Overexpression of a ‘Beta’ MYB Factor Gene, VhMYB15, Increases Salinity and Drought Tolerance in Arabidopsis thaliana

Abstract

‘Beta’ is a hybrid of Vitis riparia L. and V. labrusca and has a strong ability to adapt to adverse growth environments and is mainly cultivated and used as a resistant rootstock. At present, the most extensively studied MYB TFs are R2R3-type, which have been found to be involved in plant growth, development, and stress response processes. In the present research, VhMYB15, a key transcription factor for abiotic stress tolerance, was screened by bioinformatics in ‘Beta’ rootstock, and its function under salinity and drought stresses was investigated. VhMYB15 was highly expressed in roots and mature leave under salinity and drought stresses. Observing the phenotype and calculating the survival rate of plants, it was found that VhMYB15-overexpressing plants exhibited relatively less yellowing and wilting of leaves and a higher survival rate under salinity and drought stresses. Consistent with the above results, through the determination of stress-related physiological indicators and the expression analysis of stress-related genes (AtSOS2, AtSOS3, AtSOS1, AtNHX1, AtSnRK2.6, AtNCED3, AtP5CS1, and AtCAT1), it was found that transgenic Arabidopsis showed better stress tolerance and stronger adaptability under salinity and drought stresses. Based on the above data, it was preliminarily indicated that VhMYB15 may be a key factor in salinity and drought regulation networks, enhancing the adaptability of ‘Beta’ to adverse environments.

1. Introduction

Plants in the natural environment are constantly challenged by changes in the environment, including abiotic and biotic stresses [1]. Salinity and drought are major threats to ecosystems, food security, and fruit quality [2]. Plants have evolved a series of regulatory mechanisms to cope with stress in the process of adapting to abiotic stress [3]. Studying the regulatory mechanisms of plant resistance to adversity is beneficial in selecting excellent resistant varieties [4]. In recent years, the function of transcription factors (TFs) in adversity has become a research hotspot [5].

The MYB family is divided into four subfamilies: 1R-MYB, 2R-MYB, 3R-MYB, and 4R-MYB according to the number of repeated R structures [6]. Different subfamily members perform different functions, among which, the 2R-MYB subfamily is the most studied. The N-terminal of the R2R3-MYB TF is composed of two R structures, while the C-terminal R structure has strong transcriptional activation function and certain plasticity, regulating protein activity. R2R3-MYB TFs play a core role in controlling plant metabolism, cell cycle and identification, development, and response to abiotic and biotic stresses [7]. Dicotyledonous and monocotyledonous plants have more than 100 R2R3-MYB members in their genomes. As of now, researchers have identified a large number of R2R3-MYB TFs from plants such as Arabidopsis, rice, and maize [8]. AtMYB15, an R2R3-MYB gene of Arabidopsis, responds to a variety of abiotic stresses [9]. GsMYB15 is related to the survival ability of wild soybeans under salinity stress. AtMYB49 improves the salt tolerance of Arabidopsis by activation of cutin deposition and antioxidant defense [10]. GbMYB5 endows cotton and transgenic tobacco with drought tolerance [11], while LcMYB1 endows transgenic Arabidopsis with salt tolerance [12].

R2R3-MYB TFs are identified using the RNA-Seq data of Vitis vinifera L. and 134 genes are obtained by collation and removal of redundancy [13]. Previously, the focus of attention on MYB TFs in grapes was mainly on the synthesis pathway of secondary metabolites [14]. VvMYBPA1 in grapes is the first factor found to regulate their proanthocyanidins (PAs) synthesis [15], and its heterologous expression increases the synthesis of PAs in Arabidopsis. VvMYBPA2 has high homology with AtTT2, and ectopic expression increases the biosynthesis of PAs in the hairy roots of grapes [16]. VvMYB5a and VvMYB5b genes act as positive regulators to impact the expression of structural genes controlling the biosynthesis of anthocyanin and proanthocyanidin [17,18]. In addition, MYB TFs are also associated with disease resistance in grapes. Transient expression of VdMYB1 in Vitis vinifera promotes the expression of VdSTS2 and enhances tolerance to grape powdery mildew [19]. However, little attention has been paid to the functions of R2R3-MYB TFs in grapes under salinity stress and drought stress, and there are also numerous gaps in the regulatory network.

The ‘Beta’ grape is native to the United States and is a hybrid variety. It was introduced to China in the early years and has advantages such as drought tolerance, strong disease resistance, and cold tolerance. In the Heilongjiang region, salinity and drought problems are very serious. There are fewer varieties of grapes cultivated for processing. In addition to Vitis amurensis Rupr., ‘Beta’ can also be used for wine and juice. Therefore, ‘Beta’ can be used as a rootstock for grafting and raising seedlings. At the same time, it is also possible to cross ‘Beta’ with other grape varieties to obtain new varieties. So, it is necessary to study the pathways through which ‘Beta’ regulates salinity and drought tolerance. In this study, a salinity and drought stress-induced gene, VhMYB15, was screened from the genome of grapes. The aim of this study was to explore the valuable function of the MYB gene and provide a molecular basis for breeding rootstocks of resistant grapes.

2. Results

2.1. Isolation and Bioinformatics Analysis of VhMYB15

Based on the homologous cloning of VvMYB15 (XM_002285157.4, Vitis vinifera L.), the VhMYB15 gene was obtained. The coding region of VhMYB15, from the initiation codon to the termination codon, contained a total of 762 nucleobases and was composed of 253 amino acids, of which Ser (11.1%), Leu (7.9%), and Glu (7.5%) accounted for a large proportion (Figure S1). Predictive analysis of the VhMYB15 protein revealed that its molecular weight and isoelectric point were 28.42 kDa and 5.42, respectively. Since the average hydrophilic coefficient was −0.675, VhMYB15 was a hydrophilic protein.

By predicting and analyzing the secondary structure of the VhMYB15 protein, it was found that it consisted of 30.83% alpha helices, 4.74% beta turns, 4.35% extended strands, and 60.08% random coils (Figure S2A). VhMYB15 contained two SANT conserved domains at 13–63 aa and 66–114 aa (Figure S2B). Predicting the tertiary structure of VhMYB15, it was found that the predicted model was consistent with the prediction of the secondary structure and the prediction of the conservative domain (Figure S2C). Multiple sequence analysis revealed that VhMYB15, like MYB proteins from other species, contained R2 and R3 domains (Figure 1A). Analyzing the evolutionary relationship, it was found that VhMYB15 and VrMYB15 (Vitis riparia L.) clustered on the same branch, with the closest evolutionary relationship. In addition, together with DzMYB15, GhMYB15, and MiMYB15, they formed the first cluster of the evolutionary tree. AtMYB15, BrMYB15, CmMYB15, and CpMYB15 constituted the second cluster, which was also closely related to the evolution of VhMYB15. The third cluster, consisting of SlMYB15, FtMYB15, LsMYB15, and GsMYB15, was relatively distant (Figure 1B).

2.2. Subcellular Localization of VhMYB15 Protein

By injecting the fusion vector VhMYB15–pCAMBIA1300 containing a GFP tag into the leaves of Nicotiana benthamiana, protein localization was determined. Combining the fluorescence of DAPI and GFP, it was found that green fluorescence was distributed throughout the entire cell of tobacco injected with the 35S::GFP vector. In tobacco injected with the 35S::VhMYB15-GFP vector, the green fluorescence coincided with the blue fluorescence of DAPI, so it was determined that VhMYB15 was localized in the nucleus (Figure 2).

2.3. Analysis of the Expression Characteristics of VhMYB15 in ‘Beta’

The tissue-specific expression characteristics of VhMYB15 in ‘Beta’ were analyzed by qRT-PCR. The data showed that the expression level of VhMYB15 was high in roots, relatively high in mature leaves, and low in stems and young leaves, indicating that the main function of VhMYB15 may be nutrient transport (Figure 3A).

Salt, drought, cold, heat, and ABA stresses can all induce the expression of VhMYB15. Within 24 h of stresses, the changes in expression levels under different stresses showed a single-peak pattern. Data analysis found that under salt, drought, cold, heat, and ABA stresses, the time points at which the expression peaks occurred in roots and leaves were the same, 8 h, 4 h, 2 h, 8 h, and 8 h, respectively. In addition, these results also indicated that the up-regulation of VhMYB15 expression was more induced by salt and drought stresses (Figure 3B,C).

2.4. Heterologous Expression of VhMYB15 in Arabidopsis Improved Salinity Tolerance

To analyze whether VhMYB15 plays a regulatory role in salinity and drought stresses, a VhMYB15–pCAMBIA1300 fusion vector was constructed. Transgenic plants were obtained by transforming the pCAMBIA1300 vector and VhMYB15–pCAMBIA1300 vector into Arabidopsis. RNA extraction was performed on plants with positive kanamycin screening for qRT-PCR analysis. VhMYB15 was not expressed in the wild type (WT) or unloaded line (UL), while VhMYB15 was expressed in positive plants to varying degrees, indicating the successful transfer of VhMYB15 in Arabidopsis (Figure 4A). From the eight transgenic lines (L1, L2, L3, L4, L5, L6, L7, and L8), L1, L3, and L7, lines with high expression of VhMYB15, were selected to continue cultivation for the next experimental analysis.

In order to analyze the effect of VhMYB15 on the tolerance of Arabidopsis to salinity stress, all lines of Arabidopsis were treated with 200 mM NaCl to analyze the effects of stress on plant phenotype and survival rate. Under control conditions (Salinity 0 d), the growth trend of Arabidopsis in all lines was basically the same, and there was no significant difference in survival rate. After 10 d of salinity treatment (Salinity 10 d), both VhMYB15-overexpressing (L1, L3, L7) and control-group plants (WT and UL) exhibited yellowing in their leaves, and there were obvious differences in phenotypes. VhMYB15-overexpressing Arabidopsis leaves had a lighter yellowing phenomenon (Figure 4B). After relieving the stress conditions and returning to normal growth for 3 d, it was found that the survival rates of VhMYB15-overexpressing Arabidopsis (80%, 75%, and 82%) were significantly higher than those of the control group Arabidopsis (46% and 41%) (Figure 4C).

Under control conditions (Salinity 0 d), there was no obvious difference in the physiological indicators of all Arabidopsis lines, but the physiological indexes changed under salinity stress, showing obvious differences. Salinity treatment resulted in an increase in plant antioxidant enzyme activity, proline content, MDA content, and electrolyte leakage. The activities of CAT, SOD, POD, and proline content of VhMYB15-overexpressing Arabidopsis were the highest (Figure 5A,D–F), while MDA content and electrolyte leakage were the lowest (Figure 5C,G). In addition, the content of chlorophyll was also affected by salinity stress and decreased, but the VhMYB15-overexpressing Arabidopsis was less affected (Figure 5B). The measured physiological indicators of plants before and after salinity stress further indicate that overexpression of VhMYB15 may enhance plant tolerance to salinity stress.

2.5. VhMYB15 in Transgenic Arabidopsis Activated Salinity Tolerance-Related Genes

The expression levels of AtSOS1, AtSOS2, AtSOS3, and AtNHX1 genes were analyzed by qRT-PCR. The results showed that the expression levels of AtSOS1, AtSOS2, AtSOS3, and AtNHX1 did not differ significantly among all lines of Arabidopsis when not subjected to salinity stress. Salinity stress induced the expression of these responsive genes, and the expression level in VhMYB15-overexpressing Arabidopsis was higher. Therefore, we speculate that VhMYB15 may alleviate osmotic pressure and maintain the balance of intracellular Na⁺ concentration by activating the expression of salt stress-responsive genes, thereby enhancing plant tolerance to salinity stress (Figure 6).

2.6. Heterologous Expression of VhMYB15 in Arabidopsis Improved Drought Tolerance

Under control conditions (Drought 0 d), overexpression of VhMYB15 did not cause phenotypic differences in Arabidopsis, and all lines had good leaf growth, with green color and no yellowing. After 10 d of water deficiency (Drought 10 d), phenotypic differences between VhMYB15-overexpressing Arabidopsis and the control-group Arabidopsis appeared (Figure 7A). Water scarcity leaded to leaf withering, while overexpression of VhMYB15 weakened this trend. After watering again and returning to normal conditions for 3 d, most of the VhMYB15-overexpressing Arabidopsis resumed growth, with survival rates of 82%, 79%, and 80%, while most of the control-group Arabidopsis died (Figure 7B).

Under control conditions (Drought 0 d), there was no significant difference in physiological indicators among all Arabidopsis lines, but physiological indicators changed under drought stress, and there were significant differences. The water shortage resulted in increases in proline content, MDA content, and electrolyte leakage and decrease in chlorophyll content (Figure 8A–C,G). In addition, the activity of antioxidant enzymes was also improved. The activities of CAT, SOD, and POD and the contents of proline and chlorophyll in VhMYB15-overexpressing Arabidopsis were significantly higher than those in the control group, while MDA content was the opposite, significantly lower than that of the control group (Figure 8D–F).

2.7. VhMYB15 in Transgenic Arabidopsis Activated Drought Tolerance-Related Genes

We conducted qRT-PCR analysis of the expression levels of the key enzyme gene for proline synthesis P5CS1, the catalase 1 (CAT1) gene, the key enzyme in ABA synthesis gene NCED3, and the key gene SnRK2.6 that regulates stomatal closure in Arabidopsis. The results showed that under sufficient irrigation conditions, there was no significant difference in the expression levels of AtP5CS1, AtCAT1, AtCAT1, and AtSnRK2.6 among various lines of Arabidopsis. The expression of these genes increased due to dehydration, and the expression of VhMYB15-overexpressing Arabidopsis was significantly higher than that of the control group (Figure 9).

3. Discussion

‘Beta’ is often used as a hybrid parent or grafting stock to obtain varieties with better tolerance and quality. At the same time, ‘Beta’ is also used as a processing variety for brewing and making juices [20]. MYB TFs are widely present in animals, plants, and fungi and are also one of the largest TF families in plants, possessing multiple biological functions [21]. It is not only involved in the regulation of plant growth and development [22,23], but it also participates in plant tolerance to stresses such as drought, salinity, and cold [24,25,26]. Therefore, it is necessary to study the function of MYB TFs in ‘Beta’, which is beneficial for grape breeding using genetic engineering technology. In this research, the VhMYB15 gene was cloned and isolated from ‘Beta’ using VvMYB15 (XM_002285157.4, Vitis vinifera L.) as a homologous gene. The VhMYB15 protein shared the same conserved domain with MYB15 proteins from other species and contained two SANT-MYB DNA binding domains, belonging to the typical R2R3-MYB protein (Figure 1).

TFs typically perform transcriptional regulatory functions in the nucleus, so most TFs are located at the subcellular level in the nucleus, and nuclear localization has gradually become the standard for identifying genes as TFs [27]. In this study, the 35S::VhMYB15-GFP vector was constructed and introduced into tobacco cells, and it was observed that it was also located in the nucleus, consistent with previous studies and consistent with the general characteristics of TFs.

MYB TFs are involved in regulating plant tolerance to a variety of adverse environments. For example, the expression of GhMYB113 is positively regulated by drought stress and negatively regulated by salt stress [28]. ZmMYB002 is highly expressed in maize seeds, roots, and leaves and can be significantly induced by drought and salt stresses [29]. VvMYB112 and VvMYB15 are induced by salt, drought, and cold, while VvMYB107 and VvMYB87 are only induced by salt and are not sensitive to drought or cold [30]. This study used qRT-PCR to detect the expression of VhMYB15 in different tissue parts, with tissue specificity and the highest expression level observed in the roots (Figure 3A). Therefore, the roots can give priority to responding to adverse conditions. In addition, VhMYB15 was expressed in both leaves and roots under salinity, drought, cold, heat, and ABA stresses, but its expression patterns were different. The response rate of VhMYB15 to salinity and drought stresses was relatively rapid, and the expression of VhMYB15 decreased rapidly with the extension of stress time, with a large change range. Under cold, heat, and ABA stresses, the expression trend of VhMYB15 was the same as that of salinity and drought, but the expression level was relatively low (Figure 3). Therefore, salinity and drought were selected as stress treatment conditions for further analysis of VhMYB15 function.

When plants are subjected to salt and drought stresses, the balance of REDOX reactions within their cells is disrupted. This imbalance can lead to the production of a large number of reactive oxygen species (ROS) and other harmful metabolites in plants [31]. These substances accumulate to a certain extent, which can damage the cellular structure of plants, increase the permeability of cell membranes, and lead to a large amount of electrolyte leakage [32]. In addition, ROS can also inhibit the activity of biological enzymes, thereby affecting various physiological and metabolic reactions of plants.

Plants can eliminate reactive ROS free radicals through POD, SOD, and CAT, reduce cell membrane peroxidation, alleviate cell membrane osmotic pressure, and improve survival ability under adverse conditions [33,34]. Salt and drought stress accelerate the degradation of chloroplasts in plants, leading to a decrease in the stability of thylakoid membranes and a significant decrease in chloroplast absorption of light energy, ultimately leading to a decrease in photosynthetic rate [35]. MDA is the end product of membrane lipid peroxidation [36], and its changes in content can reflect the degree of membrane system damage. Stress can trigger or exacerbate membrane lipid peroxidation in plant cells and increase plasma membrane permeability and MDA content, leading to the worsening of biofilm damage [37]. In addition, plants also alleviate stress damage through solute accumulation, and some studies suggest that proline is the most effective osmotic regulator [38]. By observing the phenotype of VhMYB15-overexpressing Arabidopsis and measuring related physiological indicators, the function of VhMYB15 under salinity and drought stresses was analyzed. It was found that VhMYB15-overexpressing Arabidopsis suffered significantly less damage under salinity and drought stresses than the control group, resulting in better growth and higher survival rate after stress relief (Figure 4 and Figure 7). Under salinity and drought stresses, the antioxidant enzyme activity, chlorophyll content, and proline content of VhMYB15-overexpressing Arabidopsis was significantly higher than that of the control group, while MDA content and electrolyte leakage were the opposite, which was consistent with the phenotype of Arabidopsis (Figure 5 and Figure 8).

We verified the difference in tolerance between VhMYB15-overexpressing Arabidopsis and control Arabidopsis under stress at the molecular level. The AtSOS pathway is currently one of the most extensively studied mechanisms by which plants regulate salt stress responses [39]. SOS1, SOS2, and SOS3 constitute the SOS signaling pathway for salt tolerance in Arabidopsis, playing an important role in regulating K⁺/Na⁺ homeostasis in plants under salt stress [40]. The AtSOS1 encodes a Na⁺/H⁺ reverse transporter protein, mediating Na⁺ efflux and transport and protecting cells from Na⁺ toxicity [41]. The AtSOS2 gene encodes serine/threonine protein kinases, and its activity depends on the regulation of the calcium-binding protein AtSOS3 [42]. AtSOS3 activates and interacts with the AtSOS2 protein kinase [43]. The phosphorylation of the AtSOS3–AtSOS2 complex can activate the AtSOS1 protein, directly promoting Na⁺/H⁺ exchange controlled by AtSOS1 [44]. In addition, it may also negatively regulate the process of Na⁺ entering cells. NHX1 (Na⁺/H⁺ antagonist, NHX) encodes the Na⁺/H⁺ reversal transporter located on the vacuole membrane [45]. It can transport excess Na⁺ within the cell to the vacuole, thereby reducing Na⁺ accumulation in the cytoplasm and improving salt tolerance [46]. Overexpression of IlNHX in tobacco maintains a high K⁺/Na⁺ ratio in tissues under salt stress, while reducing chlorophyll loss and lipid peroxidation, thereby improving tobacco salt tolerance [47]. Our research results were consistent with the expression characteristics of these four genes, and salinity stress positively regulates the expression of SOS and NHX1. In the VhMYB15-overexpressing Arabidopsis, the expression levels of AtSOS1/2/3 and AtNHX1 were significantly higher than those of the control-group Arabidopsis. This indicates that VhMYB15 can maintain the balance of intracellular Na⁺ concentration by positively regulating AtSOS1/2/3 and AtNHX1, thereby enhancing salinity tolerance (Figure 6). This was consistent with the measurement results of electrolyte leakage.

P5CS is a rate-limiting enzyme in the proline biosynthesis pathway, and its mRNA expression level is positively correlated with proline content in plants [48]. There is a high positive correlation between plant stress tolerance and proline accumulation. For example, heterologous expression of the LcP5CS gene in Arabidopsis enhances plant tolerance to drought stress [49]. The main function of CAT is to remove excess hydrogen peroxide produced during stress and maintain the oxidative balance of plants under adverse conditions [50]. Research has found that under drought stress, the expression level of the CAT gene in drought-resistant varieties is significantly higher than that in drought-sensitive varieties, indicating that these antioxidant enzymes provide innate protection for drought-resistant varieties against ROS toxicity [51]. SnRK2 plays an important role in plant stress tolerance [52]. AtSnRK2.6 (open stochastic 1) belongs to the Arabidopsis SnRK2 family and can be activated and expressed by ABA signaling. Under stress, the protein phosphatase PP2C in plants releases the inhibition of SnRK2.6 protein kinase. Subsequently, SnRK2.6 protein kinase initiates the regulatory effect on downstream signaling components and causes stomatal movement to enhance plant drought tolerance [53]. NCED is a key rate-limiting enzyme in ABA synthesis, widely involved in plant responses to abiotic stress. Overexpression of AtNCED3 in Arabidopsis enhances plant tolerance to drought stress by increasing endogenous ABA levels [54]. Our research results were consistent with the expression characteristics of these four genes, and drought stress positively regulates the expression of P5CS1, CAT1, NCED3, and SnRK2.6. In the VhMYB15-overexpressing Arabidopsis, the expression levels of AtP5CS1, AtCAT1, AtNCED3, and AtSnRK2.6 were significantly higher than those in the control-group Arabidopsis. This indicates that VhMYB15 can enhance drought tolerance by positively regulating the expression of these stress-related genes, increasing the accumulation of proline and the clearance of ROS (Figure 9).

In summary, based on the data from this study, we have established a potential stress regulation network model centered on VhMYB15 (Figure 10). Under salinity stress, the expression of VhMYB15 activates the SOS pathway, and AtSOS1 mediates the efflux of Na⁺ in cells under salt stress. Its activity is regulated by the SOS3–SOS2 kinase complex. In addition, the SOS pathway and ABA can regulate the expression of AtNHX1, maintain intracellular K⁺/Na⁺ balance and, thus, improve plant salinity tolerance. Under drought stress, VhMYB15 increases the accumulation of proline and enhances the ability to clear ROS by increasing the expression of AtP5CS and AtCAT1. In addition, VhMYB15 responds to drought stress through ABA-dependent pathways. The expression of VhMYB15 promotes an increase in AtSnRK2.6 expression, thereby regulating stomatal closure and increasing tolerance to drought stress. VhMYB15 also increases plant drought tolerance by positively regulating the expression of AtNCED3. In summary, overexpression of VhMYB15 positively regulates plant tolerance to salt and drought stress.

4. Materials and Methods

4.1. Plant Materials, Growth Conditions, and Treatments

The ‘Beta’ plants were planted in a light incubator owned by our research group (Laboratory 322, College of Horticulture and Landscape Architecture, Northeast Agricultural University). We selected ‘Beta’ hydroponic seedlings with strong root systems and small growth differences for stress analysis. The specific methods of stresses were as follows: the hydroponic seedlings were placed in Hoagland solution for salinity (Hoagland solution containing 100 mM NaCl, Coolaber, Beijing, China), drought (Hoagland solution containing 20% PEG6000, Coolaber, Beijing, China), cold (Hoagland solution at 4 °C), high temperature (Hoagland solution at 37 °C), and ABA (Hoagland solution containing 100 μM ABA, Coolaber, Beijing, China) treatments [55]. Samples were taken at 0, 1, 2, 4, 8, 12, and 24 h after stresses, and the expression pattern of VhMYB15 was analyzed using qRT-PCR. Arabidopsis was planted in a nutrient bowl (peat soil:vermiculite = 2:1) in the same growth environment as that of ‘Beta’ (humidity: 75%, 25 °C, 16 h of light) [56,57].

4.2. Cloning and Bioinformatic Analysis of VhMYB15

Total RNA was extracted from ‘Beta’ leaves and the first cDNA was synthesized. The target gene VhMYB15 was isolated by a homologous cloning method [55]. Based on the CDS sequence of VvMYB15 (XM_002285157.4, Vitis vinifera L.), Primer 5 was used to design primers for PCR amplification (the primer sequence was as follows: VhMYB15-F/R: ATGGTAAGAGCTCCTTGTTG/TCAAAGCTCC TGTAAGCCGC). The primers were from the 5′ to the 3′. The PCR product was connected with the T₅ cloning vector, and the kanamycin-positive single colony was selected for sequencing, and the CDS sequence of the target gene was obtained [58]. The homology of VhMYB15 was analyzed using NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 21 January 2023) and DNAMAN 5.2, the evolution relationship of VhMYB15 was analyzed using MEGA11, the physicochemical properties of VhMYB15 were analyzed using TBtools v2.042, and the secondary structure and tertiary structure of VhMYB15 were analyzed using SOPMA (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html, accessed on 26 March 2023) and SWISS-MODEL (https://swissmodel.expasy.org/, accessed on 26 March 2023) [27,59].

4.3. Vector Construction and Subcellular Localization of VhMYB15

The vector pCAMBIA1300 GFP was linearized using restriction endonuclease BamHI and SalI [27]. The fusion vector VhMYB15–pCAMBIA1300 was obtained by adding 15 bp homologous arms to both ends of the cloned primers (VhMYB15-2F/2R: GGTACCCGGGGATCCATGGTAAGAGCTCCTTGTTG/GCTCACCATGTCGACAAG CTCCTGTAAGCCGC; the primers were from the 5′ to the 3′) and connecting the target gene to the linearized vector by a homologous recombination method [6]. The successfully constructed vector was transformed into Agrobacterium GV3101 for subsequent experiments [4].

In order to determine the localization of VhMYB15 in cells, Agrobacterium containing the VhMYB15–pCAMBIA1300 vector and pCAMBIA1300 vector were injected into 30-day-old tobacco leaves, and the distribution of GFP fluorescence signals was observed under confocal microscopy. DAPI staining was used as a means of assisting localization [32].

4.4. Expression Analysis of VhMYB15

We used the VvActin-7 gene (Vitis vinifera, XM_002282480.5) as an internal reference gene with the following primers: VvActin-7 F/R: CTTGCATCCCTCAGCACCTT/TCCTGTGGACAATGGA TGGA. The specific primers (VhMYB15-qF/qR) were designed to avoid the conservative domain of the CDS region of VhMYB15. The specific sequence was as follows: VhMYB15-qF/qR: TTGTTGTGATAAGGTGGG/CTTGTTTTGGAAGGGCTC. The primers were from the 5′ to the 3′. The ChamQ Universal SYBR qPCR Master Mix kit (Vazyme, Nanjing, China) was selected for the experiment. We adopted a two-step method for qRT-PCR testing, and the specific method was adapted from Han et al. [60]. It mainly included pre-denaturation (95 °C, 30 s) and a 40-cycle circulation system (95 °C, 10 s; 60 °C, 30 s). The relative expression of VhMYB15 was calculated by 2^−ΔΔCt [60].

4.5. Generation of Transgenic Lines

The Agrobacterium containing the pCAMBIA1300 vector and VhMYB15–pCAMBIA1300 vector were activated by a secondary activation method [27]. When the Agrobacterium solution had an OD₆₀₀ = 1, the re-suspension solution was prepared (OD₆₀₀ = 0.5–0.8).

Inflorescences of Arabidopsis were soaked in re-suspension solution for 30 s then left to rest for 5 min and cultured in the dark for 24 h. In order to improve the success rate of Arabidopsis transformation, each batch of seedlings was infected 2–3 times, with an interval of 1 week between infections. The infected seeds were screened using kanamycin (50 mg L⁻¹), and the initially obtained seedlings were T₁-generation plants, which were further cultured until the seeds were harvested. Subsequently, the expression of VhMYB15 in T₂-generation Arabidopsis was analyzed by qRT-PCR. In order to obtain homozygous T₃-generation Arabidopsis, the lines with relatively high expression were further cultured. Subsequently, salinity and drought treatments were carried out using T₃-generation Arabidopsis [21].

4.6. Analysis of Related Physiological Indexes in VhMYB15-Overexpressing Arabidopsis

WT, UL, and transgenic Arabidopsis lines (L1, L3, and L7) with similar growth were selected to measure the stress-related physiological indexes. Each Arabidopsis line was divided into three equal parts: one part was cultured under normal conditions, and the other two parts were treated with salinity stress or drought stress. The specific method was irrigation with Hoagland solution containing 200 mM NaCl for 8 d under salinity stress and no watering for 10 d under drought stress. The survival rate was calculated after 3 d of stress relief. The phenotypes of the plants before and after stresses were observed, and the related physiological indexes of the plants were measured. The chlorophyll content was measured by the anhydrous ethanol extraction method, the proline was extracted by sulfonic salicylic acid, and the color reaction was carried out with ninhydrin [50]. Malondialdehyde was extracted by thiobarbituric acid [3]. The activities of peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT) were detected with the Suzhou Grace Biotechnology test kit (item No. G0107F, G0101F, G0105F, Comin, Suzhou, China).

4.7. Expression Analysis of Stress-Related Genes in VhMYB15-Overexpressing Arabidopsis

The RNA of Arabidopsis lines (WT, UL, L1, L3, L7) was extracted under salinity stress (200 mM NaCl for 8 d) and drought stress (no watering for 10 d), and cDNA was obtained by reverse transcription. The expression of AtNCED3, AtSnRK2.6, AtP5SC, AtCAT1, AtSOS2, AtSOS3, AtSOS1, and AtNHX1 downstream genes of VhMYB15 was detected by qRT-PCR. AtActin2 was selected as the internal reference gene. The specific primers were as follows: AtP5CS1-F/R: AGGGAAAGTTCCA GAAAG/CATAACTAAGCGAGCCAC; AtCAT1-F/R: GTCCTGGGATTCAGACAGGC/GGCC TCACGTTAAGACGAGT; AtNCED3-F/R: TTGATGCTCCAGATTGCTTC/GGACCCTATCACG ACGACTT; AtSnRK2.6-F/R: AGATCCCGAGGAACCAAAGA/CTCTTTGCAGGGTCAGCA AC; AtSOS2-F/R: GCAAGGGAAGAAGAAGAAGT/TCTCCGCTACATAACTGCC; AtSOS3-F/R: GAATCCATCGCTCATCAA/CCATTTCTTCCTCTTCACA; AtSOS1-F/R: TTCATCATCCTC ACAATGGCTCTAA/CCCTCATCAAGCATCTCCCAGTA; AtNHX1-F/R: AGCCTTCAGGGAA CCACAAT/CTCCAAAGACGGGTCGCATG; AtActin2-F/R: TTACCCGATGGGCAAGTCA/AAACGAGGGCTGGAACAAGA [61]. The primers were from the 5′ to the 3′. The PCR program and expression calculation method were the same as those in Section 4.4.

4.8. Statistical Analysis

Using GraphPad principle (v8.0.2.263) software, physiological index data of various Arabidopsis lines (WT, UL, L1, 3, 7) before and after stresses were analyzed, and standard error (±SE) and differences (* p ≤ 0.05, ** p ≤ 0.01) were marked. Both biological and technical replicates were performed three times.

5. Conclusions

VhMYB15, an R2R3-type MYB TF isolated from ‘Beta’, can respond to various stresses, with higher expression levels in its roots and mature leaves under salinity and drought stresses. By constructing VhMYB15-overexpressing Arabidopsis and analyzing its phenotype and stress-related physiological indicators, it was found that heterologous expression of VhMYB15 improved the survival ability of Arabidopsis under salinity and drought. In addition, the expression level analysis of MYB downstream stress-related genes also confirmed this result. The analysis of VhMYB15 function can provide a possibility for the molecular breeding of grapes.