Scholar] [CrossRef]
  14. Eldesoukey, I.E.; Elmonir, W.; Alouffi, A.; Beleta, E.I.M.; Kelany, M.A.; Elnahriry, S.S.; Alghonaim, M.I.; al Zeyadi, Z.A.; Elaadli, H. Multidrug-resistant Enteropathogenic Escherichia coli isolated from diarrhoeic calves, milk, and workers in dairy farms: A potential public health risk. Antibiotics 2022, 11, 999. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, H.; Zhong, Z.; Luo, Y.; Cox, E.; Devriendt, B. Heat-Stable enterotoxins of enterotoxigenic Escherichia coli and Their impact on host immunity. Toxins 2019, 11, 24. [Google Scholar] [CrossRef] [PubMed]
  16. Jia, Z.; Chen, A.; Bao, F.; He, M.; Gao, S.; Xu, J.; Zhang, X.; Niu, P.; Wang, C. Effect of nisin on microbiomebrain-gut axis neurochemicals by Escherichia coli-induced diarrhea in mice. Microb. Pathog. 2018, 119, 65–71. [Google Scholar] [CrossRef]
  17. Hou, K.; Wu, Z.X.; Chen, X.Y.; Wang, J.Q.; Zhang, D.; Xiao, C.; Zhu, D.; Koya, J.B.; Wei, L.; Li, J.; et al. Microbiota in health and diseases. Signal Transduct. Target. Ther. 2022, 7, 135. [Google Scholar] [CrossRef] [PubMed]
  18. Shahab, M.; Shahab, N. Coevolution of the human host and gut microbiome: Metagenomics of microbiota. Curēus 2022, 14, e26310. [Google Scholar] [CrossRef]
  19. Adak, A.; Khan, M.R. An insight into gut microbiota and its functionalities. Cell. Mol. Life Sci. 2019, 76, 473–493. [Google Scholar] [CrossRef] [PubMed]
  20. Pickard, J.M.; Zeng, M.Y.; Caruso, R.; Núñez, G. Gut microbiota: Role in pathogen colonization, immune responses, and inflammatory disease. Immunol. Rev. 2017, 279, 70–89. [Google Scholar] [CrossRef]
  21. Ducarmon, Q.R.; Zwittink, R.D.; Hornung, B.V.H.; van Schaik, W.; Young, V.B.; Kuijper, E.J. Gut microbiota and colonization resistance against bacterial enteric infection. Microbiol. Mol. Biol. Rev. 2019, 83, e00007–e00019. [Google Scholar] [CrossRef] [PubMed]
  22. Stevens, E.J.; Bates, K.A.; King, K.C. Host microbiota can facilitate pathogen infection. PLoS Pathog. 2021, 17, e1009514. [Google Scholar] [CrossRef] [PubMed]
  23. Yadav, A.K.; Tyagi, A.; Kumar, A.; Panwar, S.; Grover, S.; Saklani, A.C.; Hemalatha, R.; Batish, V.K. Adhesion of Lactobacilli and their anti-infectivity potential. Crit. Rev. Food Sci. Nutr. 2017, 57, 2042–2056. [Google Scholar] [CrossRef] [PubMed]
  24. Naissinger da Silva, M.; Tagliapietra, B.L.; Flores, V.D.A. Pereira dos santos richards NS. In vitro test to evaluate survival in the gastrointestinal tract of commercial probiotics. Curr. Res. Food Sci. 2021, 4, 320–325. [Google Scholar] [CrossRef]
  25. Stasiak-Różańska, L.; Berthold-Pluta, A.; Pluta, A.S.; Dasiewicz, K.; Garbowska, M. Effect of simulated gastrointestinal tract conditions on survivability of probiotic bacteria present in commercial preparations. Int. J. Environ. Res. Public Health 2021, 18, 1108. [Google Scholar] [CrossRef] [PubMed]
  26. Reuben, R.C.; Roy, P.C.; Sarkar, S.L.; Alam, R.U.; Jahid, I.K. Isolation, characterization, and assessment of lactic acid bacteria toward their selection as poultry probiotics. BMC Microbiol. 2019, 19, 253. [Google Scholar] [CrossRef] [PubMed]
  27. Sanders, M.E.; Merenstein, D.J.; Reid, G.; Gibson, G.R.; Rastall, R.A. Probiotics and prebiotics in intestinal health and disease: From biology to the clinic. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 642. [Google Scholar] [CrossRef]
  28. Gupta, M.; Raut, R.; Manandhar, S.; Chaudhary, A.; Shrestha, U.; Dangol, S.G.C.S.; BudhaK, R.; Karki, G.; Díaz-Sánchez, S.; Gortazar, C.; et al. Identification and characterization of probiotics isolated from indigenous chicken (Gallus domesticus) of Nepal. PLoS ONE 2023, 18, e0280412. [Google Scholar] [CrossRef] [PubMed]
  29. Zhai, R.G.; Rizzi, M.; Garavaglia, S. Nicotinamide/nicotinic acid mononucleotide adenylyltransferase, new insights into an ancient enzyme. Cell. Mol. Life Sci. 2009, 66, 2805–2818. [Google Scholar] [CrossRef]
  30. Ma, Y.; Bao, Y.; Wang, S.; Li, T.; Chang, X.; Yang, G.; Meng, X. Anti-inflammation effects and potential mechanism of saikosaponins by regulating Nicotinate and Nicotinamide metabolism and arachidonic acid metabolism. Inflammation 2016, 39, 1453–1461. [Google Scholar] [CrossRef] [PubMed]
  31. Sato, Y.; Atarashi, K.; Plichta, D.R.; Arai, Y.; Sasajima, S.; Kearney, S.M.; Suda, W.; Takeshita, K.; Sasaki, T.; Okamoto, S.; et al. Novel bile acid biosynthetic pathways are enriched in the microbiome of centenarians. Nature 2021, 599, 458–464. [Google Scholar] [CrossRef] [PubMed]
  32. Prol García, M.J.; D’Alvise, P.W.; Rygaard, A.M.; Gram, L. Biofilm formation is not a prerequisite for production of the antibacterial compound tropodithietic acid in Phaeobacter inhibens DSM17395. J. Appl. Microbiol. 2014, 117, 1592–1600. [Google Scholar] [CrossRef]
  33. Kajikawa, A.; Suzuki, S.; Igimi, S. The impact of motility on the localization of Lactobacillus agilis in the murine gastrointestinal tract. BMC Microbiol. 2018, 18, 68. [Google Scholar] [CrossRef]
  34. Prakash Tamang, J.; Kharnaior, P.; Pariyar, P. Whole genome sequencing of the poly-γ-glutamic acid-producing novel Bacillus subtilis Tamang strain, isolated from spontaneously fermented kinema. Food Res. Int. 2024, 190, 114655. [Google Scholar] [CrossRef]
  35. Alcock, B.P.; Huynh, W.; Chalil, R.; Smith, K.W.; Raphenya, A.R.; Wlodarski, M.A.; Edalatmand, A.; Petkau, A.; Syed, S.A.; Tsang, K.K.; et al. CARD 2023: Expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database. Nucleic Acids Res. 2023, 51, D690–D699. [Google Scholar] [CrossRef] [PubMed]
  36. Prieto, A.; López-Novo, C.; Díaz, P.; Díaz-Cao, J.M.; López-Lorenzo, G.; Antón, C.; Remesar, S.; García-Dios, D.; López, C.; Panadero, R.; et al. Antimicrobial susceptibility of Enterotoxigenic Escherichia coli from diarrhoeic neonatal calves in Spain. Animals 2022, 12, 264. [Google Scholar] [CrossRef] [PubMed]
  37. Jia, Y.; Mao, W.; Liu, B.; Zhang, S.; Cao, J.; Xu, X. Study on the drug resistance and pathogenicity of Escherichia coli isolated from calf diarrhea and the distribution of virulence genes and antimicrobial resistance genes. Front. Microbiol. 2022, 13, 992111. [Google Scholar] [CrossRef]
  38. Signorini, M.L.; Soto, L.P.; Zbrun, M.V.; Sequeira, G.J.; Rosmini, M.R.; Frizzo, L.S. Impact of probiotic administration on the health and fecal microbiota of young calves: A meta-analysis of randomized controlled trials of lactic acid bacteria. Res. Vet. Sci. 2012, 93, 250–258. [Google Scholar] [CrossRef]
  39. Wu, Y.Y.; Nie, C.X.; Xu, C.; Luo, R.Q.; Chen, H.L.; Niu, J.L.; Bai, X.; Zhang, W. Effects of dietary supplementation with multispecies probiotics on intestinal epithelial development and growth performance of neonatal calves challenged with Escherichia coli K99. J. Sci. Food Agric. 2022, 102, 4373–4383. [Google Scholar] [CrossRef] [PubMed]
  40. Wang, G.; Zhang, Y.; Song, X.; Xia, Y.; Lai, P.F.; Ai, L. Lactobacillus casei LC2W can inhibit the colonization of Escherichia coli O157: H7 in vivo and reduce the severity of colitis. Food Funct. 2019, 10, 5843–5852. [Google Scholar] [CrossRef]
  41. Miettinen, M.; Lehtonen, A.; Julkunen, I.; Matikainen, S. Lactobacilli and Streptococci activate NF-kappa B and STAT signaling pathways in human macrophages. J. Immunol. 2000, 164, 3733–3740. [Google Scholar] [CrossRef] [PubMed]
  42. Hou, J.; Hu, M.; Zhang, L.; Gao, Y.; Ma, L.; Xu, Q. Dietary taxifolin protects against dextran sulfate sodium-induced colitis via NF-κB signaling, enhancing intestinal barrier and modulating gut microbiota. Front. Immunol. 2021, 11, 631809. [Google Scholar] [CrossRef] [PubMed]
  43. Sun, Z.; Li, H.; Li, Y.; Qiao, J. Lactobacillus salivarius, a potential probiotic to improve the health of LPS-challenged piglet intestine by alleviating inflammation as well as oxidative stress in a dose-dependent manner during weaning transition. Front. Vet. Sci. 2020, 7, 547425. [Google Scholar] [CrossRef] [PubMed]
  44. Knoop, K.A.; Newberry, R.D. Goblet cells: Multifaceted players in immunity at mucosal surfaces. Mucosal Immunol. 2018, 11, 1551–1557. [Google Scholar] [CrossRef] [PubMed]
  45. Ren, S.; Chen, A.; Tian, Y.; Bai, Z.; Wang, C. Lactobacillus paracasei from koumiss ameliorates diarrhea in mice via tight junctions modulation. Nutrition 2022, 98, 111584. [Google Scholar] [CrossRef] [PubMed]
  46. Pereira, F.C.; Wasmund, K.; Cobankovic, I.; Jehmlich, N.; Herbold, C.W.; Lee, K.S.; Sziranyi, B.; Vesely, C.; Decker, T.; Stocker, R.; et al. Rational design of a microbial consortium of mucosal sugar utilizers reduces Clostridiodes difficile colonization. Nat. Commun. 2020, 11, 5104. [Google Scholar] [CrossRef] [PubMed]
  47. He, L.; Wang, C.; Simujide, H.; Aricha, H.; Zhang, J.; Liu, B.; Zhang, C.; Cui, Y.; Aorigele, C. Effect of early Pathogenic Escherichia coli infection on the intestinal barrier and immune function in newborn calves. Front. Cell. Infect. Microbiol. 2022, 12, 818276. [Google Scholar] [CrossRef]
  48. Yang, J.; Qiu, Y.; Hu, S.; Zhu, C.; Wang, L.; Wen, X.; Yang, X.; Jiang, Z. Lactobacillus plantarum inhibited the inflammatory response induced by enterotoxigenic Escherichia coli K88 via modulating MAPK and NF-kappaB signaling in intestinal porcine epithelial cells. J. Appl. Microbiol. 2021, 130, 1684–1694. [Google Scholar] [CrossRef] [PubMed]
  49. Villena, J.; Kitazawa, H. Modulation of intestinal TLR4-inflammatory signaling pathways by probiotic microorganisms: Lessons learned from Lactobacillus jensenii TL2937. Front. Immunol. 2014, 4, 512. [Google Scholar] [CrossRef] [PubMed]
  50. Brown, M.D.; Sacks, D.B. Compartmentalised MAPK pathways. Handb. Exp. Pharmacol. 2008, 186, 205–235. [Google Scholar] [CrossRef]
  51. Chon, H.; Choi, B.; Jeong, G.; Lee, E.; Lee, S. Suppression of proinflammatory cytokine production by specific metabolites of Lactobacillus plantarum 10hk2 via inhibiting NF-κB and p38 MAPK expressions. Comp. Immunol. Microbiol. Infect. Dis. 2010, 33, e41–e49. [Google Scholar] [CrossRef] [PubMed]
  52. Kim, D.; Zeng, M.Y.; Nunez, G. The interplay between host immune cells and gut microbiota in chronic inflammatory diseases. Exp. Mol. Med. 2017, 49, e339. [Google Scholar] [CrossRef] [PubMed]
  53. Lv, W.; Liu, C.; Ye, C.; Sun, J.; Tan, X.; Zhang, C.; Qu, Q.; Shi, D.; Guo, S. Structural modulation of gut microbiota during alleviation of antibiotic-associated diarrhea with herbal formula. Int. J. Biol. Macromol. 2017, 105 Pt 3, 1622–1629. [Google Scholar] [CrossRef]
  54. Shin, N.R.; Whon, T.W.; Bae, J.W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015, 33, 496–503. [Google Scholar] [CrossRef]
  55. Ni, J.; Wu, G.D.; Albenberg, L.; Tomov, V.T. Gut microbiota and IBD: Causation or correlation? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 573–584. [Google Scholar] [CrossRef] [PubMed]
  56. Binda, C.; Lopetuso, L.R.; Rizzatti, G.; Gibiino, G.; Cennamo, V.; Gasbarrini, A. Actinobacteria: A relevant minority for the maintenance of gut homeostasis. Dig. Liver Dis. 2018, 50, 421–428. [Google Scholar] [CrossRef]
  57. Mariat, D.; Firmesse, O.; Levenez, F.; Guimarăes, V.; Sokol, H.; Doré, J.; Corthier, G.; Furet, J.P. The Firmicutes/Bacteroidetes ratio of the human microbiota changes with age. BMC Microbiol. 2009, 9, 123. [Google Scholar] [CrossRef]
  58. Ran, X.; Li, X.; Xie, X.; Lei, J.; Yang, F.; Chen, D. Effects of probiotic Enterococcus faecium from yak on the intestinal microflora and metabolomics of mice with Salmonella infection. Probiotics Antimicrob. Proteins. 2024, 16, 1036–1051. [Google Scholar] [CrossRef] [PubMed]
  59. Hu, Y.; Zhao, M.; Lu, Z.; Lv, F.; Zhao, H.; Bie, X. L. johnsonii, L. plantarum, and L. rhamnosus alleviated Enterohaemorrhagic Escherichia coli-induced diarrhoea in mice by regulating gut microbiota. Microb. Pathog. 2021, 154, 104856. [Google Scholar] [CrossRef] [PubMed]
Ijms 25 13660 g001
Figure 1. Experimental design and the characteristics of L. agilis SNF7 in vitro. (a) Experimental design; (b) colony morphology; (c) survival of L. agilis SNF7 at different pH levels; (d) survival of L. agilis SNF7 at different bile salt concentrations; (e) survival of L. agilis SNF7 in artificial gastrointestinal fluid; (f) inhibitory effect of L. agilis SNF7 on three strains of pathogenic bacteria; (g) inhibitory effect of L. agilis SNF7 on three strains of pathogenic bacteria after different treatments; (h) hemolysis of L. agilis SNF7 (the picture above is S. aureus and the one below is L. agilis SNF7); (i) growth curve of L. agilis SNF7; (j) acid production curve of L. agilis SNF7; (k) sensitivity of L. agile SNF7 to antibiotics. Compared with the CK group, ns means has no significant difference (p > 0.05), * means significant difference (p < 0.05).
Figure 1. Experimental design and the characteristics of L. agilis SNF7 in vitro. (a) Experimental design; (b) colony morphology; (c) survival of L. agilis SNF7 at different pH levels; (d) survival of L. agilis SNF7 at different bile salt concentrations; (e) survival of L. agilis SNF7 in artificial gastrointestinal fluid; (f) inhibitory effect of L. agilis SNF7 on three strains of pathogenic bacteria; (g) inhibitory effect of L. agilis SNF7 on three strains of pathogenic bacteria after different treatments; (h) hemolysis of L. agilis SNF7 (the picture above is S. aureus and the one below is L. agilis SNF7); (i) growth curve of L. agilis SNF7; (j) acid production curve of L. agilis SNF7; (k) sensitivity of L. agile SNF7 to antibiotics. Compared with the CK group, ns means has no significant difference (p > 0.05), * means significant difference (p < 0.05).
Ijms 25 13660 g001
Ijms 25 13660 g002
Figure 2. Genomic predictive function of L. agilis SNF7. (a) Annotation of the genome of L. agilis SNF7 in the GO database; (b) annotation of the genome of L. agilis SNF7 in the KEGG database; (c) annotation of the genome of L. agilis SNF7 in the eggNOG database; (d) annotation of the genome of L. agilis SNF7 in the CAZy database.
Figure 2. Genomic predictive function of L. agilis SNF7. (a) Annotation of the genome of L. agilis SNF7 in the GO database; (b) annotation of the genome of L. agilis SNF7 in the KEGG database; (c) annotation of the genome of L. agilis SNF7 in the eggNOG database; (d) annotation of the genome of L. agilis SNF7 in the CAZy database.
Ijms 25 13660 g002
Ijms 25 13660 g003
Figure 3. Effects of L. agilis SNF7 on the physiological indexes of E. coli K99-induced diarrhea mice. (a) Diarrhea rate of mice during the test period; (b) fecal scores of mice during the test period; (c) body weight of mice in each group on day 8 of the experiment; (d) body weight of mice in each group on day 15 of the experiment; (e) changes in body weight of mice during the experiment; (f) spleen index; (g) liver index; (h) intestinal index. Same letters on columns means the difference is not significant (p > 0.05), ns means has no significant difference (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Figure 3. Effects of L. agilis SNF7 on the physiological indexes of E. coli K99-induced diarrhea mice. (a) Diarrhea rate of mice during the test period; (b) fecal scores of mice during the test period; (c) body weight of mice in each group on day 8 of the experiment; (d) body weight of mice in each group on day 15 of the experiment; (e) changes in body weight of mice during the experiment; (f) spleen index; (g) liver index; (h) intestinal index. Same letters on columns means the difference is not significant (p > 0.05), ns means has no significant difference (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Ijms 25 13660 g003
Ijms 25 13660 g004
Figure 4. Effects of L. agilis SNF7 on the intestinal physical barrier of E. coli K99-induced diarrhea mice. (a) H&E staining of mouse jejunal tissue (bar = 100 µm); (b) expression of Claudin-1 in mouse jejunal tissue (bar = 100 µm); (c) expression of occludin in mouse jejunal tissue (bar = 100 µm); (d) expression of ZO-1 in mouse jejunal tissue (bar = 100 µm); (e) expression of MUC2 in mouse jejunal tissue (bar = 100 µm); (f) area fraction of Claudin-1; (g) area fraction of occludin; (h) area fraction of ZO-1; (i) area fraction of MUC2. The same letters on the column show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Figure 4. Effects of L. agilis SNF7 on the intestinal physical barrier of E. coli K99-induced diarrhea mice. (a) H&E staining of mouse jejunal tissue (bar = 100 µm); (b) expression of Claudin-1 in mouse jejunal tissue (bar = 100 µm); (c) expression of occludin in mouse jejunal tissue (bar = 100 µm); (d) expression of ZO-1 in mouse jejunal tissue (bar = 100 µm); (e) expression of MUC2 in mouse jejunal tissue (bar = 100 µm); (f) area fraction of Claudin-1; (g) area fraction of occludin; (h) area fraction of ZO-1; (i) area fraction of MUC2. The same letters on the column show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Ijms 25 13660 g004
Ijms 25 13660 g005
Figure 5. Effects of L. agilis SNF7 on E. coli-induced inflammatory factor secretion in mice jejunum tissues. (a) Relative expression of IL-6 mRNA; (b) relative expression of TNF-α mRNA; (c) relative expression of IL-1β mRNA; (d) IL-6 content; (e) TNF-α content; (f) IL-1β content. The same letters on the column show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Figure 5. Effects of L. agilis SNF7 on E. coli-induced inflammatory factor secretion in mice jejunum tissues. (a) Relative expression of IL-6 mRNA; (b) relative expression of TNF-α mRNA; (c) relative expression of IL-1β mRNA; (d) IL-6 content; (e) TNF-α content; (f) IL-1β content. The same letters on the column show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Ijms 25 13660 g005
Ijms 25 13660 g006
Figure 6. Effect of L. agilis SNF7 on NF-κB and MAPK signaling pathways in E. coli K99-induced diarrhea mice. (a) Protein bands of NF-κB signaling pathways; (b) p-IκBα/IκBα; (c) p-p65/p-65; (d) protein bands of MAPK signaling pathways; (e) p-p38/p38; (f) p-ERK/ERK; (g) p-JNK/JNK. The same letters on the column show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Figure 6. Effect of L. agilis SNF7 on NF-κB and MAPK signaling pathways in E. coli K99-induced diarrhea mice. (a) Protein bands of NF-κB signaling pathways; (b) p-IκBα/IκBα; (c) p-p65/p-65; (d) protein bands of MAPK signaling pathways; (e) p-p38/p38; (f) p-ERK/ERK; (g) p-JNK/JNK. The same letters on the column show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Ijms 25 13660 g006
Ijms 25 13660 g007
Figure 7. Venn diagram, α diversity analysis, and β diversity analysis of cecum microorganisms in each group. (a) OTU Wayne diagram; (b) α diversity analysis; (c) beta-diversity analysis: PCoA analysis; (d) beta-diversity analysis: NMDS analysis. * Compared with the CK group, * means significant difference (p < 0.05).
Figure 7. Venn diagram, α diversity analysis, and β diversity analysis of cecum microorganisms in each group. (a) OTU Wayne diagram; (b) α diversity analysis; (c) beta-diversity analysis: PCoA analysis; (d) beta-diversity analysis: NMDS analysis. * Compared with the CK group, * means significant difference (p < 0.05).
Ijms 25 13660 g007
Ijms 25 13660 g008
Figure 8. Modulation effect of L. agilis SNF7 on the gut microbiota in E. coli K99-induced diarrhea mice. (a) Phyla-level species distribution histogram; (b) phylum-level species composition heat map; (c) genus-level species distribution histogram; (d) generic-level species composition heat map; (e–k) relative abundance of genera with genus-level differences between groups. The same letters on the columns show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Figure 8. Modulation effect of L. agilis SNF7 on the gut microbiota in E. coli K99-induced diarrhea mice. (a) Phyla-level species distribution histogram; (b) phylum-level species composition heat map; (c) genus-level species distribution histogram; (d) generic-level species composition heat map; (e–k) relative abundance of genera with genus-level differences between groups. The same letters on the columns show the difference is not significant (p > 0.05). The difference is significant (p < 0.05) when there are no identical letters between the columns.
Ijms 25 13660 g008
Table 1. General genome features of L. agilis SNF7.
Table 1. General genome features of L. agilis SNF7.
FeaturesResultsFeaturesResults
Genome size2,214,4225S rRNA8
GC content41.6316S rRNA8
Number of genes215623S rRNA8
Total gene length1,940,892tRNA91
Proportion of coding genes87.65eggNOG 1853
Mean gene length900.23GO 1643
Repeat sequence length2657KEGG1211
Repeat sequence content 0.12VFDB0
Table 2. L. agilis SNF7 genome’s antibacterial and anti-inflammatory pathway and related genes.
Table 2. L. agilis SNF7 genome’s antibacterial and anti-inflammatory pathway and related genes.
NoPathway IDDescriptionGene Number
1ko00053Ascorbate and aldarate metabolism1
2ko00121Secondary bile acid biosynthesis2
3ko00130Ubiquinone and other terpenoid–quinone biosyntheses4
4ko00362Benzoate degradation3
5ko00401Novobiocin biosynthesis1
6ko00430Taurine and hypotaurine metabolism4
7ko00521Streptomycin biosynthesis4
8ko00523Polyketide sugar unit biosynthesis1
9ko00525Acarbose and validamycin biosynthesis1
10ko00643Styrene degradation2
11ko00760Nicotinate and nicotinamide metabolism8
12ko00900Terpenoid backbone biosynthesis13
13ko01130Biosynthesis of antibiotics116
14ko02030Bacterial chemotaxis18
Table 3. CRISPR-Cas proteins and CRISPR consensus repeats in the genome of L. agilis SNF7.
Table 3. CRISPR-Cas proteins and CRISPR consensus repeats in the genome of L. agilis SNF7.
Sequence IDCas-Type/SubtypeBegin (bp)End (bp)
136-1csn2_TypeIIA148,951149,622
137-1cas2_TypeI-II-III149,619149,924
138-1cas1_TypeII149,902150,807
139-1cas9_TypeII151,005155,063
1512-1cas2_TypeIE1,566,3941,567,287
1513-1cas1_TypeIE1,567,2841,568,231
1514-1cas6_TypeIE1,568,2631,568,898
1515-1cas5_TypeIE1,568,9111,569,606
1516-1cas7_TypeIE1,569,5871,570,696
1517-1cse2_TypeIE1,570,7091,571,329
1519-1cas3_TypeI1,573,3971,576,135
Sequence IDConsensus RepeatCRISPR Start (bp)CRISPR End (bp)
1-1GTACTAAACATCATTGATTTAACATACTTCTGAGAC146,511148,923
2-1CTAGGCCCCTAATGTGCAAGGAAAATTA1,009,8951,009,983
3-1TGAATCTATTTAACTTAAGAGGAATGTAAAT1,379,2041,379,301
4-1AGGATTACCCCCACTAGTGTGGGGAGAAG1,565,1731,566,364
Table 4. Prediction of the virulence factor of L. agilis SNF7.
Table 4. Prediction of the virulence factor of L. agilis SNF7.
Gene_IDARO_NameResistance PhenotypeResistance Mechanism
GE000947mefAmacrolidesAntibiotic efflux pump
GE000051APH (7″)-IaaminoglycosidesAntibiotic inactivation
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Feng, M.; Cheng, J.; Su, Y.; Tong, J.; Wen, X.; Jin, T.; Ren, M.; Song, D.; Song, J.; Li, X.; et al. Lactobacillus agilis SNF7 Presents Excellent Antibacteria and Anti-Inflammation Properties in Mouse Diarrhea Induced by Escherichia coli. Int. J. Mol. Sci. 2024, 25, 13660. https://doi.org/10.3390/ijms252413660

AMA Style

Feng M, Cheng J, Su Y, Tong J, Wen X, Jin T, Ren M, Song D, Song J, Li X, et al. Lactobacillus agilis SNF7 Presents Excellent Antibacteria and Anti-Inflammation Properties in Mouse Diarrhea Induced by Escherichia coli. International Journal of Molecular Sciences. 2024; 25(24):13660. https://doi.org/10.3390/ijms252413660

Chicago/Turabian Style

Feng, Mingque, Jia Cheng, Yalan Su, Jingdi Tong, Xiangfu Wen, Tianxiong Jin, Meiyi Ren, Deyuan Song, Jinshang Song, Xiaohan Li, and et al. 2024. "Lactobacillus agilis SNF7 Presents Excellent Antibacteria and Anti-Inflammation Properties in Mouse Diarrhea Induced by Escherichia coli" International Journal of Molecular Sciences 25, no. 24: 13660. https://doi.org/10.3390/ijms252413660

APA Style

Feng, M., Cheng, J., Su, Y., Tong, J., Wen, X., Jin, T., Ren, M., Song, D., Song, J., Li, X., Xie, Q., & Liu, M. (2024). Lactobacillus agilis SNF7 Presents Excellent Antibacteria and Anti-Inflammation Properties in Mouse Diarrhea Induced by Escherichia coli. International Journal of Molecular Sciences, 25(24), 13660. https://doi.org/10.3390/ijms252413660

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop