Exploratory Analysis of MicroRNA Alterations in a Neurodevelopmental Mouse Model for Autism Spectrum Disorder and Schizophrenia
Abstract
:1. Introduction
2. Results
2.1. ASD-Linked miR-451a and miR-486-3p Dynamics in the Early Ketamine-Treated Neurodevelopmental Model
2.2. SCZ-Linked miR-132-3p and miR-137-3p Dynamics in the Early Ketamine-Treated Neurodevelopmental Model
2.3. ASD and SCZ-Linked miRNAs’ Dynamics in the Early Ketamine-Treated Neurodevelopmental Model
2.4. Correlation of miRNA Expression and Common Targets within the Investigated Set
3. Discussion
4. Materials and Methods
4.1. Animals and Drug Treatment: Mouse Neurodevelopmental Model for ASD and SCZ with Early NMDA Receptor Hypofunction
4.2. Tissue Collection
4.3. RNA Isolation
4.4. miRNA Expression Profiling
4.5. Statistical Analysis
4.6. Construction of the miRNA Targeting Networks
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rajman, M.; Schratt, G. MicroRNAs in Neural Development: From Master Regulators to Fine-Tuners. Development 2017, 144, 2310–2322. [Google Scholar] [CrossRef]
- Sun, E.; Shi, Y. MicroRNAs: Small Molecules with Big Roles in Neurodevelopment and Diseases. Exp. Neurol. 2015, 268, 46–53. [Google Scholar] [CrossRef]
- Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from Repression to Activation: MicroRNAs Can up-Regulate Translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef]
- Vishnoi, A.; Rani, S. MiRNA Biogenesis and Regulation of Diseases: An Overview. In MicroRNA Profiling; Rani, S., Ed.; Methods in Molecular Biology; Humana Press: New York, NY, USA, 2017; Volume 1509, pp. 1–10. [Google Scholar] [CrossRef]
- Shang, R.; Lee, S.; Senavirathne, G.; Lai, E.C. MicroRNAs in Action: Biogenesis, Function and Regulation. Nat. Rev. Genet. 2023, 24, 816–833. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Hannon, G.J. MicroRNAs: Small RNAs with a Big Role in Gene Regulation. Nat. Rev. Genet. 2004, 5, 522–531. [Google Scholar] [CrossRef] [PubMed]
- Shafiee-Kandjani, A.R.; Nezhadettehad, N.; Farhang, S.; Bruggeman, R.; Shanebandi, D.; Hassanzadeh, M.; Azizi, H. MicroRNAs and Pro-Inflammatory Cytokines as Candidate Biomarkers for Recent-Onset Psychosis. BMC Psychiatry 2023, 23, 631. [Google Scholar] [CrossRef] [PubMed]
- Juźwik, C.A.; Drake, S.S.; Zhang, Y.; Paradis-Isler, N.; Sylvester, A.; Amar-Zifkin, A.; Douglas, C.; Morquette, B.; Moore, C.S.; Fournier, A.E. MicroRNA Dysregulation in Neurodegenerative Diseases: A Systematic Review. Prog. Neurobiol. 2019, 182, 101664. [Google Scholar] [CrossRef] [PubMed]
- Xu, B.; Karayiorgou, M.; Gogos, J.A. MicroRNAs in Psychiatric and Neurodevelopmental Disorders. Brain Res. 2010, 1338, 78–88. [Google Scholar] [CrossRef]
- Iorio, M.V.; Croce, C.M. Causes and Consequences of MicroRNA Dysregulation. Cancer J. 2012, 18, 215. [Google Scholar] [CrossRef] [PubMed]
- Brites, D.; Fernandes, A. Neuroinflammation and Depression: Microglia Activation, Extracellular Microvesicles and MicroRNA Dysregulation. Front. Cell Neurosci. 2015, 9, 476. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.C.; Du, Y.; Chen, L.; Yuan, Z.Q.; Cheng, Y. MicroRNA Schizophrenia: Etiology, Biomarkers and Therapeutic Targets. Neurosci. Biobehav. Rev. 2023, 146, 105064. [Google Scholar] [CrossRef]
- Li, J.; Xu, X.; Liu, J.; Zhang, S.; Tan, X.; Li, Z.; Zhang, J.; Wang, Z. Decoding MicroRNAs in Autism Spectrum Disorder. Mol. Ther. Nucleic Acids 2022, 30, 535–546. [Google Scholar] [CrossRef]
- Solmi, M.; Seitidis, G.; Mavridis, D.; Correll, C.U.; Dragioti, E.; Guimond, S.; Tuominen, L.; Dargél, A.; Carvalho, A.F.; Fornaro, M.; et al. Incidence, Prevalence, and Global Burden of Schizophrenia—Data, with Critical Appraisal, from the Global Burden of Disease (GBD) 2019. Mol. Psychiatry 2023. [Google Scholar] [CrossRef]
- Solmi, M.; Song, M.; Yon, D.K.; Lee, S.W.; Fombonne, E.; Kim, M.S.; Park, S.; Lee, M.H.; Hwang, J.; Keller, R.; et al. Incidence, Prevalence, and Global Burden of Autism Spectrum Disorder from 1990 to 2019 across 204 Countries. Mol. Psychiatry 2022, 27, 4172–4180. [Google Scholar] [CrossRef]
- Lord, C.; Brugha, T.S.; Charman, T.; Cusack, J.; Dumas, G.; Frazier, T.; Jones, E.J.H.; Jones, R.M.; Pickles, A.; State, M.W.; et al. Autism Spectrum Disorder. Nat. Rev. Dis. Primers 2020, 6, 5. [Google Scholar] [CrossRef]
- Hirota, T.; King, B.H. Autism Spectrum Disorder: A Review. JAMA 2023, 329, 157–168. [Google Scholar] [CrossRef]
- Jauhar, S.; Johnstone, M.; McKenna, P.J. Schizophrenia. Lancet 2022, 399, 473–486. [Google Scholar] [CrossRef] [PubMed]
- Owen, M.J.; Sawa, A.; Mortensen, P.B. Schizophrenia. Lancet 2016, 388, 86–97. [Google Scholar] [CrossRef] [PubMed]
- Gao, R.; Penzes, P. Common Mechanisms of Excitatory and Inhibitory Imbalance in Schizophrenia and Autism Spectrum Disorders. Curr. Mol. Med. 2015, 15, 146. [Google Scholar] [CrossRef] [PubMed]
- Prata, J.; Santos, S.G.; Almeida, M.I.; Coelho, R.; Barbosa, M.A. Bridging Autism Spectrum Disorders and Schizophrenia through Inflammation and Biomarkers—Pre-Clinical and Clinical Investigations. J. Neuroinflamm. 2017, 14, 179. [Google Scholar] [CrossRef] [PubMed]
- Vorstman, J.A.S.; Burbach, J.P.H. Autism and Schizophrenia: Genetic and Phenotypic Relationships. In Comprehensive Guide to Autism; Springer: New York, NY, USA, 2014; pp. 1645–1662. [Google Scholar] [CrossRef]
- Marín, O. Interneuron Dysfunction in Psychiatric Disorders. Nat. Rev. Neurosci. 2012, 13, 107–120. [Google Scholar] [CrossRef]
- Hu, H.; Gan, J.; Jonas, P. Interneurons. Fast-Spiking, Parvalbumin+ GABAergic Interneurons: From Cellular Design to Microcircuit Function. Science 2014, 345, 1255263. [Google Scholar] [CrossRef]
- Ferguson, B.R.; Gao, W.J. PV Interneurons: Critical Regulators of E/I Balance for Prefrontal Cortex-Dependent Behavior and Psychiatric Disorders. Front. Neural Circuits 2018, 12, 37. [Google Scholar] [CrossRef]
- Bartos, M.; Vida, I.; Jonas, P. Synaptic Mechanisms of Synchronized Gamma Oscillations in Inhibitory Interneuron Networks. Nat. Rev. Neurosci. 2007, 8, 45–56. [Google Scholar] [CrossRef]
- Juarez, P.; Martínez Cerdeño, V. Parvalbumin and Parvalbumin Chandelier Interneurons in Autism and Other Psychiatric Disorders. Front. Psychiatry 2022, 13, 913550. [Google Scholar] [CrossRef]
- Volk, D.W.; Lewis, D.A. Early Developmental Disturbances of Cortical Inhibitory Neurons: Contribution to Cognitive Deficits in Schizophrenia. Schizophr. Bull. 2014, 40, 952–957. [Google Scholar] [CrossRef]
- Kaar, S.J.; Angelescu, I.; Marques, T.R.; Howes, O.D. Pre-Frontal Parvalbumin Interneurons in Schizophrenia: A Meta-Analysis of Post-Mortem Studies. J. Neural Transm. 2019, 126, 1637. [Google Scholar] [CrossRef]
- Filice, F.; Janickova, L.; Henzi, T.; Bilella, A.; Schwaller, B. The Parvalbumin Hypothesis of Autism Spectrum Disorder. Front. Cell Neurosci. 2020, 14, 577525. [Google Scholar] [CrossRef] [PubMed]
- Contractor, A.; Ethell, I.M.; Portera-Cailliau, C. Cortical Interneurons in Autism. Nat. Neurosci. 2021, 24, 1648–1659. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Sun, Q.Q. Development of NMDA NR2 Subunits and Their Roles in Critical Period Maturation of Neocortical GABAergic Interneurons. Dev. Neurobiol. 2011, 71, 221–245. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.X.; Gao, W.J. Cell Type-Specific Development of NMDA Receptors in the Interneurons of Rat Prefrontal Cortex. Neuropsychopharmacology 2009, 34, 2028–2040. [Google Scholar] [CrossRef]
- Behrens, M.M.; Sejnowski, T.J. Does Schizophrenia Arise from Oxidative Dysregulation of Parvalbumin-Interneurons in the Developing Cortex? Neuropharmacology 2009, 57, 193–200. [Google Scholar] [CrossRef]
- Jeevakumar, V.; Kroener, S. Ketamine Administration during the Second Postnatal Week Alters Synaptic Properties of Fast-Spiking Interneurons in the Medial Prefrontal Cortex of Adult Mice. Cereb. Cortex 2016, 26, 1117–1129. [Google Scholar] [CrossRef] [PubMed]
- Jeevakumar, V.; Driskill, C.; Paine, A.; Sobhanian, M.; Vakil, H.; Morris, B.; Ramos, J.; Kroener, S. Ketamine Administration during the Second Postnatal Week Induces Enduring Schizophrenia-like Behavioral Symptoms and Reduces Parvalbumin Expression in the Medial Prefrontal Cortex of Adult Mice. Behav. Brain Res. 2015, 282, 165–175. [Google Scholar] [CrossRef]
- Behrens, M.M.; Ali, S.S.; Dao, D.N.; Lucero, J.; Shekhtman, G.; Quick, K.L.; Dugan, L.L. Ketamine-Induced Loss of Phenotype of Fast-Spiking Interneurons Is Mediated by NADPH-Oxidase. Science 2007, 318, 1645–1647. [Google Scholar] [CrossRef] [PubMed]
- Phensy, A.; Duzdabanian, H.E.; Brewer, S.; Panjabi, A.; Driskill, C.; Berz, A.; Peng, G.; Kroener, S. Antioxidant Treatment with N-Acetyl Cysteine Prevents the Development of Cognitive and Social Behavioral Deficits That Result from Perinatal Ketamine Treatment. Front. Behav. Neurosci. 2017, 11, 106. [Google Scholar] [CrossRef] [PubMed]
- Phensy, A.; Lindquist, K.L.; Lindquist, K.A.; Bairuty, D.; Gauba, E.; Guo, L.; Tian, J.; Du, H.; Kroener, S. Deletion of the Mitochondrial Matrix Protein Cyclophilin D Prevents Parvalbumin Interneuron Dysfunctionand Cognitive Deficits in a Mouse Model of NMDA Hypofunction. J. Neurosci. 2020, 40, 6121–6132. [Google Scholar] [CrossRef] [PubMed]
- Bove, M.; Tucci, P.; Dimonte, S.; Trabace, L.; Schiavone, S.; Morgese, M.G. Postnatal Antioxidant and Anti-Inflammatory Treatments Prevent Early Ketamine-Induced Cortical Dysfunctions in Adult Mice. Front. Neurosci. 2020, 14, 590088. [Google Scholar] [CrossRef] [PubMed]
- Bove, M.; Schiavone, S.; Tucci, P.; Sikora, V.; Dimonte, S.; Colia, A.L.; Morgese, M.G.; Trabace, L. Ketamine Administration in Early Postnatal Life as a Tool for Mimicking Autism Spectrum Disorders Core Symptoms. Prog. Neuropsychopharmacol. Biol. Psychiatry 2022, 117, 110560. [Google Scholar] [CrossRef] [PubMed]
- Garrido-Torres, N.; Guzmán-Torres, K.; García-Cerro, S.; Pinilla Bermúdez, G.; Cruz-Baquero, C.; Ochoa, H.; García-González, D.; Canal-Rivero, M.; Crespo-Facorro, B.; Ruiz-Veguilla, M. MiRNAs as Biomarkers of Autism Spectrum Disorder: A Systematic Review and Meta-Analysis. Eur. Child. Adolesc. Psychiatry 2023, 1, 1–34. [Google Scholar] [CrossRef]
- Thomas, K.T.; Zakharenko, S.S. MicroRNAs in the Onset of Schizophrenia. Cells 2021, 10, 2679. [Google Scholar] [CrossRef]
- Liu, S.; Zhang, F.; Wang, X.; Shugart, Y.Y.; Zhao, Y.; Li, X.; Liu, Z.; Sun, N.; Yang, C.; Zhang, K.; et al. Diagnostic Value of Blood-Derived MicroRNAs for Schizophrenia: Results of a Meta-Analysis and Validation. Sci. Rep. 2017, 7, 15328. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, W.; Liu, H.; He, Z.; Ju, J.; Gao, Q.; Shan, Z.; Lei, L. MiR-92a-2-5p Regulates the Proliferation and Differentiation of ASD-Derived Neural Progenitor Cells. Curr. Issues Mol. Biol. 2022, 44, 2431–2442. [Google Scholar] [CrossRef]
- Murphy, C.P.; Li, X.; Maurer, V.; Oberhauser, M.; Gstir, R.; Wearick-Silva, L.E.; Viola, T.W.; Schafferer, S.; Grassi-Oliveira, R.; Whittle, N.; et al. MicroRNA-Mediated Rescue of Fear Extinction Memory by MiR-144-3p in Extinction-Impaired Mice. Biol. Psychiatry 2017, 81, 979–989. [Google Scholar] [CrossRef] [PubMed]
- Fregeac, J.; Colleaux, L.; Nguyen, L.S. The Emerging Roles of MicroRNAs in Autism Spectrum Disorders. Neurosci. Biobehav. Rev. 2016, 71, 729–738. [Google Scholar] [CrossRef] [PubMed]
- Sarachana, T.; Zhou, R.; Chen, G.; Manji, H.K.; Hu, V.W. Investigation of Post-Transcriptional Gene Regulatory Networks Associated with Autism Spectrum Disorders by MicroRNA Expression Profiling of Lymphoblastoid Cell Lines. Genome Med. 2010, 2, 23. [Google Scholar] [CrossRef]
- Huang, F.; Long, Z.; Chen, Z.; Li, J.; Hu, Z.; Qiu, R.; Zhuang, W.; Tang, B.; Xia, K.; Jiang, H. Investigation of Gene Regulatory Networks Associated with Autism Spectrum Disorder Based on MiRNA Expression in China. PLoS ONE 2015, 10, e0129052. [Google Scholar] [CrossRef]
- Mor, M.; Nardone, S.; Sams, D.S.; Elliott, E. Hypomethylation of MiR-142 Promoter and Upregulation of MicroRNAs That Target the Oxytocin Receptor Gene in the Autism Prefrontal Cortex. Mol. Autism 2015, 6, 46. [Google Scholar] [CrossRef]
- Ragusa, M.; Santagati, M.; Mirabella, F.; Lauretta, G.; Cirnigliaro, M.; Brex, D.; Barbagallo, C.; Domini, C.N.; Gulisano, M.; Barone, R.; et al. Potential Associations Among Alteration of Salivary MiRNAs, Saliva Microbiome Structure, and Cognitive Impairments in Autistic Children. Int. J. Mol. Sci. 2020, 21, 6203. [Google Scholar] [CrossRef]
- Frye, R.E.; Rose, S.; McCullough, S.; Bennuri, S.C.; Porter-Gill, P.A.; Dweep, H.; Gill, P.S. MicroRNA Expression Profiles in Autism Spectrum Disorder: Role for MiR-181 in Immunomodulation. J. Pers. Med. 2021, 11, 922. [Google Scholar] [CrossRef]
- Ghahramani Seno, M.M.; Hu, P.; Gwadry, F.G.; Pinto, D.; Marshall, C.R.; Casallo, G.; Scherer, S.W. Gene and MiRNA Expression Profiles in Autism Spectrum Disorders. Brain Res. 2011, 1380, 85–97. [Google Scholar] [CrossRef]
- Kichukova, T.M.; Popov, N.T.; Ivanov, I.S.; Vachev, T.I. Profi Ling of Circulating Serum MicroRNAs in Children with Autism Spectrum Disorder Using Stem-Loop QRT-PCR Assay. Folia Medica I 2017, 59, 43–52. [Google Scholar] [CrossRef]
- Yu, D.; Jiao, X.; Cao, T.; Huang, F. Serum MiRNA Expression Profiling Reveals MiR-486-3p May Play a Significant Role in the Development of Autism by Targeting ARID1B. Neuroreport 2018, 29, 1431–1436. [Google Scholar] [CrossRef] [PubMed]
- Perkins, D.O.; Jeffries, C.D.; Jarskog, L.F.; Thomson, J.M.; Woods, K.; Newman, M.A.; Parker, J.S.; Jin, J.; Hammond, S.M. MicroRNA Expression in the Prefrontal Cortex of Individuals with Schizophrenia and Schizoaffective Disorder. Genome Biol. 2007, 8, R27. [Google Scholar] [CrossRef] [PubMed]
- Cosgrove, D.; Harold, D.; Mothersill, O.; Anney, R.; Hill, M.J.; Bray, N.J.; Blokland, G.; Petryshen, T.; Richards, A.; Mantripragada, K.; et al. MiR-137-Derived Polygenic Risk: Effects on Cognitive Performance in Patients with Schizophrenia and Controls. Transl. Psychiatry 2017, 7, e1012. [Google Scholar] [CrossRef]
- Rubenstein, J.L.R.; Merzenich, M.M. Model of Autism: Increased Ratio of Excitation/Inhibition in Key Neural Systems. Genes. Brain Behav. 2003, 2, 255–267. [Google Scholar] [CrossRef] [PubMed]
- Santos-Silva, T.; dos Santos Fabris, D.; de Oliveira, C.L.; Guimarães, F.S.; Gomes, F.V. Prefrontal and Hippocampal Parvalbumin Interneurons in Animal Models for Schizophrenia: A Systematic Review and Meta-Analysis. Schizophr. Bull. 2024, 50, 210–223. [Google Scholar] [CrossRef]
- Fan, H.M.; Sun, X.Y.; Niu, W.; Zhao, L.; Zhang, Q.L.; Li, W.S.; Zhong, A.F.; Zhang, L.Y.; Lu, J. Altered MicroRNA Expression in Peripheral Blood Mononuclear Cells from Young Patients with Schizophrenia. J. Mol. Neurosci. 2015, 56, 562–571. [Google Scholar] [CrossRef]
- Chen, S.D.; Sun, X.Y.; Niu, W.; Kong, L.M.; He, M.J.; Fan, H.M.; Li, W.S.; Zhong, A.F.; Zhang, L.Y.; Lu, J. A Preliminary Analysis of MicroRNA-21 Expression Alteration after Antipsychotic Treatment in Patients with Schizophrenia. Psychiatry Res. 2016, 244, 324–332. [Google Scholar] [CrossRef]
- Jyonouchi, H.; Geng, L.; Streck, D.L.; Dermody, J.J.; Toruner, G.A. MicroRNA Expression Changes in Association with Changes in Interleukin-1ß/Interleukin10 Ratios Produced by Monocytes in Autism Spectrum Disorders: Their Association with Neuropsychiatric Symptoms and Comorbid Conditions (Observational Study). J. Neuroinflamm. 2017, 14, 229. [Google Scholar] [CrossRef]
- Hicks, S.D.; Rajan, A.T.; Wagner, K.E.; Barns, S.; Carpenter, R.L.; Middleton, F.A. Validation of a Salivary RNA Test for Childhood Autism Spectrum Disorder. Front. Genet. 2018, 9, 420578. [Google Scholar] [CrossRef]
- Ma, J.; Shang, S.; Wang, J.; Zhang, T.; Nie, F.; Song, X.; Zhao, H.; Zhu, C.; Zhang, R.; Hao, D. Identification of MiR-22-3p, MiR-92a-3p, and MiR-137 in Peripheral Blood as Biomarker for Schizophrenia. Psychiatry Res. 2018, 265, 70–76. [Google Scholar] [CrossRef]
- Nakata, M.; Kimura, R.; Funabiki, Y.; Awaya, T.; Murai, T.; Hagiwara, M. MicroRNA Profiling in Adults with High-Functioning Autism Spectrum Disorder. Mol. Brain 2019, 12, 82. [Google Scholar] [CrossRef]
- Da Silva Vaccaro, T.; Sorrentino, J.M.; Salvador, S.; Veit, T.; Souza, D.O.; De Almeida, R.F. Alterations in the MicroRNA of the Blood of Autism Spectrum Disorder Patients: Effects on Epigenetic Regulation and Potential Biomarkers. Behav. Sci. 2018, 8, 75. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Zhu, X.; Sun, Y.; Li, Z.; Li, X.; Ai, L.; He, Y.; Liu, Y.; Jia, N.; Hu, G.; et al. Identification of Peripheral Blood MiRNA Biomarkers in First-Episode Drug-Free Schizophrenia Patients Using Bioinformatics Strategy. Mol. Neurobiol. 2022, 59, 4730–4746. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, R.R.; Amer, R.A.; Abozeid, A.A.; Elsharaby, R.M.; Shafik, N.M. Micro RNA 146a Gene Variant/TNF-α/IL-6/IL-1 β; A Cross-Link Axis Inbetween Oxidative Stress, Endothelial Dysfunction and Neuro-Inflammation in Acute Ischemic Stroke and Chronic Schizophrenic Patients. Arch. Biochem. Biophys. 2020, 679, 108193. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.S.; Fregeac, J.; Bole-Feysot, C.; Cagnard, N.; Iyer, A.; Anink, J.; Aronica, E.; Alibeu, O.; Nitschke, P.; Colleaux, L. Role of MiR-146a in Neural Stem Cell Differentiation and Neural Lineage Determination: Relevance for Neurodevelopmental Disorders. Mol. Autism 2018, 9, 38. [Google Scholar] [CrossRef] [PubMed]
- De La Torre-Ubieta, L.; Won, H.; Stein, J.L.; Geschwind, D.H. Advancing the Understanding of Autism Disease Mechanisms through Genetics. Nat. Med. 2016, 22, 345–361. [Google Scholar] [CrossRef] [PubMed]
- Kato, H.; Kimura, H.; Kushima, I.; Takahashi, N.; Aleksic, B.; Ozaki, N. The Genetic Architecture of Schizophrenia: Review of Large-Scale Genetic Studies. J. Hum. Genet. 2022, 68, 175–182. [Google Scholar] [CrossRef]
- Andreassen, O.A.; Hindley, G.F.L.; Frei, O.; Smeland, O.B. New Insights from the Last Decade of Research in Psychiatric Genetics: Discoveries, Challenges and Clinical Implications. World Psychiatry 2023, 22, 4–24. [Google Scholar] [CrossRef]
- Gebert, L.F.R.; MacRae, I.J. Regulation of MicroRNA Function in Animals. Nat. Rev. Mol. Cell Biol. 2018, 20, 21–37. [Google Scholar] [CrossRef]
- Craske, M.G.; Herzallah, M.M.; Nusslock, R.; Patel, V. From Neural Circuits to Communities: An Integrative Multidisciplinary Roadmap for Global Mental Health. Nat. Ment. Health 2023, 1, 12–24. [Google Scholar] [CrossRef]
- Phensy, A.; Driskill, C.; Lindquist, K.; Guo, L.; Jeevakumar, V.; Fowler, B.; Du, H.; Kroener, S. Antioxidant Treatment in Male Mice Prevents Mitochondrial and Synaptic Changes in an NMDA Receptor Dysfunction Model of Schizophrenia. eNeuro 2017, 4, e0081-17.2017. [Google Scholar] [CrossRef]
- Meyer-Lindenberg, A.; Domes, G.; Kirsch, P.; Heinrichs, M. Oxytocin and Vasopressin in the Human Brain: Social Neuropeptides for Translational Medicine. Nat. Rev. Neurosci. 2011, 12, 524–538. [Google Scholar] [CrossRef]
- Di Napoli, A.; Warrier, V.; Baron-Cohen, S.; Chakrabarti, B. Genetic Variation in the Oxytocin Receptor (OXTR) Gene Is Associated with Asperger Syndrome. Mol. Autism 2014, 5, 48. [Google Scholar] [CrossRef]
- Camkurt, M.A.; Acar, Ş.; Coşkun, S.; Güneş, M.; Güneş, S.; Yilmaz, M.F.; Görür, A.; Tamer, L. Comparison of Plasma MicroRNA Levels in Drug Naive, First Episode Depressed Patients and Healthy Controls. J. Psychiatr. Res. 2015, 69, 67–71. [Google Scholar] [CrossRef]
- Chen, F.; Zou, L.; Dai, Y.; Sun, J.; Chen, C.; Zhang, Y.; Peng, Q.; Zhang, Z.; Xie, Z.; Wu, H.; et al. Prognostic Plasma Exosomal MicroRNA Biomarkers in Patients with Substance Use Disorders Presenting Comorbid with Anxiety and Depression. Sci. Rep. 2021, 11, 6271. [Google Scholar] [CrossRef]
- Al-Rawaf, H.A.; Alghadir, A.H.; Gabr, S.A. Circulating MicroRNAs and Molecular Oxidative Stress in Older Adults with Neuroprogression Disorders. Dis. Markers 2021, 2021, 4409212. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Sundquist, K.; Palmér, K.; Hedelius, A.; Memon, A.A.; Sundquist, J. Macrophage Migration Inhibitory Factor and MicroRNA-451a in Response to Mindfulness-Based Therapy or Treatment as Usual in Patients with Depression, Anxiety, or Stress and Adjustment Disorders. Int. J. Neuropsychopharmacol. 2018, 21, 513–521. [Google Scholar] [CrossRef] [PubMed]
- Hu, P.; Cao, Q.; Feng, H.; Liu, Y.; Chen, Y.; Xu, J.; Feng, W.; Sun, H.; Ding, H.; Wang, C.; et al. MicroRNA-451a Is a Candidate Biomarker and Therapeutic Target for Major Depressive Disorder. Gen. Psychiatr. 2024, 37, e101291. [Google Scholar] [CrossRef] [PubMed]
- Kuang, W.H.; Dong, Z.Q.; Tian, L.T.; Li, J. MicroRNA-451a, MicroRNA-34a-5p, and MicroRNA-221-3p as Predictors of Response to Antidepressant Treatment. Braz. J. Med. Biol. Res. 2018, 51, e7212. [Google Scholar] [CrossRef] [PubMed]
- Jun, C.; Choi, Y.; Lim, S.M.; Bae, S.; Hong, Y.S.; Kim, J.E.; Lyoo, I.K. Disturbance of the Glutamatergic System in Mood Disorders. Exp. Neurobiol. 2014, 23, 28. [Google Scholar] [CrossRef] [PubMed]
- Mahmoudi, E.; Cairns, M.J. MiR-137: An Important Player in Neural Development and Neoplastic Transformation. Mol. Psychiatry 2016, 22, 44–55. [Google Scholar] [CrossRef] [PubMed]
- Ou, M.L.; Liu, G.; Xiao, D.; Zhang, B.H.; Guo, C.C.; Ye, X.G.; Liu, Y.; Zhang, N.; Wang, M.; Han, Y.J.; et al. Association between MiR-137 Polymorphism and Risk of Schizophrenia: A Meta-Analysis. Genet. Mol. Res. 2016, 15, gmr.15038703. [Google Scholar] [CrossRef] [PubMed]
- Guella, I.; Sequeira, A.; Rollins, B.; Morgan, L.; Torri, F.; van Erp, T.G.M.; Myers, R.M.; Barchas, J.D.; Schatzberg, A.F.; Watson, S.J.; et al. Analysis of MiR-137 Expression and Rs1625579 in Dorsolateral Prefrontal Cortex. J. Psychiatr. Res. 2013, 47, 1215–1221. [Google Scholar] [CrossRef] [PubMed]
- Willemsen, M.H.; Vallès, A.; Kirkels, L.A.M.H.; Mastebroek, M.; Loohuis, N.O.; Kos, A.; Wissink-Lindhout, W.M.; de Brouwer, A.P.M.; Nillesen, W.M.; Pfundt, R.; et al. Chromosome 1p21.3 Microdeletions Comprising DPYD and MIR137 Are Associated with Intellectual Disability. J. Med. Genet. 2011, 48, 810–818. [Google Scholar] [CrossRef] [PubMed]
- Smalheiser, N.R.; Lugli, G.; Rizavi, H.S.; Torvik, V.I.; Turecki, G.; Dwivedi, Y. MicroRNA Expression Is Down-Regulated and Reorganized in Prefrontal Cortex of Depressed Suicide Subjects. PLoS ONE 2012, 7, e33201. [Google Scholar] [CrossRef]
- Whalley, H.C.; Papmeyer, M.; Romaniuk, L.; Sprooten, E.; Johnstone, E.C.; Hall, J.; Lawrie, S.M.; Evans, K.L.; Blumberg, H.P.; Sussmann, J.E.; et al. Impact of a MicroRNA MIR137 Susceptibility Variant on Brain Function in People at High Genetic Risk of Schizophrenia or Bipolar Disorder. Neuropsychopharmacology 2012, 37, 2720–2729. [Google Scholar] [CrossRef]
- Cummings, E.; Donohoe, G.; Hargreaves, A.; Moore, S.; Fahey, C.; Dinan, T.G.; McDonald, C.; O’Callaghan, E.; O’Neill, F.A.; Waddington, J.L.; et al. Mood Congruent Psychotic Symptoms and Specific Cognitive Deficits in Carriers of the Novel Schizophrenia Risk Variant at MIR-137. Neurosci. Lett. 2013, 532, 33–38. [Google Scholar] [CrossRef]
- Cheng, Y.; Wang, Z.M.; Tan, W.; Wang, X.; Li, Y.; Bai, B.; Li, Y.; Zhang, S.F.; Yan, H.L.; Chen, Z.L.; et al. Partial Loss of Psychiatric Risk Gene Mir137 in Mice Causes Repetitive Behavior and Impairs Sociability and Learning via Increased Pde10a. Nat. Neurosci. 2018, 21, 1689–1703. [Google Scholar] [CrossRef]
- Gunasekaran, S.; Jacob, R.S.; Omkumar, R.V. Differential Expression of MiR-148b, MiR-129-2 and MiR-296 in Animal Models of Schizophrenia-Relevance to NMDA Receptor Hypofunction. Neuropharmacology 2022, 210, 109024. [Google Scholar] [CrossRef]
- Endele, S.; Rosenberger, G.; Geider, K.; Popp, B.; Tamer, C.; Stefanova, I.; Milh, M.; Kortüm, F.; Fritsch, A.; Pientka, F.K.; et al. Mutations in GRIN2A and GRIN2B Encoding Regulatory Subunits of NMDA Receptors Cause Variable Neurodevelopmental Phenotypes. Nat. Genet. 2010, 42, 1021–1026. [Google Scholar] [CrossRef]
- Chen, L.; Shi, X.J.; Liu, H.; Mao, X.; Gui, L.N.; Wang, H.; Cheng, Y. Oxidative Stress Marker Aberrations in Children with Autism Spectrum Disorder: A Systematic Review and Meta-Analysis of 87 Studies (N = 9109). Transl. Psychiatry 2021, 11, 15. [Google Scholar] [CrossRef] [PubMed]
- Cuenod, M.; Steullet, P.; Cabungcal, J.H.; Dwir, D.; Khadimallah, I.; Klauser, P.; Conus, P.; Do, K.Q. Caught in Vicious Circles: A Perspective on Dynamic Feed-Forward Loops Driving Oxidative Stress in Schizophrenia. Mol. Psychiatry 2021, 27, 1886–1897. [Google Scholar] [CrossRef]
- Steullet, P.; Cabungcal, J.H.; Coyle, J.; Didriksen, M.; Gill, K.; Grace, A.A.; Hensch, T.K.; Lamantia, A.S.; Lindemann, L.; Maynard, T.M.; et al. Oxidative Stress-Driven Parvalbumin Interneuron Impairment as a Common Mechanism in Models of Schizophrenia. Mol. Psychiatry 2017, 22, 936–943. [Google Scholar] [CrossRef] [PubMed]
- Khadimallah, I.; Jenni, R.; Cabungcal, J.H.; Cleusix, M.; Fournier, M.; Beard, E.; Klauser, P.; Knebel, J.F.; Murray, M.M.; Retsa, C.; et al. Mitochondrial, Exosomal MiR137-COX6A2 and Gamma Synchrony as Biomarkers of Parvalbumin Interneurons, Psychopathology, and Neurocognition in Schizophrenia. Mol. Psychiatry 2022, 27, 1192–1204. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Xu, L.J.; Han, G.D.; Sun, H.L.; Zhu, G.T.; Jiang, H.T.; Yu, G.Y.; Tang, X.M. MiR-137 Attenuates Spinal Cord Injury by Modulating NEUROD4 through Reducing Inflammation and Oxidative Stress. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 1884–1890. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Li, Y.; Yu, G.; Ling, Z.; Zhong, K.; Zilundu, P.L.M.; Li, W.; Fu, R.; Zhou, L.H. MicroRNA-137-3p Protects PC12 Cells Against Oxidative Stress by Downregulation of Calpain-2 and NNOS. Cell Mol. Neurobiol. 2021, 41, 1373–1387. [Google Scholar] [CrossRef] [PubMed]
- Ma, K.; Zhang, H.; Wang, S.; Wang, H.; Wang, Y.; Liu, J.; Song, X.; Dong, Z.; Han, X.; Zhang, Y.; et al. The Molecular Mechanism Underlying GABAergic Dysfunction in Nucleus Accumbens of Depression-like Behaviours in Mice. J. Cell Mol. Med. 2019, 23, 7021–7028. [Google Scholar] [CrossRef] [PubMed]
- van der Zee, Y.Y.; Eijssen, L.M.T.; Mews, P.; Ramakrishnan, A.; Alvarez, K.; Lardner, C.K.; Cates, H.M.; Walker, D.M.; Torres-Berrío, A.; Browne, C.J.; et al. Blood MiR-144-3p: A Novel Diagnostic and Therapeutic Tool for Depression. Mol. Psychiatry 2022, 27, 4536–4549. [Google Scholar] [CrossRef]
- Fregeac, J.; Moriceau, S.; Poli, A.; Nguyen, L.S.; Oury, F.; Colleaux, L. Loss of the Neurodevelopmental Disease-Associated Gene MiR-146a Impairs Neural Progenitor Differentiation and Causes Learning and Memory Deficits. Mol. Autism 2020, 11, 22. [Google Scholar] [CrossRef]
- Nguyen, L.S.; Lepleux, M.; Makhlouf, M.; Martin, C.; Fregeac, J.; Siquier-Pernet, K.; Philippe, A.; Feron, F.; Gepner, B.; Rougeulle, C.; et al. Profiling Olfactory Stem Cells from Living Patients Identifies MiRNAs Relevant for Autism Pathophysiology. Mol. Autism 2016, 7, 1. [Google Scholar] [CrossRef]
- Bai, X.; Bian, Z. MicroRNA-21 Is a Versatile Regulator and Potential Treatment Target in Central Nervous System Disorders. Front. Mol. Neurosci. 2022, 15, 842288. [Google Scholar] [CrossRef]
- Garcia, G.; Pinto, S.; Ferreira, S.; Lopes, D.; Serrador, M.J.; Fernandes, A.; Vaz, A.R.; de Mendonça, A.; Edenhofer, F.; Malm, T.; et al. Emerging Role of MiR-21-5p in Neuron–Glia Dysregulation and Exosome Transfer Using Multiple Models of Alzheimer’s Disease. Cells 2022, 11, 3377. [Google Scholar] [CrossRef] [PubMed]
- Tannenbaum, C.; Ellis, R.P.; Eyssel, F.; Zou, J.; Schiebinger, L. Sex and Gender Analysis Improves Science and Engineering. Nature 2019, 575, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Huang, M.; Chen, L. Mechanism of MiR-132-3p Promoting Neuroinflammation and Dopaminergic Neurodegeneration in Parkinson’s Disease. eNeuro 2022, 9, e.0393-21.2021. [Google Scholar] [CrossRef]
- Ronovsky, M.; Zambon, A.; Cicvaric, A.; Boehm, V.; Hoesel, B.; Moser, B.A.; Yang, J.; Schmid, J.A.; Haubensak, W.E.; Monje, F.J.; et al. A Role for MiR-132 in Learned Safety. Sci. Rep. 2019, 9, 528. [Google Scholar] [CrossRef]
- Zou, H.; Ding, Y.; Wang, K.; Xiong, E.; Peng, W.; Du, F.; Zhang, Z.; Liu, J.; Gong, A. MicroRNA-29A/PTEN Pathway Modulates Neurite Outgrowth in PC12 Cells. Neuroscience 2015, 291, 289–300. [Google Scholar] [CrossRef]
- Caserta, S.; Gangemi, S.; Murdaca, G.; Allegra, A. Gender Differences and MiRNAs Expression in Cancer: Implications on Prognosis and Susceptibility. Int. J. Mol. Sci. 2023, 24, 11544. [Google Scholar] [CrossRef] [PubMed]
- Kraczkowska, W.; Stachowiak, L.; Pławski, A.; Jagodziński, P.P. Circulating MiRNA as Potential Biomarkers for Diabetes Mellitus Type 2: Should We Focus on Searching for Sex Differences? J. Appl. Genet. 2022, 63, 293. [Google Scholar] [CrossRef]
- Florijn, B.W.; Bijkerk, R.; Kruyt, N.D.; Van Zonneveld, A.J.; Wermer, M.J.H. Sex-Specific MicroRNAs in Neurovascular Units in Ischemic Stroke. Int. J. Mol. Sci. 2021, 22, 11888. [Google Scholar] [CrossRef] [PubMed]
- Riecher-Rössler, A. Sex and Gender Differences in Mental Disorders. Lancet Psychiatry 2017, 4, 8–9. [Google Scholar] [CrossRef] [PubMed]
- Kabekkodu, S.P.; Shukla, V.; Varghese, V.K.; D’Souza, J.; Chakrabarty, S.; Satyamoorthy, K. Clustered MiRNAs and Their Role in Biological Functions and Diseases. Biol. Rev. 2018, 93, 1955–1986. [Google Scholar] [CrossRef] [PubMed]
- Rupaimoole, R.; Slack, F.J. MicroRNA Therapeutics: Towards a New Era for the Management of Cancer and Other Diseases. Nat. Rev. Drug Discov. 2017, 16, 203–222. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, C.; Sharma, A.R.; Sharma, G.; Lee, S.S. Therapeutic Advances of MiRNAs: A Preclinical and Clinical Update. J. Adv. Res. 2021, 28, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Lanford, R.E.; Hildebrandt-Eriksen, E.S.; Petri, A.; Persson, R.; Lindow, M.; Munk, M.E.; Kauppinen, S.; Rum, H. Therapeutic Silencing of MicroRNA-122 in Primates with Chronic Hepatitis C Virus Infection. Science 2010, 327, 198–201. [Google Scholar] [CrossRef] [PubMed]
- Janssen, H.L.A.; Reesink, H.W.; Lawitz, E.J.; Zeuzem, S.; Rodriguez-Torres, M.; Patel, K.; van der Meer, A.J.; Patick, A.K.; Chen, A.; Zhou, Y.; et al. Treatment of HCV Infection by Targeting MicroRNA. N. Engl. J. Med. 2013, 368, 1685–1694. [Google Scholar] [CrossRef]
- Barbosa, M.; Santos, M.; de Sousa, N.; Duarte-Silva, S.; Vaz, A.R.; Salgado, A.J.; Brites, D. Intrathecal Injection of the Secretome from ALS Motor Neurons Regulated for MiR-124 Expression Prevents Disease Outcomes in SOD1-G93A Mice. Biomedicines 2022, 10, 2120. [Google Scholar] [CrossRef]
- Bizzotto, S.; Walsh, C.A. Genetic Mosaicism in the Human Brain: From Lineage Tracing to Neuropsychiatric Disorders. Nat. Rev. Neurosci. 2022, 23, 275–286. [Google Scholar] [CrossRef]
- Miller, D.D.; Andreasen, N.C.; O’Leary, D.S.; Watkins, G.L.; Boles Ponto, L.L.; Hichwa, R.D. Comparison of the Effects of Risperidone and Haloperidol on Regional Cerebral Blood Flow in Schizophrenia. Biol Psychiatry 2001, 49, 704–715. [Google Scholar] [CrossRef]
- Jutla, A.; Foss-Feig, J.; Veenstra-Vanderweele, J. Autism Spectrum Disorder and Schizophrenia: An Updated Conceptual Review HHS Public Access. Autism Res. 2022, 15, 384–412. [Google Scholar] [CrossRef] [PubMed]
- Issler, O.; Chen, A. Determining the Role of MicroRNAs in Psychiatric Disorders. Nat. Rev. Neurosci. 2015, 16, 201–212. [Google Scholar] [CrossRef] [PubMed]
- Friedman, R.C.; Farh, K.K.H.; Burge, C.B.; Bartel, D.P. Most Mammalian MRNAs Are Conserved Targets of MicroRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef] [PubMed]
- Meyer, U.; Feldon, J.; Dammann, O. Schizophrenia and Autism: Both Shared and Disorder-Specific Pathogenesis Via Perinatal Inflammation? Pediatr. Res. 2011, 69, 26–33. [Google Scholar] [CrossRef]
- Powell, S.B.; Sejnowski, T.J.; Behrens, M.M. Behavioral and Neurochemical Consequences of Cortical Oxidative Stress on Parvalbumin-Interneuron Maturation in Rodent Models of Schizophrenia. Neuropharmacology 2012, 62, 1322–1331. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Morris, T.P.; White, I.R.; Royston, P. Tuning Multiple Imputation by Predictive Mean Matching and Local Residual Draws. BMC Med. Res. Methodol. 2014, 14, 75. [Google Scholar] [CrossRef]
- Chang, L.; Zhou, G.; Soufan, O.; Xia, J. MiRNet 2.0: Network-Based Visual Analytics for MiRNA Functional Analysis and Systems Biology. Nucleic Acids Res. 2020, 48, W244. [Google Scholar] [CrossRef]
miRNAs | Target Sequence (5′ to 3′) |
---|---|
hsa-miR-451a (conserved) | AAACCGUUACCAUUACUGAGUU |
hsa-miR-144-3p (conserved) | UACAGUAUAGAUGAUGUACU |
hsa-miR-21-5p (conserved) | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-146a-5p (conserved) | UGAGAACUGAAUUCCAUGGGUU |
mmu-miR-92a-2-5p (not conserved) | AGGUGGGGAUUGGUGGCAUUAC |
hsa-miR-486-3p (conserved) | CGGGGCAGCUCAGUACAGGAU |
hsa-miR-137-3p (conserved) | UUAUUGCUUAAGAAUACGCGUAG |
hsa-miR-132-3p (conserved) | UAACAGUCUACAGCCAUGGUCG |
mmu-miR-SNORD110 | (Reference sequence) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
García-Cerro, S.; Gómez-Garrido, A.; Garcia, G.; Crespo-Facorro, B.; Brites, D. Exploratory Analysis of MicroRNA Alterations in a Neurodevelopmental Mouse Model for Autism Spectrum Disorder and Schizophrenia. Int. J. Mol. Sci. 2024, 25, 2786. https://doi.org/10.3390/ijms25052786
García-Cerro S, Gómez-Garrido A, Garcia G, Crespo-Facorro B, Brites D. Exploratory Analysis of MicroRNA Alterations in a Neurodevelopmental Mouse Model for Autism Spectrum Disorder and Schizophrenia. International Journal of Molecular Sciences. 2024; 25(5):2786. https://doi.org/10.3390/ijms25052786
Chicago/Turabian StyleGarcía-Cerro, Susana, Ana Gómez-Garrido, Gonçalo Garcia, Benedicto Crespo-Facorro, and Dora Brites. 2024. "Exploratory Analysis of MicroRNA Alterations in a Neurodevelopmental Mouse Model for Autism Spectrum Disorder and Schizophrenia" International Journal of Molecular Sciences 25, no. 5: 2786. https://doi.org/10.3390/ijms25052786