A Preliminary Investigation of the Roles of Endometrial Cells in Endometriosis Development via In Vitro and In Vivo Analyses
Abstract
:1. Introduction
2. Results
2.1. Characterization of Isolated Primary ECs
2.2. Effects of LPS Stimulation on Proliferation, Inflammation, and Fibrosis in Rat ECs In Vitro
2.3. Characteristics and Size of Lesions in the Peritoneal Cavity and Peritoneum of the Rat Endometriosis Models
2.4. Effect of Estradiol Solution on the Body Weight of Ectopic Endometriosis-like Lesion Rat Model
2.5. IHC Evaluation of Endometriotic Lesions in Two Ectopic Endometriosis-like Lesion Rat Models
2.6. Effects of Estrogen on Cell Proliferation, Angiogenesis, Fibrosis, and Inflammation-Associated Genes in the Ectopic Endometriosis-like Lesion Rat Models
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Preparation of Primary Rat Uterine ECs
4.3. Flow Cytometric Analysis of ECs
4.4. LPS Stimulation of Primary Rat Uterine ECs
4.5. Establishment of Two Rat Endometriosis Models
4.6. RNA Extraction, Reverse Transcription (RT), and Quantitative Polymerase Chain Reaction (qPCR)
4.7. Western Blotting
4.8. Immunohistochemical (IHC) Staining
4.9. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Culley, L.; Law, C.; Hudson, N.; Denny, E.; Mitchell, H.; Baumgarten, M.; Raine-Fenning, N. The social and psychological impact of endometriosis on women’s lives: A critical narrative review. Hum. Reprod. Update 2013, 19, 625–639. [Google Scholar] [CrossRef] [PubMed]
- Damewood, M.; Kresch, A.J.; Metzger, D.; Begany, T. Current approaches to endometriosis. Patient Care 1997, 31, 34–43. [Google Scholar]
- Gao, X.; Yeh, Y.C.; Outley, J.; Simon, J.; Botteman, M.; Spalding, J. Health-related quality of life burden of women with endometriosis: A literature review. Curr. Med. Res. Opin. 2006, 22, 1787–1797. [Google Scholar] [CrossRef]
- Giudice, L.C.; Kao, L.C. Endometriosis. Lancet 2004, 364, 1789–1799. [Google Scholar] [CrossRef] [PubMed]
- Dückelmann, A.M.; Taube, E.; Abesadze, E.; Chiantera, V.; Sehouli, J.; Mechsner, S. When and how should peritoneal endometriosis be operated on in order to improve fertility rates and symptoms? The experience and outcomes of nearly 100 cases. Arch. Gynecol. Obstet. 2021, 304, 143–155. [Google Scholar] [CrossRef] [PubMed]
- Meyer, R. Zur Frage der heterotopen Epithelwucherung, insbesondere des Peritonealepithels und in den Ovarien. Virchows Arch. Pathol. Anat. Physiol. Klin. Med. 1924, 250, 595–610. [Google Scholar] [CrossRef]
- Martinez-Roman, S.; Balasch, J.; Creus, M.; Fabregues, F.; Carmona, F.; Vilella, R.; Vanrell, J.A. Immunological factors in endometriosis-associated reproductive failure: Studies in fertile and infertile women with and without endometriosis. Hum. Reprod. 1997, 12, 1794–1799. [Google Scholar] [CrossRef]
- Braun, D.P.; Dmowski, W.P. Endometriosis: Abnormal endometrium and dysfunctional immune response. Curr. Opin. Obstet. Gynecol. 1998, 10, 365–369. [Google Scholar] [CrossRef]
- Oosterlynck, D.J.; Cornillie, F.J.; Waer, M.; Vandeputte, M.; Koninckx, P.R. Women with endometriosis show a defect in natural killer activity resulting in a decreased cytotoxicity to autologous endometrium. Fertil. Steril. 1991, 56, 45–51. [Google Scholar] [CrossRef]
- Zondervan, K.T.; Cardon, L.R.; Kennedy, S.H. The genetic basis of endometriosis. Curr. Opin. Obstet. Gynecol. 2001, 13, 309–314. [Google Scholar] [CrossRef]
- Pelch, K.E.; Schroder, A.L.; Kimball, P.A.; Sharpe-Timms, K.L.; Davis, J.W.; Nagel, S.C. Aberrant gene expression profile in a mouse model of endometriosis mirrors that observed in women. Fertil. Steril. 2010, 93, 1615–1627. [Google Scholar] [CrossRef] [PubMed]
- Bailey, M.T.; Coe, C.L. Endometriosis is associated with an altered profile of intestinal microflora in female rhesus monkeys. Hum. Reprod. 2002, 17, 1704–1708. [Google Scholar] [CrossRef] [PubMed]
- Sheldon, I.M.; Dobson, H. Postpartum uterine health in cattle. Anim. Reprod. Sci. 2004, 82–83, 295–306. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Gomez, E.; Vazquez-Martinez, E.R.; Reyes-Mayoral, C.; Cruz-Orozco, O.P.; Camacho-Arroyo, I.; Cerbon, M. Regulation of inflammation pathways and inflammasome by sex steroid hormones in endometriosis. Front. Endocrinol. 2019, 10, 935. [Google Scholar] [CrossRef] [PubMed]
- Farhana, A.; Khan, Y.S. Biochemistry, Lipopolysaccharide; Ineligible Companies; Disclosure: Yusuf Khan Declares no Relevant Financial Relationships with Ineligible Companies; StatPearls: Treasure Island, FL, USA, 2023. [Google Scholar]
- Khan, K.N.; Fujishita, A.; Hiraki, K.; Kitajima, M.; Nakashima, M.; Fushiki, S.; Kitawaki, J. Bacterial contamination hypothesis: A new concept in endometriosis. Reprod. Med. Biol. 2018, 17, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wu, Z.M.; Yang, Y.P.; Shaukat, A.; Yang, J.; Guo, Y.F.; Zhang, T.; Zhu, X.Y.; Qiu, J.X.; Deng, G.Z.; et al. Catalpol ameliorates LPS-induced endometritis by inhibiting inflammation and TLR4/NF-kappaB signaling. J. Zhejiang Univ. Sci. B 2019, 20, 816–827. [Google Scholar] [CrossRef] [PubMed]
- Azuma, Y.; Taniguchi, F.; Nakamura, K.; Nagira, K.; Khine, Y.M.; Kiyama, T.; Uegaki, T.; Izawa, M.; Harada, T. Lipopolysaccharide promotes the development of murine endometriosis-like lesions via the nuclear factor-kappa B pathway. Am. J. Reprod. Immunol. 2017, 77, e12631. [Google Scholar] [CrossRef] [PubMed]
- Khan, K.N.; Kitajima, M.; Inoue, T.; Fujishita, A.; Nakashima, M.; Masuzaki, H. 17beta-estradiol and lipopolysaccharide additively promote pelvic inflammation and growth of endometriosis. Reprod. Sci. 2015, 22, 585–594. [Google Scholar] [CrossRef] [PubMed]
- Iba, Y.; Harada, T.; Horie, S.; Deura, I.; Iwabe, T.; Terakawa, N. Lipopolysaccharide-promoted proliferation of endometriotic stromal cells via induction of tumor necrosis factor alpha and interleukin-8 expression. Fertil. Steril. 2004, 82 (Suppl. S3), 1036–1042. [Google Scholar] [CrossRef]
- Yao, Y.; Chen, R.; Wang, G.; Zhang, Y.; Liu, F. Exosomes derived from mesenchymal stem cells reverse EMT via TGF-beta1/Smad pathway and promote repair of damaged endometrium. Stem Cell Res. Ther. 2019, 10, 225. [Google Scholar] [CrossRef]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef]
- Khan, K.N.; Kitajima, M.; Hiraki, K.; Yamaguchi, N.; Katamine, S.; Matsuyama, T.; Nakashima, M.; Fujishita, A.; Ishimaru, T.; Masuzaki, H. Escherichia coli contamination of menstrual blood and effect of bacterial endotoxin on endometriosis. Fertil. Steril. 2010, 94, 2860–2863. [Google Scholar] [CrossRef] [PubMed]
- Dohmen, M.J.; Joop, K.; Sturk, A.; Bols, P.E.; Lohuis, J.A. Relationship between intra-uterine bacterial contamination, endotoxin levels and the development of endometritis in postpartum cows with dystocia or retained placenta. Theriogenology 2000, 54, 1019–1032. [Google Scholar] [CrossRef]
- Yu, K.; Huang, Z.Y.; Xu, X.L.; Li, J.; Fu, X.W.; Deng, S.L. Estrogen receptor function: Impact on the human endometrium. Front. Endocrinol 2022, 13, 827724. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Xie, H.; Wu, J.; Liu, D.; Yao, S. Villainous role of estrogen in macrophage-nerve interaction in endometriosis. Reprod. Biol. Endocrinol. 2018, 16, 122. [Google Scholar] [CrossRef]
- Horvath, G.; Leser, G.; Hahlin, M.; Henriksson, M. Exon deletions and variants of human estrogen receptor mRNA in endometrial hyperplasia and adenocarcinoma. Int. J. Gynecol. Cancer. 2000, 10, 128–136. [Google Scholar] [CrossRef] [PubMed]
- Iwabe, T.; Harada, T.; Terakawa, N. Role of cytokines in endometriosis-associated infertility. Gynecol. Obstet. Invest. 2002, 53 (Suppl. S1), 19–25. [Google Scholar] [CrossRef]
- Nanda, A.; Thangapandi, K.; Banerjee, P.; Dutta, M.; Wangdi, T.; Sharma, P.; Chaudhury, K.; Jana, S.K. Cytokines, angiogenesis, and extracellular matrix degradation are augmented by oxidative stress in endometriosis. Ann. Lab. Med. 2020, 40, 390–397. [Google Scholar] [CrossRef]
- Bedaiwy, M.A.; Falcone, T.; Sharma, R.K.; Goldberg, J.M.; Attaran, M.; Nelson, D.R.; Agarwal, A. Prediction of endometriosis with serum and peritoneal fluid markers: A prospective controlled trial. Hum. Reprod. 2002, 17, 426–431. [Google Scholar] [CrossRef]
- Wang, D.; Liu, Y.; Han, J.; Zai, D.; Ji, M.; Cheng, W.; Xu, L.; Yang, L.; He, M.; Ni, J.; et al. Puerarin suppresses invasion and vascularization of endometriosis tissue stimulated by 17beta-estradiol. PLoS ONE 2011, 6, e25011. [Google Scholar] [CrossRef]
- De Clercq, K.; Hennes, A.; Vriens, J. Isolation of mouse endometrial epithelial and stromal cells for In vitro decidualization. J. Vis. Exp. 2017, 2, e55168. [Google Scholar] [CrossRef]
- Pritts, E.A.; Taylor, R.N. An evidence-based evaluation of endometriosis-associated infertility. Endocrinol. Metab. Clin. N. Am. 2003, 32, 653–667. [Google Scholar] [CrossRef] [PubMed]
- Meyer, R. Uber den stand der frage der adenomyositis und adenomyome im allgemeinen und insbesondere uber adenomyositis seroepithelialis und adenomyometritis sarcomatosa. Zentralbl. Gynakol. 1919, 36, 745–750. [Google Scholar]
- Sampson, J.A. Peritoneal Endometriosis Due to the Menstrual Dissemination of Endometrial Tissue into the Peritoneal Cavity. Am. J. Obstet. Gynecol. 1927, 14, 442–469. [Google Scholar] [CrossRef]
- Levander, G.; Normann, P. The pathogenesis of endometriosis; an experimental study. Acta Obstet. Gynecol. Scand. 1955, 34, 366–398. [Google Scholar] [CrossRef] [PubMed]
- Treloar, S.; Hadfield, R.; Montgomery, G.; Lambert, A.; Wicks, J.; Barlow, D.H.; O’Connor, D.T.; Kennedy, S.; the International Endogene Study Group. The International endogene study: A collection of families for genetic research in endometriosis. Fertil. Steril. 2002, 78, 679–685. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, S. Genetics of endometriosis: A review of the positional cloning approaches. Semin. Reprod. Med. 2003, 21, 111–118. [Google Scholar] [CrossRef] [PubMed]
- Bischoff, F.Z.; Simpson, J.L. Heritability and molecular genetic studies of endometriosis. Hum. Reprod. Update 2000, 6, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Dmowski, W.P.; Steele, R.W.; Baker, G.F. Deficient cellular immunity in endometriosis. Am. J. Obstet. Gynecol. 1981, 141, 377–383. [Google Scholar] [CrossRef]
- Sikora, J.; Mielczarek-Palacz, A.; Kondera-Anasz, Z. Role of natural killer cell activity in the pathogenesis of endometriosis. Curr. Med. Chem. 2011, 18, 200–208. [Google Scholar] [CrossRef]
- Osuga, Y.; Koga, K.; Hirota, Y.; Hirata, T.; Yoshino, O.; Taketani, Y. Lymphocytes in endometriosis. Am. J. Reprod. Immunol. 2011, 65, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.; Agarwal, A.; Krajcir, N.; Alvarez, J.G. Role of oxidative stress in endometriosis. Reprod. Biomed. Online 2006, 13, 126–134. [Google Scholar] [CrossRef]
- Lebovic, D.I.; Mueller, M.D.; Taylor, R.N. Immunobiology of endometriosis. Fertil. Steril. 2001, 75, 1–10. [Google Scholar] [CrossRef]
- Augoulea, A.; Alexandrou, A.; Creatsa, M.; Vrachnis, N.; Lambrinoudaki, I. Pathogenesis of endometriosis: The role of genetics, inflammation and oxidative stress. Arch. Gynecol. Obstet. 2012, 286, 99–103. [Google Scholar] [CrossRef]
- Parente Barbosa, C.; Bentes De Souza, A.M.; Bianco, B.; Christofolini, D.M. The effect of hormones on endometriosis development. Minerva Ginecol. 2011, 63, 375–386. [Google Scholar] [PubMed]
- Attia, G.R.; Zeitoun, K.; Edwards, D.; Johns, A.; Carr, B.R.; Bulun, S.E. Progesterone receptor isoform A but not B is expressed in endometriosis. J. Clin. Endocrinol. Metab. 2000, 85, 2897–2902. [Google Scholar] [CrossRef]
- Hapangama, D.K.; Turner, M.A.; Drury, J.A.; Quenby, S.; Hart, A.; Maddick, M.; Martin-Ruiz, C.; von Zglinicki, T. Sustained replication in endometrium of women with endometriosis occurs without evoking a DNA damage response. Hum. Reprod. 2009, 24, 687–696. [Google Scholar] [CrossRef]
- Hapangama, D.K.; Turner, M.A.; Drury, J.; Heathcote, L.; Afshar, Y.; Mavrogianis, P.A.; Fazleabas, A.T. Aberrant expression of regulators of cell-fate found in eutopic endometrium is found in matched ectopic endometrium among women and in a baboon model of endometriosis. Hum. Reprod. 2010, 25, 2840–2850. [Google Scholar] [CrossRef] [PubMed]
- Ferryman, S.R.; Rollason, T.P. Pathology of the uterine body. Curr. Opin. Obstet. Gynecol. 1994, 6, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, F.; Kaponis, A.; Izawa, M.; Kiyama, T.; Deura, I.; Ito, M.; Iwabe, T.; Adonakis, G.; Terakawa, N.; Harada, T. Apoptosis and endometriosis. Front. Biosci. (Elite Ed.) 2011, 3, 648–662. [Google Scholar] [CrossRef]
- Rier, S.E.; Martin, D.C.; Bowman, R.E.; Dmowski, W.P.; Becker, J.L. Endometriosis in rhesus monkeys (Macaca mulatta) following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Fundam. Appl. Toxicol. 1993, 21, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Koninckx, P.R.; Braet, P.; Kennedy, S.H.; Barlow, D.H. Dioxin pollution and endometriosis in Belgium. Hum. Reprod. 1994, 9, 1001–1002. [Google Scholar] [CrossRef] [PubMed]
- Myers, J.; Guillette, L., Jr.; Palanza, P.; Parmigiani, S.; Swan, S.; SAAL, F.V. The emerging science of endocrine disruption. In Proceedings of the International Seminar on Nuclear War and Planetary Emergencies, 28th Session, Erice, Italy, 20–15 May 2003. Science and Culture Series. [Google Scholar]
- Fanton, J.W.; Golden, J.G. Radiation-induced endometriosis in Macaca mulatta. Radiat. Res. 1991, 126, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Zondervan, K.T.; Becker, C.M.; Koga, K.; Missmer, S.A.; Taylor, R.N.; Vigano, P. Endometriosis. Nat. Rev. Dis. Primers 2018, 4, 1–25. [Google Scholar] [CrossRef]
- Taylor, H.S.; Giudice, L.C.; Lessey, B.A.; Abrao, M.S.; Kotarski, J.; Archer, D.F.; Diamond, M.P.; Surrey, E.; Johnson, N.P.; Watts, N.B.; et al. Treatment of endometriosis-associated pain with elagolix, an oral GnRH antagonist. N. Engl. J. Med. 2017, 377, 28–40. [Google Scholar] [CrossRef] [PubMed]
- Vercellini, P.; Vigano, P.; Somigliana, E.; Fedele, L. Endometriosis: Pathogenesis and treatment. Nat. Rev. Endocrinol. 2014, 10, 261–275. [Google Scholar] [CrossRef] [PubMed]
- Elliott, L.; McMahon, K.J.; Gier, H.T.; Marion, G.B. Uterus of the cow after parturition: Bacterial content. Am. J. Vet. Res. 1968, 29, 77–81. [Google Scholar] [PubMed]
- Svensson, A.; Brunkwall, L.; Roth, B.; Orho-Melander, M.; Ohlsson, B. Associations between endometriosis and gut microbiota. Reprod. Sci. 2021, 28, 2367–2377. [Google Scholar] [CrossRef]
- Muraoka, A.; Suzuki, M.; Hamaguchi, T.; Watanabe, S.; Iijima, K.; Murofushi, Y.; Shinjo, K.; Osuka, S.; Hariyama, Y.; Ito, M. Fusobacterium infection facilitates the development of endometriosis through the phenotypic transition of endometrial fibroblasts. Sci. Transl. Med. 2023, 15, 1531. [Google Scholar] [CrossRef]
- Hou, H.T.; Lin, T.C.; Wu, M.H.; Tsai, S.J. Feel so bac: Is Fusobacterium the suspect causing endometriosis? Trends Mol. Med. 2023, 29, 780–782. [Google Scholar] [CrossRef]
- Bonnett, B.; Martin, S. Path analysis of peripartum and postpartum events, rectal palpation findings, endometrial biopsy results and reproductive performance in Holstein-Friesian dairy cows. Prev. Vet. Med. 1995, 21, 279–288. [Google Scholar] [CrossRef]
- Huszenicza, G.; Fodor, M.; Gacs, M.; Kulcsar, M.; Dohmen, M.; Vamos, M.; Porkolab, L.; Kegl, T.; Bartyik, J.; Lohuis, J. Uterine bacteriology, resumption of cyclic ovarian activity and fertility in postpartum cows kept in large-scale dairy herds. Reprod. Domest. Anim. 1999, 34, 237–245. [Google Scholar] [CrossRef]
- Carneiro, L.C.; Cronin, J.G.; Sheldon, I.M. Mechanisms linking bacterial infections of the bovine endometrium to disease and infertility. Reprod. Biol. 2016, 16, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Ramos, R.; Defrere, S.; Devoto, L. Nuclear factor-kappaB: A main regulator of inflammation and cell survival in endometriosis pathophysiology. Fertil. Steril. 2012, 98, 520–528. [Google Scholar] [CrossRef] [PubMed]
- Rhodus, N.L.; Cheng, B.; Myers, S.; Miller, L.; Ho, V.; Ondrey, F. The feasibility of monitoring NF-kappaB associated cytokines: TNF-alpha, IL-1alpha, IL-6, and IL-8 in whole saliva for the malignant transformation of oral lichen planus. Mol. Carcinog. 2005, 44, 77–82. [Google Scholar]
- Tak, P.P.; Firestein, G.S. NF-kappaB: A key role in inflammatory diseases. J. Clin. Invest. 2001, 107, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-H.; Yang, Y.-I.; Lee, K.-T.; Park, H.-J.; Choi, J.-H. Costunolide induces apoptosis in human endometriotic cells through inhibition of the prosurvival Akt and nuclear factor kappa B signaling pathway. Biol. Pharm. Bull. 2011, 34, 580–585. [Google Scholar] [CrossRef] [PubMed]
- Dolcet, X.; Llobet, D.; Encinas, M.; Pallares, J.; Cabero, A.; Schoenenberger, J.A.; Comella, J.X.; Matias-Guiu, X. Proteasome inhibitors induce death but activate NF-kappaB on endometrial carcinoma cell lines and primary culture explants. J. Biol. Chem. 2006, 281, 22118–22130. [Google Scholar] [CrossRef] [PubMed]
- Horie, S.; Harada, T.; Mitsunari, M.; Taniguchi, F.; Iwabe, T.; Terakawa, N. Progesterone and progestational compounds attenuate tumor necrosis factor alpha–induced interleukin-8 production via nuclear factor kappaB inactivation in endometriotic stromal cells. Fertil. Steril. 2005, 83, 1530–1535. [Google Scholar] [CrossRef]
- Wieser, F.; Vigne, J.L.; Ryan, I.; Hornung, D.; Djalali, S.; Taylor, R.N. Sulindac suppresses nuclear factor-kappaB activation and RANTES gene and protein expression in endometrial stromal cells from women with endometriosis. J. Clin. Endocrinol. Metab. 2005, 90, 6441–6447. [Google Scholar] [CrossRef]
- Lebovic, D.I.; Chao, V.A.; Martini, J.-F.o.; Taylor, R.N. IL-1β induction of RANTES (regulated upon activation, normal T cell expressed and secreted) chemokine gene expression in endometriotic stromal cells depends on a nuclear factor-κB site in the proximal promoter. J. Clin. Endocrinol. Metab. 2001, 86, 4759–4764. [Google Scholar] [CrossRef] [PubMed]
- Lei, S.; Cao, Y.; Sun, J.; Li, M.; Zhao, D. H(2)S promotes proliferation of endometrial stromal cells via activating the NF-kappaB pathway in endometriosis. Am. J. Transl. Res. 2018, 10, 4247–4257. [Google Scholar] [PubMed]
- Wei, X.; Shao, X. Nobiletin alleviates endometriosis via down-regulating NF-kappaB activity in endometriosis mouse model. Biosci. Rep. 2018, 38, BSR20180470. [Google Scholar] [CrossRef]
- Gonzalez-Ramos, R.; Van Langendonckt, A.; Defrere, S.; Lousse, J.C.; Mettlen, M.; Guillet, A.; Donnez, J. Agents blocking the nuclear factor-kappaB pathway are effective inhibitors of endometriosis in an in vivo experimental model. Gynecol. Obstet. Invest. 2008, 65, 174–186. [Google Scholar] [CrossRef]
- González-Ramos, R.; Donnez, J.; Defrère, S.; Leclercq, I.; Squifflet, J.; Lousse, J.-C.; Van Langendonckt, A. Nuclear factor-kappa B is constitutively activated in peritoneal endometriosis. Mol. Hum. Reprod. 2007, 13, 503–509. [Google Scholar] [CrossRef] [PubMed]
- Celik, O.; Ersahin, A.; Acet, M.; Celik, N.; Baykus, Y.; Deniz, R.; Ozerol, E.; Ozerol, I. Disulfiram, as a candidate NF-kappaB and proteasome inhibitor, prevents endometriotic implant growing in a rat model of endometriosis. Eur. Rev. Med. Pharmacol. Sci. 2016, 20, 4380–4389. [Google Scholar]
- Page, M.; Tuckerman, E.M.; Li, T.C.; Laird, S.M. Expression of nuclear factor kappa B components in human endometrium. J. Reprod. Immunol. 2002, 54, 1–13. [Google Scholar] [CrossRef]
- King, A.E.; Collins, F.; Klonisch, T.; Sallenave, J.M.; Critchley, H.O.; Saunders, P.T. An additive interaction between the NFkappaB and estrogen receptor signalling pathways in human endometrial epithelial cells. Hum. Reprod. 2010, 25, 510–518. [Google Scholar] [CrossRef]
- Takenaka, Y.; Taniguchi, F.; Miyakoda, H.; Takai, E.; Terakawa, N.; Harada, T. Lipopolysaccharide promoted proliferation and invasion of endometriotic stromal cells via induction of cyclooxygenase-2 expression. Fertil. Steril. 2010, 93, 325–327. [Google Scholar] [CrossRef]
- Miyamoto, A.; Taniguchi, F.; Tagashira, Y.; Watanabe, A.; Harada, T.; Terakawa, N. TNFalpha gene silencing reduced lipopolysaccharide-promoted proliferation of endometriotic stromal cells. Am. J. Reprod. Immunol. 2009, 61, 277–285. [Google Scholar] [CrossRef]
- Agarwal, A.; Aponte-Mellado, A.; Premkumar, B.J.; Shaman, A.; Gupta, S. The effects of oxidative stress on female reproduction: A review. Reprod. Biol. Endocrinol. 2012, 10, 49. [Google Scholar] [CrossRef] [PubMed]
- Gargett, C.E.; Lederman, F.; Heryanto, B.; Gambino, L.S.; Rogers, P.A. Focal vascular endothelial growth factor correlates with angiogenesis in human endometrium. Role of intravascular neutrophils. Hum. Reprod. 2001, 16, 1065–1075. [Google Scholar] [CrossRef] [PubMed]
- Ho, H.N.; Wu, M.Y.; Chao, K.H.; Chen, C.D.; Chen, S.U.; Chen, H.F.; Yang, Y.S. Decrease in interferon gamma production and impairment of T-lymphocyte proliferation in peritoneal fluid of women with endometriosis. Am. J. Obstet. Gynecol. 1996, 175, 1236–1241. [Google Scholar] [CrossRef] [PubMed]
- McLaren, J.; Prentice, A.; Charnock-Jones, D.S.; Smith, S.K. Vascular endothelial growth factor (VEGF) concentrations are elevated in peritoneal fluid of women with endometriosis. Hum. Reprod. 1996, 11, 220–223. [Google Scholar] [CrossRef] [PubMed]
- Shin, M.R.; Kang, S.K.; Kim, Y.S.; Lee, S.Y.; Hong, S.C.; Kim, E.C. TNF-alpha and LPS activate angiogenesis via VEGF and SIRT1 signalling in human dental pulp cells. Int. Endod. J. 2015, 48, 705–716. [Google Scholar] [CrossRef]
- Mehedintu, C.; Antonovici, M.; Brinduse, L.; Bratila, E.; Stanculescu, R.; Berceanu, C.; Bratu, O.; Pituru, S.; Onofriescu, M.; Matasariu, D.R. The influence of progesterone on immunohystochemical markers in endometriosis. Rev. Chim. 2018, 69, 581–584. [Google Scholar] [CrossRef]
- Nguyen, T.T.; Hachisuga, T.; Urabe, R.; Ueda, T.; Kurita, T.; Kagami, S.; Kawagoe, T.; Hisaoka, M. Immunohistochemical analysis of the effect of dienogest on ovarian endometriotic cysts. J. UOEH 2016, 38, 271–278. [Google Scholar] [CrossRef]
- Cheng, F.; Shen, Y.; Mohanasundaram, P.; Lindström, M.; Ivaska, J.; Ny, T.; Eriksson, J.E. Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF-β–Slug signaling. Proc. Natl. Acad. Sci. USA 2016, 113, 4320–4327. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Zhang, L.; Zhan, H.; Mo, Y.; Ren, Z.; Shao, A.; Lin, J. Single-cell transcriptomic analysis of endometriosis provides insights into fibroblast fates and immune cell heterogeneity. Cell Biosci. 2021, 11, 125. [Google Scholar] [CrossRef]
- Kim, B.G.; Malek, E.; Choi, S.H.; Ignatz-Hoover, J.J.; Driscoll, J.J. Novel therapies emerging in oncology to target the TGF-beta pathway. J. Hematol. Oncol. 2021, 14, 55. [Google Scholar] [CrossRef]
- Chegini, N.; Gold, L.I.; Williams, R.S. Localization of transforming growth factor beta isoforms TGF-beta 1, TGF-beta 2, and TGF-beta 3 in surgically induced endometriosis in the rat. Obstet. Gynecol. 1994, 83, 455–461. [Google Scholar] [PubMed]
- Liu, Z.; Yi, L.; Du, M.; Gong, G.; Zhu, Y. Overexpression of TGF-beta enhances the migration and invasive ability of ectopic endometrial cells via ERK/MAPK signaling pathway. Exp. Ther. Med. 2019, 17, 4457–4464. [Google Scholar] [CrossRef] [PubMed]
- Fosslien, E. Cancer morphogenesis: Role of mitochondrial failure. Ann. Clin. Lab. Sci. 2008, 38, 307–329. [Google Scholar] [PubMed]
- Li, C.L.; Leng, J.H.; Li, M.H.; Shi, J.H.; Jia, S.Z.; Lang, J.H. Expressions and roles of TGFbeta/Smad signal pathway in peritoneum of endometriosis. Zhonghua Fu Chan Ke Za Zhi 2011, 46, 826–830. [Google Scholar] [PubMed]
- Hull, M.L.; Johan, M.Z.; Hodge, W.L.; Robertson, S.A.; Ingman, W.V. Host-derived TGFB1 deficiency suppresses lesion development in a mouse model of endometriosis. Am. J. Pathol. 2012, 180, 880–887. [Google Scholar] [CrossRef] [PubMed]
- Young, V.J.; Brown, J.K.; Saunders, P.T.; Duncan, W.C.; Horne, A.W. The peritoneum is both a source and target of TGF-β in women with endometriosis. PLoS ONE 2014, 9, e106773. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Chen, L.; Jiang, C.; Guo, J.; Xie, Y.; Kang, L.; Cheng, Z. Berberine inhibits the LPS-induced proliferation and inflammatory response of stromal cells of adenomyosis tissues mediated by the LPS/TLR4 signaling pathway. Exp. Ther. Med. 2017, 14, 6125–6130. [Google Scholar] [CrossRef] [PubMed]
- Chavez, E.; Reyes-Gordillo, K.; Segovia, J.; Shibayama, M.; Tsutsumi, V.; Vergara, P.; Moreno, M.G.; Muriel, P. Resveratrol prevents fibrosis, NF-kappaB activation and TGF-beta increases induced by chronic CCl4 treatment in rats. J. Appl. Toxicol. 2008, 28, 35–43. [Google Scholar] [CrossRef]
- Reichhart, J.-M. TLR5 takes aim at bacterial propeller. Nat. Immunol. 2003, 4, 1159–1160. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. Toll-like receptors in innate immunity. Int. Immunol. 2005, 17, 1–14. [Google Scholar] [CrossRef]
- Wira, C.R.; Fahey, J.V.; Sentman, C.L.; Pioli, P.A.; Shen, L. Innate and adaptive immunity in female genital tract: Cellular responses and interactions. Immunol. Rev. 2005, 206, 306–335. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Yang, D.; Song, M.; Murphy, A.; Parthasarathy, S. The presence of endometrial cells in the peritoneal cavity enhances monocyte recruitment and induces inflammatory cytokines in mice: Implications for endometriosis. Fertil. Steril. 2004, 82, 999–1007. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, K.Y.; Chang, N.; Lin, S.C.; Li, Y.H.; Wu, M.H. Inhibition of dual specificity phosphatase-2 by hypoxia promotes interleukin-8-mediated angiogenesis in endometriosis. Hum. Reprod. 2014, 29, 2747–2755. [Google Scholar] [CrossRef] [PubMed]
- Li, W.N.; Hsiao, K.Y.; Wang, C.A.; Chang, N.; Hsu, P.L.; Sun, C.H.; Wu, S.R.; Wu, M.H.; Tsai, S.J. Extracellular vesicle-associated VEGF-C promotes lymphangiogenesis and immune cells infiltration in endometriosis. Proc. Natl. Acad. Sci. USA. 2020, 117, 25859–25868. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.C.; Lee, H.C.; Hou, P.C.; Fu, J.L.; Wu, M.H.; Tsai, S.J. Targeting hypoxia-mediated YAP1 nuclear translocation ameliorates pathogenesis of endometriosis without compromising maternal fertility. J. Pathol. 2017, 242, 476–487. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.C.; Li, W.N.; Lin, S.C.; Hou, H.T.; Tsai, Y.C.; Lin, T.C.; Wu, M.H.; Tsai, S.J. Targeting YAP1 ameliorates progesterone resistance in endometriosis. Hum. Reprod. 2023, 38, 1124–1134. [Google Scholar] [CrossRef] [PubMed]
- Tal, A.; Tal, R.; Pluchino, N.; Taylor, H.S. Endometrial cells contribute to preexisting endometriosis lesions in a mouse model of retrograde menstruationdagger. Biol. Reprod. 2019, 100, 1453–1460. [Google Scholar] [CrossRef]
- Bruner-Tran, K.L.; Mokshagundam, S.; Herington, J.L.; Ding, T.; Osteen, K.G. Rodent models of experimental endometriosis: Identifying mechanisms of disease and therapeutic targets. Curr. Womens Health Rev. 2018, 14, 173–188. [Google Scholar] [CrossRef] [PubMed]
- Greaves, E.; Critchley, H.O.D.; Horne, A.W.; Saunders, P.T.K. Relevant human tissue resources and laboratory models for use in endometriosis research. Acta Obstet. Gynecol. Scand. 2017, 96, 644–658. [Google Scholar] [CrossRef]
- Huhtinen, K.; Desai, R.; Ståhle, M.; Salminen, A.; Handelsman, D.J.; Perheentupa, A.; Poutanen, M. Endometrial and endometriotic concentrations of estrone and estradiol are determined by local metabolism rather than circulating levels. J. Clin. Endocrinol. Metab. 2012, 97, 4228–4235. [Google Scholar] [CrossRef]
- Rizner, T.L. Estrogen metabolism and action in endometriosis. Mol. Cell. Endocrinol. 2009, 307, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, K.; Nagata, H.; Kitao, M. Clinical usefulness of determination of estradiol level in the menstrual blood for patients with endometriosis. Nihon Seikeigeka Gakkai Zasshi 1989, 41, 1849–1850. [Google Scholar]
- Fournier, M.A.; Poirier, D. Estrogen formation in endometrial and cervix cancer cell lines: Involvement of aromatase, steroid sulfatase and 17beta-hydroxysteroid dehydrogenases (types 1, 5, 7 and 12). Mol Cell Endocrinol 2009, 301, 142–145. [Google Scholar] [CrossRef] [PubMed]
- Heilier, J.-F.; Donnez, O.; Van Kerckhove, V.; Lison, D.; Donnez, J. Expression of aromatase (P450 aromatase/CYP19) in peritoneal and ovarian endometriotic tissues and deep endometriotic (adenomyotic) nodules of the rectovaginal septum. Fertil. Steril. 2006, 85, 1516–1518. [Google Scholar] [CrossRef] [PubMed]
- Banu, S.K.; Lee, J.; Starzinski-Powitz, A.; Arosh, J.A. Gene expression profiles and functional characterization of human immortalized endometriotic epithelial and stromal cells. Fertil. Steril. 2008, 90, 972–987. [Google Scholar] [CrossRef] [PubMed]
- Dassen, H.; Punyadeera, C.; Kamps, R.; Delvoux, B.; Van Langendonckt, A.; Donnez, J.; Husen, B.; Thole, H.; Dunselman, G.; Groothuis, P. Estrogen metabolizing enzymes in endometrium and endometriosis. Hum. Reprod. 2007, 22, 3148–3158. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.-H.; Imir, A.; Fenkci, V.; Yilmaz, M.B.; Bulun, S.E. Stromal cells of endometriosis fail to produce paracrine factors that induce epithelial 17β-hydroxysteroid dehydrogenase type 2 gene and its transcriptional regulator Sp1: A mechanism for defective estradiol metabolism. Am. J. Obstet. Gynecol. 2007, 196, 391. [Google Scholar] [CrossRef] [PubMed]
- Smuc, T.; Pucelj, M.R.; Sinkovec, J.; Husen, B.; Thole, H.; Lanisnik Rizner, T. Expression analysis of the genes involved in estradiol and progesterone action in human ovarian endometriosis. Gynecol. Endocrinol. 2007, 23, 105–111. [Google Scholar] [CrossRef] [PubMed]
- Smuc, T.; Hevir, N.; Ribic-Pucelj, M.; Husen, B.; Thole, H.; Rizner, T.L. Disturbed estrogen and progesterone action in ovarian endometriosis. Mol. Cell. Endocrinol. 2009, 301, 59–64. [Google Scholar] [CrossRef]
- Shao, R.; Cao, S.; Wang, X.; Feng, Y.; Billig, H. The elusive and controversial roles of estrogen and progesterone receptors in human endometriosis. Am. J. Transl. Res. 2014, 6, 104–113. [Google Scholar]
- Simmen, R.C.; Kelley, A.S. Reversal of fortune: Estrogen receptor-beta in endometriosis. J. Mol. Endocrinol. 2016, 57, 23–27. [Google Scholar] [CrossRef] [PubMed]
- Han, S.J.; Jung, S.Y.; Wu, S.P.; Hawkins, S.M.; Park, M.J.; Kyo, S.; Qin, J.; Lydon, J.P.; Tsai, S.Y.; Tsai, M.J.; et al. Estrogen receptor beta modulates apoptosis complexes and the inflammasome to drive the pathogenesis of endometriosis. Cell 2015, 163, 960–974. [Google Scholar] [CrossRef] [PubMed]
- Burns, K.A.; Rodriguez, K.F.; Hewitt, S.C.; Janardhan, K.S.; Young, S.L.; Korach, K.S. Role of estrogen receptor signaling required for endometriosis-like lesion establishment in a mouse model. Endocrinology 2012, 153, 3960–3971. [Google Scholar] [CrossRef] [PubMed]
- Bulun, S.E.; Monsavais, D.; Pavone, M.E.; Dyson, M.; Xue, Q.; Attar, E.; Tokunaga, H.; Su, E.J. Role of estrogen receptor-beta in endometriosis. Semin. Reprod. Med. 2012, 30, 39–45. [Google Scholar] [CrossRef] [PubMed]
- Ramirez-Pavez, T.N.; Martinez-Esparza, M.; Ruiz-Alcaraz, A.J.; Marin-Sanchez, P.; Machado-Linde, F.; Garcia-Penarrubia, P. The role of peritoneal macrophages in endometriosis. Int. J. Mol. Sci. 2021, 22, 10792. [Google Scholar] [CrossRef] [PubMed]
- Khan, K.N.; Kitajima, M.; Hiraki, K.; Fujishita, A.; Sekine, I.; Ishimaru, T.; Masuzaki, H. Immunopathogenesis of pelvic endometriosis: Role of hepatocyte growth factor, macrophages and ovarian steroids. Am. J. Reprod. Immunol. 2008, 60, 383–404. [Google Scholar] [CrossRef] [PubMed]
- Persoons, E.; De Clercq, K.; Van den Eynde, C.; Pinto, S.; Luyten, K.; Van Bree, R.; Tomassetti, C.; Voets, T.; Vriens, J. Mimicking Sampson’s retrograde menstrual theory in rats: A new rat model for ongoing endometriosis-associated pain. Int. J. Mol. Sci. 2020, 21, 2326. [Google Scholar] [CrossRef] [PubMed]
- Torry, D.S.; Holt, V.J.; Keenan, J.A.; Harris, G.; Caudle, M.R.; Torry, R.J. Vascular endothelial growth factor expression in cycling human endometrium. Fertil. Steril. 1996, 66, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Shifren, J.L.; Tseng, J.F.; Zaloudek, C.J.; Ryan, I.P.; Meng, Y.G.; Ferrara, N.; Jaffe, R.B.; Taylor, R.N. Ovarian steroid regulation of vascular endothelial growth factor in the human endometrium: Implications for angiogenesis during the menstrual cycle and in the pathogenesis of endometriosis. J. Clin. Endocrinol. Metab. 1996, 81, 3112–3118. [Google Scholar] [CrossRef]
- Ds, C.-J. Identification and localization of alternatively spliced mRNAs for vascular endothelial growth factor in human uterus and estrogen regulation in endometrial carcinoma cell lines. Biol. Reprod. 1993, 48, 1120–1128. [Google Scholar]
- Shweiki, D.; Itin, A.; Neufeld, G.; Gitay-Goren, H.; Keshet, E. Patterns of expression of vascular endothelial growth factor (VEGF) and VEGF receptors in mice suggest a role in hormonally regulated angiogenesis. J. Clin. Investig. 1993, 91, 2235–2243. [Google Scholar] [CrossRef] [PubMed]
- Young, V.J.; Ahmad, S.F.; Duncan, W.C.; Horne, A.W. The role of TGF-beta in the pathophysiology of peritoneal endometriosis. Hum. Reprod. Update 2017, 23, 548–559. [Google Scholar] [CrossRef] [PubMed]
- Karslioglu, T.; Karasu, A.F.G.; Yildiz, P. The effects of micronized progesterone and cabergoline on a rat autotransplantation endometriosis model: A placebo controlled randomized trial. J. Investig. Surg. 2021, 34, 897–901. [Google Scholar] [CrossRef] [PubMed]
- Eisermann, J.; Gast, M.J.; Pineda, J.; Odem, R.R.; Collins, J.L. Tumor necrosis factor in peritoneal fluid of women undergoing laparoscopic surgery. Fertil. Steril. 1988, 50, 573–579. [Google Scholar] [CrossRef]
- May, K.E.; Conduit-Hulbert, S.A.; Villar, J.; Kirtley, S.; Kennedy, S.H.; Becker, C.M. Peripheral biomarkers of endometriosis: A systematic review. Hum. Reprod. Update 2010, 16, 651–674. [Google Scholar] [CrossRef] [PubMed]
- May, K.E.; Villar, J.; Kirtley, S.; Kennedy, S.H.; Becker, C.M. Endometrial alterations in endometriosis: A systematic review of putative biomarkers. Hum. Reprod. Update 2011, 17, 637–653. [Google Scholar] [CrossRef]
- Viatour, P.; Merville, M.P.; Bours, V.; Chariot, A. Phosphorylation of NF-kappaB and IkappaB proteins: Implications in cancer and inflammation. Trends Biochem. Sci. 2005, 30, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Perkins, N.D. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat. Rev. Mol. Cell Biol. 2007, 8, 49–62. [Google Scholar] [CrossRef]
- Gonzalez-Ramos, R.; Van Langendonckt, A.; Defrere, S.; Lousse, J.C.; Colette, S.; Devoto, L.; Donnez, J. Involvement of the nuclear factor-kappaB pathway in the pathogenesis of endometriosis. Fertil. Steril. 2010, 94, 1985–1994. [Google Scholar] [CrossRef]
- Kolahdouz-Mohammadi, R.; Shidfar, F.; Khodaverdi, S.; Arablou, T.; Heidari, S.; Rashidi, N.; Delbandi, A.A. Resveratrol treatment reduces expression of MCP-1, IL-6, IL-8 and RANTES in endometriotic stromal cells. J. Cell Mol. Med. 2021, 25, 1116–1127. [Google Scholar] [CrossRef]
- Ponce, C.; Torres, M.; Galleguillos, C.; Sovino, H.; Boric, M.A.; Fuentes, A.; Johnson, M.C. Nuclear factor kappaB pathway and interleukin-6 are affected in eutopic endometrium of women with endometriosis. Reproduction 2009, 137, 727–737. [Google Scholar] [CrossRef]
- Pereira, F.E.; Almeida, P.R.; Dias, B.H.; Vasconcelos, P.R.; Guimaraes, S.B.; Medeiros, F. Development of a subcutaneous endometriosis rat model. Acta Cir. Bras. 2015, 30, 6–12. [Google Scholar] [CrossRef]
- Li, Z.; Liu, H.; Lang, J.; Zhang, G.; He, Z. Effects of cisplatin on surgically induced endometriosis in a rat model. Oncol. Lett. 2018, 16, 5282–5290. [Google Scholar] [CrossRef]
- Zhang, L.; Li, Y.; Guan, C.Y.; Tian, S.; Lv, X.D.; Li, J.H.; Ma, X.; Xia, H.F. Therapeutic effect of human umbilical cord-derived mesenchymal stem cells on injured rat endometrium during its chronic phase. Stem Cell Res. Ther. 2018, 9, 36. [Google Scholar] [CrossRef] [PubMed]
- Spittau, B.; Rilka, J.; Steinfath, E.; Zoller, T.; Krieglstein, K. TGFbeta1 increases microglia-mediated engulfment of apoptotic cells via upregulation of the milk fat globule-EGF factor 8. Glia 2015, 63, 142–153. [Google Scholar] [CrossRef] [PubMed]
- Reinehr, S.; Reinhard, J.; Gandej, M.; Gottschalk, I.; Stute, G.; Faissner, A.; Dick, H.B.; Joachim, S.C. S100B immunization triggers NFkappaB and complement activation in an autoimmune glaucoma model. Sci. Rep. 2018, 8, 9821. [Google Scholar] [CrossRef]
- Wu, T.; Chen, J.M.; Xiao, T.G.; Shu, X.B.; Xu, H.C.; Yang, L.L.; Xing, L.J.; Zheng, P.Y.; Ji, G. Qinggan Huoxue Recipe suppresses epithelial-to-mesenchymal transition in alcoholic liver fibrosis through TGF-beta1/Smad signaling pathway. World J. Gastroenterol. 2016, 22, 4695–4706. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wang, X.; Liu, T.; Mo, M.; Ao, L.; Liu, J.; Cao, J.; Cui, Z. Smad2/3 Upregulates the Expression of Vimentin and Affects Its Distribution in DBP-Exposed Sertoli Cells. PPAR Res. 2015, 2015, 489314. [Google Scholar] [CrossRef]
- Lee, S.W.; Lee, J.E.; Yoo, C.Y.; Ko, M.S.; Park, C.S.; Yang, S.-H. NRP-1 expression is strongly associated with the progression of pituitary adenomas. Oncol. Rep. 2014, 32, 1537–1542. [Google Scholar] [CrossRef]
- Roudkenar, M.H.; Halabian, R.; Tehrani, H.A.; Amiri, F.; Jahanian-Najafabadi, A.; Roushandeh, A.M.; Abbasi-Malati, Z.; Kuwahara, Y. Lipocalin 2 enhances mesenchymal stem cell-based cell therapy in acute kidney injury rat model. Cytotechnology 2018, 70, 103–117. [Google Scholar] [CrossRef]
- Sanchez, R.N.; Chan, C.K.; Garg, S.; Kwong, J.M.; Wong, M.J.; Sadun, A.A.; Lam, T.T. Interleukin-6 in retinal ischemia reperfusion injury in rats. Invest. Ophthalmol. Vis. Sci. 2003, 44, 4006–4011. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; O’Sullivan, K.M.; Jones, L.K.; Lo, C.; Semple, T.; Kumanogoh, A.; Kikutani, H.; Holdsworth, S.R.; Kitching, R. Endogenous CD100 promotes glomerular injury and macrophage recruitment in experimental crescentic glomerulonephritis. Immunology 2009, 128, 114–122. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Kong, X.; Kong, H. Ethylparaben induces subconjunctival fibrosis via the Wnt/beta-catenin signaling pathway. Exp. Ther. Med. 2021, 21, 295. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.H.; Tsai, N.C.; Chen, Y.J.; Weng, P.L.; Chang, Y.C.; Cheng, J.H.; Ko, J.Y.; Kang, H.Y.; Lan, K.C. Extracorporeal Shock Wave Therapy Combined with Platelet-Rich Plasma during Preventive and Therapeutic Stages of Intrauterine Adhesion in a Rat Model. Biomedicines 2022, 10, 476. [Google Scholar] [CrossRef] [PubMed]
Control a | Ectopic Endometrial Lesion in the Peritoneal Cavity (Procedure 1) | p Value | Control a | Ectopic Endometrial Lesion in the Peritoneum (Procedure 2) | p Value | |
---|---|---|---|---|---|---|
Day 0 | 215.5 ± 6.3 | 221.6 ± 2.3 | 0.2641 | 227.3 ± 5.8 | 236.1 ± 3.3 | 0.2382 |
Day 7 | 206.4 ± 8.2 | 197.3 ± 1.9 | 0.1244 | 222.7 ± 8.8 | 231.6 ± 3.7 | 0.3147 |
Day 14 | 215.0 ± 7.3 | 204.4 ± 2.2 | 0.0949 | 238.6 ± 9.0 | 242.0 ± 3.9 | 0.6971 |
Day 21 | 225.7 ± 11.2 | 213.6 ± 4.0 | 0.2209 | 252.1 ± 10.9 | 252.4 ± 5.0 | 0.9782 |
Day 28 | 226.4 ± 14.3 | 207.7 ± 2.0 | 0.0709 | 261.5 ± 11.5 | 257.2 ± 5.4 | 0.7139 |
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
Ki-67 [146] | CTGCAGAGAAGGTTGGGATAAA | CTGACTTTGCCCAGAGATGAA |
TGF-β [147] | TAATGGTGGACCGCAACAACG | GGCACTGCTTCCCGAATGTCT |
NF-κB [148] | CTGGCAGCTCTTCTCAAAGC | CCAGGTCATAGAGAGGCTCAA |
Fibronectin [149] | GACTCGCTTTGACTTCACCAC | GCTGAGACCCAGGAGACCAC |
Vimentin [150] | GCACCCTGCAGTCATTCAGA | GCAAGGATTCCACTTTACGTTCA |
VEGF [151] | TATCTTCAAGCCGTCCTGTG | GATCCGCATGATCTGCATAG |
CK-18 [152] | CTGGGGCCACTACTTCAAGA | CCTTGCGGAGTCCATGAATG |
IL-6 [153] | TCAACTCCATCTGCCCTTCAG | AAGGCAACTGGCTGGAAGTCT |
TNF-α [154] | GCCTCTTCTCATTCCTGCTT | CACTTGGTGGTTTGCTACGA |
β-actin [155] | GACGTTGACATCCGTAAAGACC | CTAGGAGCCAGGGCAGTAATCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, Y.-H.; Huang, C.-W.; Lien, H.-T.; Hsiao, Y.-Y.; Weng, P.-L.; Chang, Y.-C.; Cheng, J.-H.; Lan, K.-C. A Preliminary Investigation of the Roles of Endometrial Cells in Endometriosis Development via In Vitro and In Vivo Analyses. Int. J. Mol. Sci. 2024, 25, 3873. https://doi.org/10.3390/ijms25073873
Cheng Y-H, Huang C-W, Lien H-T, Hsiao Y-Y, Weng P-L, Chang Y-C, Cheng J-H, Lan K-C. A Preliminary Investigation of the Roles of Endometrial Cells in Endometriosis Development via In Vitro and In Vivo Analyses. International Journal of Molecular Sciences. 2024; 25(7):3873. https://doi.org/10.3390/ijms25073873
Chicago/Turabian StyleCheng, Yin-Hua, Ching-Wei Huang, Hao-Ting Lien, Yu-Yang Hsiao, Pei-Ling Weng, Yung-Chiao Chang, Jai-Hong Cheng, and Kuo-Chung Lan. 2024. "A Preliminary Investigation of the Roles of Endometrial Cells in Endometriosis Development via In Vitro and In Vivo Analyses" International Journal of Molecular Sciences 25, no. 7: 3873. https://doi.org/10.3390/ijms25073873