The Suppression of the Epithelial to Mesenchymal Transition in Prostate Cancer through the Targeting of MYO6 Using MiR-145-5p
Abstract
:1. Introduction
2. Results
2.1. Reduced miR-145-5p Expression Correlates with Prostate Cancer Progression
2.2. MYO6 Is a Novel Target of miR-145-5p in Prostate Cancer
2.3. miR-145-5p Alters Key EMT Markers in Prostate Cell Lines
2.4. miR-145-5p Regulates Proliferation, Migration, and Clonogenic POTENTIAL in Prostate Cell Lines
2.5. Mapping the Functional Network of the miR-145-5p/MYO6 Axis
2.6. Potential of miR-145-5p as a Biomarker of Prostate Cancer
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfections
4.2. Quantitative Real-Time PCR (qRT-PCR)
- MYO6 (fw: GGATCTGTCCGAGCAGGAAG, rv: CTGTACGGGTGAAGCTGGAG),
- ACTA2 (fw: GTTCCGCTCCTCTCTCCAAC, rv: GTGCGGACAGGAATTGAAGC),
- VIM (fw: GGACCAGCTAACCAACGACA, rv: AAGGTCAAGACGTGCCAGAG),
- FN1 (fw: TCAGCTTCCTGGCACTTCTG, rv: TCCCTGGGGATGTGACCAAT), and housekeeping gene GAPDH (fw: GACAGTCAGCCGCATCTTCT, rv: GCGCCCAATACGACCAAATC).
4.3. Protein Analysis
4.4. Bioassays
4.5. Databases and Analysis
4.6. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rebello, R.J.; Oing, C.; Knudsen, K.E.; Loeb, S.; Johnson, D.C.; Reiter, R.E.; Gillessen, S.; Van der Kwast, T.; Bristow, R.G. Prostate cancer. Nat. Rev. Dis. Primer 2021, 7, 9. [Google Scholar] [CrossRef]
- Khan, M.I.; Hamid, A.; Adhami, V.M.; Lall, R.K.; Mukhtar, H. Role of Epithelial Mesenchymal Transition in Prostate Tumorigenesis. Curr. Pharm. Des. 2015, 21, 1240–1248. [Google Scholar] [CrossRef]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428. [Google Scholar] [CrossRef]
- Hussen, B.M.; Shoorei, H.; Mohaqiq, M.; Dinger, M.E.; Hidayat, H.J.; Taheri, M.; Ghafouri-Fard, S. The Impact of Non-coding RNAs in the Epithelial to Mesenchymal Transition. Front. Mol. Biosci. 2021, 8, 665199. Available online: https://www.frontiersin.org/articles/10.3389/fmolb.2021.665199 (accessed on 29 June 2023). [CrossRef] [PubMed]
- Shang, R.; Lee, S.; Senavirathne, G.; Lai, E.C. microRNAs in action: Biogenesis, function and regulation. Nat. Rev. Genet. 2023, 24, 816–833. [Google Scholar] [CrossRef]
- Dexheimer, P.J.; Cochella, L. MicroRNAs: From Mechanism to Organism. Front. Cell Dev. Biol. 2020, 8, 409. Available online: https://www.frontiersin.org/articles/10.3389/fcell.2020.00409 (accessed on 24 January 2024). [CrossRef]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 388354. Available online: https://www.frontiersin.org/articles/10.3389/fendo.2018.00402 (accessed on 29 June 2023). [CrossRef]
- Orang, A.V.; Safaralizadeh, R.; Kazemzadeh-Bavili, M. Mechanisms of miRNA-Mediated Gene Regulation from Common Downregulation to mRNA-Specific Upregulation. Int. J. Genom. 2014, 2014, 970607. [Google Scholar] [CrossRef]
- Schitcu, V.H.; Raduly, L.; Nutu, A.; Zanoaga, O.; Ciocan, C.; Munteanu, V.C.; Cojocneanu, R.; Petrut, B.; Coman, I.; Braicu, C.; et al. MicroRNA Dysregulation in Prostate Cancer. Pharmacogenom. Pers. Med. 2022, 15, 177–193. [Google Scholar] [CrossRef]
- Lynch, S.M.; O’Neill, K.M.; McKenna, M.M.; Walsh, C.P.; McKenna, D.J. Regulation of miR-200c and miR-141 by Methylation in Prostate Cancer. Prostate 2016, 76, 1146–1159. [Google Scholar] [CrossRef]
- Lynch, S.M.; McKenna, M.M.; Walsh, C.P.; McKenna, D.J. miR-24 regulates CDKN1B/p27 expression in prostate cancer. Prostate 2016, 76, 637–648. [Google Scholar] [CrossRef] [PubMed]
- Angel, C.Z.; Lynch, S.M.; Nesbitt, H.; McKenna, M.M.; Walsh, C.P.; McKenna, D.J. miR-210 is induced by hypoxia and regulates neural cell adhesion molecule in prostate cells. J. Cell. Physiol. 2020, 235, 6194–6203. [Google Scholar] [CrossRef] [PubMed]
- Stafford, M.Y.C.; Willoughby, C.E.; Walsh, C.P.; McKenna, D.J. Prognostic value of miR-21 for prostate cancer: A systematic review and meta-analysis. Biosci. Rep. 2022, 42, BSR20211972. [Google Scholar] [CrossRef] [PubMed]
- Stafford, M.Y.C.; McKenna, D.J. MiR-182 Is Upregulated in Prostate Cancer and Contributes to Tumor Progression by Targeting MITF. Int. J. Mol. Sci. 2023, 24, 1824. [Google Scholar] [CrossRef]
- Armstrong, L.; Willoughby, C.E.; McKenna, D.J. Targeting of AKT1 by miR-143-3p Suppresses Epithelial-to-Mesenchymal Transition in Prostate Cancer. Cells 2023, 12, 2207. [Google Scholar] [CrossRef] [PubMed]
- Sekhon, K.; Bucay, N.; Majid, S.; Dahiya, R.; Saini, S. MicroRNAs and epithelial-mesenchymal transition in prostate cancer. Oncotarget 2016, 7, 67597–67611. [Google Scholar] [CrossRef]
- Kadkhoda, S.; Ghafouri-Fard, S. Function of miRNA-145–5p in the pathogenesis of human disorders. Pathol.-Res. Pract. 2022, 231, 153780. [Google Scholar] [CrossRef]
- Wang, J.; Zhang, H.; Situ, J.; Li, M.; Sun, H. KCNQ1OT1 aggravates cell proliferation and migration in bladder cancer through modulating miR-145-5p/PCBP2 axis. Cancer Cell Int. 2019, 19, 325. [Google Scholar] [CrossRef]
- Dong, M.; Xu, T.; Li, H.; Li, X. LINC00052 promotes breast cancer cell progression and metastasis by sponging miR-145-5p to modulate TGFBR2 expression. Oncol. Lett. 2021, 21, 368. [Google Scholar] [CrossRef]
- He, W.; Liang, B.; Wang, C.; Li, S.; Zhao, Y.; Huang, Q.; Liu, Z.; Yao, Z.; Wu, Q.; Liao, W.; et al. MSC-regulated lncRNA MACC1-AS1 promotes stemness and chemoresistance through fatty acid oxidation in gastric cancer. Oncogene 2019, 38, 4637–4654. [Google Scholar] [CrossRef]
- He, J.; Yan, H.; Wei, S.; Chen, G. LncRNA ST8SIA6-AS1 Promotes Cholangiocarcinoma Progression by Suppressing the miR-145-5p/MAL2 Axis. OncoTargets Ther. 2021, 14, 3209–3223. [Google Scholar] [CrossRef] [PubMed]
- Liep, J.; Kilic, E.; Meyer, H.A.; Busch, J.; Jung, K.; Rabien, A. Cooperative Effect of miR-141-3p and miR-145-5p in the Regulation of Targets in Clear Cell Renal Cell Carcinoma. PLoS ONE 2016, 11, e0157801. [Google Scholar] [CrossRef] [PubMed]
- Kadkhoda, S.; Taslimi, R.; Noorbakhsh, F.; Darbeheshti, F.; Bazzaz, J.T.; Ghafouri-Fard, S.; Shakoori, A. Importance of Circ0009910 in colorectal cancer pathogenesis as a possible regulator of miR-145 and PEAK1. World J. Surg. Oncol. 2021, 19, 265. [Google Scholar] [CrossRef] [PubMed]
- Mei, L.-L.; Wang, W.-J.; Qiu, Y.-T.; Xie, X.-F.; Bai, J.; Shi, Z.-Z. miR-145-5p Suppresses Tumor Cell Migration, Invasion and Epithelial to Mesenchymal Transition by Regulating the Sp1/NF-κB Signaling Pathway in Esophageal Squamous Cell Carcinoma. Int. J. Mol. Sci. 2017, 18, 1833. [Google Scholar] [CrossRef] [PubMed]
- Fan, S.; Chen, P.; Li, S. miR-145-5p Inhibits the Proliferation, Migration, and Invasion of Esophageal Carcinoma Cells by Targeting ABRACL. BioMed Res. Int. 2021, 2021, e6692544. [Google Scholar] [CrossRef] [PubMed]
- Goeppert, B.; Truckenmueller, F.; Ori, A.; Fritz, V.; Albrecht, T.; Fraas, A.; Scherer, D.; Silos, R.G.; Sticht, C.; Gretz, N.; et al. Profiling of gallbladder carcinoma reveals distinct miRNA profiles and activation of STAT1 by the tumor suppressive miRNA-145-5p. Sci. Rep. 2019, 9, 4796. [Google Scholar] [CrossRef] [PubMed]
- Zhou, K.; Song, B.; Wei, M.; Fang, J.; Xu, Y. MiR-145-5p suppresses the proliferation, migration and invasion of gastric cancer epithelial cells via the ANGPT2/NOD_LIKE_RECEPTOR axis. Cancer Cell Int. 2020, 20, 416. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Chen, T.; Zhu, Y.; Li, Y.; Zhang, Y.; Wang, Y.; Li, X.; Xie, X.; Wang, J.; Huang, M.; et al. circPTN sponges miR-145-5p/miR-330-5p to promote proliferation and stemness in glioma. J. Exp. Clin. Cancer Res. 2019, 38, 398. [Google Scholar] [CrossRef] [PubMed]
- Ding, B.; Fan, W.; Lou, W. hsa_circ_0001955 Enhances In Vitro Proliferation, Migration, and Invasion of HCC Cells through miR-145-5p/NRAS Axis. Mol. Ther.-Nucleic Acids 2020, 22, 445–455. [Google Scholar] [CrossRef]
- Gao, W.; Zhang, C.; Li, W.; Li, H.; Sang, J.; Zhao, Q.; Bo, Y.; Luo, H.; Zheng, X.; Lu, Y.; et al. Promoter Methylation-Regulated miR-145-5p Inhibits Laryngeal Squamous Cell Carcinoma Progression by Targeting FSCN1. Mol. Ther. 2019, 27, 365–379. [Google Scholar] [CrossRef]
- Bagheri, M.; Khansarinejad, B.; Mosayebi, G.; Moradabadi, A.; Mondanizadeh, M. Diagnostic Value of Plasma miR-145 and miR-185 as Targeting of the APRIL Oncogene in the B-cell Chronic Lymphocytic Leukemia. Asian Pac. J. Cancer Prev. APJCP 2021, 22, 111–117. [Google Scholar] [CrossRef]
- Jiang, W.; Zhang, C.; Kang, Y.; Li, G.; Feng, Y.; Ma, H. The roles and mechanisms of the circular RNA circ_104640 in early-stage lung adenocarcinoma: A potential diagnostic and therapeutic target. Ann. Transl. Med. 2021, 9, 138. [Google Scholar] [CrossRef] [PubMed]
- Mataki, H.; Seki, N.; Mizuno, K.; Nohata, N.; Kamikawaji, K.; Kumamoto, T.; Koshizuka, K.; Goto, Y.; Inoue, H. Dual-strand tumor-suppressor microRNA-145 (miR-145-5p and miR-145-3p) coordinately targeted MTDH in lung squamous cell carcinoma. Oncotarget 2016, 7, 72084. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.J.; Liu, S.; Han, D.M.; Han, D.Z.; Sun, W.J.; Zhao, X.C.; Liang, J.Q.; Yu, L. FUT8-AS1 Inhibits the Malignancy of Melanoma Through Promoting miR-145-5p Biogenesis and Suppressing NRAS/MAPK Signaling. Front. Oncol. 2021, 10, 586085. Available online: https://www.frontiersin.org/articles/10.3389/fonc.2020.586085 (accessed on 24 January 2024). [CrossRef] [PubMed]
- Zhu, Z.; Wu, Q.; Zhang, M.; Tong, J.; Zhong, B.; Yuan, K. Hsa_circ_0016760 exacerbates the malignant development of non-small cell lung cancer by sponging miR-145-5p/FGF5. Oncol. Rep. 2021, 45, 501–512. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Pan, R.; Lu, Q.; Ren, C.; Sun, J.; Wu, H.; Wen, J.; Chen, H. MicroRNA-145-5p inhibits osteosarcoma cell proliferation by targeting E2F transcription factor 3. Int. J. Mol. Med. 2020, 45, 1317–1326. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Yang, J.; Gong, F.; Li, L.; Li, A. Long non-coding RNA CASC9 promotes the progression of retinoblastoma via interacting with miR-145-5p. Cell Cycle 2020, 19, 2270–2280. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Zhou, Q.; Yi, H.; Ma, S.; Li, D.; Xu, Y.; Wang, J.; Yin, S. A novel lncRNA n384546 promotes thyroid papillary cancer progression and metastasis by acting as a competing endogenous RNA of miR-145-5p to regulate AKT3. Cell Death Dis. 2019, 10, 433. [Google Scholar] [CrossRef] [PubMed]
- Ozen, M.; Karatas, O.F.; Gulluoglu, S.; Bayrak, O.F.; Sevli, S.; Guzel, E.; Ekici, I.D.; Caskurlu, T.; Solak, M.; Creighton, C.J.; et al. Overexpression of miR-145–5p Inhibits Proliferation of Prostate Cancer Cells and Reduces SOX2 Expression. Cancer Investig. 2015, 33, 251–258. [Google Scholar] [CrossRef]
- Ji, S.; Shi, Y.; Yang, L.; Zhang, F.; Li, Y.; Xu, F. miR-145-5p Inhibits Neuroendocrine Differentiation and Tumor Growth by Regulating the SOX11/MYCN Axis in Prostate cancer. Front. Genet. 2022, 13, 790621. Available online: https://www.frontiersin.org/articles/10.3389/fgene.2022.790621 (accessed on 24 January 2024). [CrossRef]
- Guo, H.; Zhao, J.; Li, X.; Sun, F.; Qin, Y.; Yang, X.; Xiong, X.; Yin, Q.; Wang, X.; Gao, L.; et al. Identification of miR-1-3p, miR-143–3p and miR-145–5p association with bone metastasis of Gleason 3+4 prostate cancer and involvement of LASP1 regulation. Mol. Cell. Probes 2023, 68, 101901. [Google Scholar] [CrossRef] [PubMed]
- Le Hars, M.; Castro-Vega, L.J.; Rajabi, F.; Tabatadze, D.; Romero, M.; Pinskaya, M.; Groisman, I. Pro-tumorigenic role of lnc-ZNF30-3 as a sponge counteracting miR-145-5p in prostate cancer. Biol. Direct 2023, 18, 38. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Qin, P.; Cao, C.; Dai, G.; Xu, L.; Yang, D. Use of miR-145 and testicular nuclear receptor 4 inhibition to reduce chemoresistance to docetaxel in prostate cancer. Oncol. Rep. 2021, 45, 963–974. [Google Scholar] [CrossRef] [PubMed]
- Tohidast, M.; Memari, N.; Amini, M.; Hosseini, S.S.; Jebelli, A.; Doustvandi, M.A.; Baradaran, B.; Mokhtarzadeh, A. MiR-145 inhibits cell migration and increases paclitaxel chemosensitivity in prostate cancer cells. Iran. J. Basic Med. Sci. 2023, 26, 1350–1359. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Deng, L.; Gong, Y. MiR-145-5p Inhibits the Invasion of Prostate Cancer and Induces Apoptosis by Inhibiting WIP1. J. Oncol. 2021, 2021, 4412705. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Huang, Y.; Liu, Q.; Liu, H.; Long, T.; Zhu, C.; Wu, X. MiR-145 suppresses the motility of prostate cancer cells by targeting cadherin-2. Mol. Cell. Biochem. 2021, 476, 3635–3646. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.; Wang, M.; Guo, W.; Zhao, X.; Tu, X.; Huang, S.; Zou, X.; Peng, X. Wild-type p53 suppresses the epithelial-mesenchymal transition and stemness in PC-3 prostate cancer cells by modulating miR-145. Int. J. Oncol. 2013, 42, 1473–1481. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.; Wang, M.; Guo, W.; Huang, S.; Wang, Z.; Zhao, X.; Du, H.; Song, L.; Peng, X. Double-negative feedback loop between ZEB2 and miR-145 regulates epithelial-mesenchymal transition and stem cell properties in prostate cancer cells. Cell Tissue Res. 2014, 358, 763–778. [Google Scholar] [CrossRef] [PubMed]
- Luo, B.; Yuan, Y.; Zhu, Y.; Liang, S.; Dong, R.; Hou, J.; Li, P.; Xing, Y.; Lu, Z.; Lo, R.; et al. microRNA-145-5p inhibits prostate cancer bone metastatic by modulating the epithelial-mesenchymal transition. Front. Oncol. 2022, 12, 988794. Available online: https://www.frontiersin.org/journals/oncology/articles/10.3389/fonc.2022.988794 (accessed on 31 January 2024). [CrossRef]
- Chen, Q.; Zhou, L.; Ye, X.; Tao, M.; Wu, J. miR-145-5p suppresses proliferation, metastasis and EMT of colorectal cancer by targeting CDCA3. Pathol.-Res. Pract. 2020, 216, 152872. [Google Scholar] [CrossRef]
- Wang, D.; Zhu, L.; Liao, M.; Zeng, T.; Zhuo, W.; Yang, S.; Wu, W. MYO6 knockdown inhibits the growth and induces the apoptosis of prostate cancer cells by decreasing the phosphorylation of ERK1/2 and PRAS40. Oncol. Rep. 2016, 36, 1285–1292. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Zhang, X.; Li, W.; Chen, Y. MicroRNA-145-5p regulates the proliferation of epithelial ovarian cancer cells via targeting SMAD4. J. Ovarian Res. 2020, 13, 54. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Wu, S.; Zhu, K.; Zhang, J.; Shi, X.; Shen, J.; Xu, J. The role of miR-145-5p in esophageal squamous cell carcinoma tumor-associated macrophages and selection of immunochemotherapy. J. Thorac. Dis. 2022, 14, 2493–2510. [Google Scholar] [CrossRef] [PubMed]
- Mozammel, N.; Amini, M.; Baradaran, B.; Mahdavi, S.Z.B.; Hosseini, S.S.; Mokhtarzadeh, A. The function of miR-145 in colorectal cancer progression; an updated review on related signaling pathways. Pathol.-Res. Pract. 2023, 242, 154290. [Google Scholar] [CrossRef] [PubMed]
- Avgeris, M.; Stravodimos, K.; Fragoulis, E.G.; Scorilas, A. The loss of the tumour-suppressor miR-145 results in the shorter disease-free survival of prostate cancer patients. Br. J. Cancer 2013, 108, 2573–2581. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Dong, L.; Sun, J.; Shao, J.; Zhang, J.; Chen, S.; Wang, C.; Wu, G.; Wang, X. miR-145-5p: A Potential Biomarker in Predicting Gleason Upgrading of Prostate Biopsy Samples Scored 3+3=6. Cancer Manag. Res. 2021, 13, 9095–9106. [Google Scholar] [CrossRef] [PubMed]
- Lei, C.; Du, F.; Sun, L.; Li, T.; Li, T.; Min, Y.; Nie, A.; Wang, X.; Geng, L.; Lu, Y.; et al. miR-143 and miR-145 inhibit gastric cancer cell migration and metastasis by suppressing MYO6. Cell Death Dis. 2017, 8, e3101. [Google Scholar] [CrossRef] [PubMed]
- Szczyrba, J.; Löprich, E.; Wach, S.; Jung, V.; Unteregger, G.; Barth, S.; Grobholz, R.; Wieland, W.; Stöhr, R.; Hartmann, A.; et al. The microRNA profile of prostate carcinoma obtained by deep sequencing. Mol. Cancer Res. MCR 2010, 8, 529–538. [Google Scholar] [CrossRef]
- Zhang, L.; Yu, R.; Li, C.; Dang, Y.; Yi, X.; Wang, L. Circ_0026416 downregulation blocks the development of colorectal cancer through depleting MYO6 expression by enriching miR-545-3p. World J. Surg. Oncol. 2021, 19, 299. [Google Scholar] [CrossRef]
- Buss, F.; Kendrick-Jones, J. How are the cellular functions of myosin VI regulated within the cell? Biochem. Biophys. Res. Commun. 2008, 369, 165–175. [Google Scholar] [CrossRef]
- Maddugoda, M.P.; Crampton, M.S.; Shewan, A.M.; Yap, A.S. Myosin VI and vinculin cooperate during the morphogenesis of cadherin cell–cell contacts in mammalian epithelial cells. J. Cell Biol. 2007, 178, 529–540. [Google Scholar] [CrossRef] [PubMed]
- Chung, C.-L.; Tai, S.-B.; Hu, T.-H.; Chen, J.-J.; Chen, C.-L. Roles of Myosin-Mediated Membrane Trafficking in TGF-β Signaling. Int. J. Mol. Sci. 2019, 20, 3913. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Ying, M.; Wu, Q.; Wang, R.; Li, Y. Overexpression of myosin VI regulates gastric cancer cell progression. Gene 2016, 593, 100–109. [Google Scholar] [CrossRef]
- Zhan, X.-J.; Wang, R.; Kuang, X.-R.; Zhou, J.-Y.; Hu, X.-L. Elevated expression of myosin VI contributes to breast cancer progression via MAPK/ERK signaling pathway. Cell. Signal. 2023, 106, 110633. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Li, J.; Ma, Y.; Xu, C.; Wang, Y.; He, Y. MicroRNA miR-145-5p inhibits Phospholipase D 5 (PLD5) to downregulate cell proliferation and metastasis to mitigate prostate cancer. Bioengineered 2021, 12, 3240–3251. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Zeng, H.; Guo, Y.; Liu, P.; Pan, H.; Deng, A.; Hu, J. miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J. Exp. Clin. Cancer Res. CR 2010, 29, 151. [Google Scholar] [CrossRef] [PubMed]
- Shao, Y.; Qu, Y.; Dang, S.; Yao, B.; Ji, M. MiR-145 inhibits oral squamous cell carcinoma (OSCC) cell growth by targeting c-Myc and Cdk6. Cancer Cell Int. 2013, 13, 51. [Google Scholar] [CrossRef]
- Pagliuca, A.; Valvo, C.; Fabrizi, E.; di Martino, S.; Biffoni, M.; Runci, D.; Forte, S.; De Maria, R.; Ricci-Vitiani, L. Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene 2013, 32, 4806–4813. [Google Scholar] [CrossRef] [PubMed]
- Zou, C.; Xu, Q.; Mao, F.; Li, D.; Bian, C.; Liu, L.-Z.; Jiang, Y.; Chen, X.; Qi, Y.; Zhang, X.; et al. MiR-145 inhibits tumor angiogenesis and growth by N-RAS and VEGF. Cell Cycle Georget. Tex 2012, 11, 2137–2145. [Google Scholar] [CrossRef]
- Yin, Y.; Yan, Z.-P.; Lu, N.-N.; Xu, Q.; He, J.; Qian, X.; Yu, J.; Guan, X.; Jiang, B.-H.; Liu, L.-Z. Downregulation of miR-145 associated with cancer progression and VEGF transcriptional activation by targeting N-RAS and IRS1. Biochim. Biophys. Acta 2013, 1829, 239–247. [Google Scholar] [CrossRef]
- Boufraqech, M.; Zhang, L.; Jain, M.; Patel, D.; Ellis, R.; Xiong, Y.; He, M.; Nilubol, N.; Merino, M.J.; Kebebew, E. miR-145 suppresses thyroid cancer growth and metastasis and targets AKT3. Endocr. Relat. Cancer 2014, 21, 517–531. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wang, J.; Deng, J.; Li, X.; Long, W.; Chang, Y. MiR-145 acts as a metastasis suppressor by targeting metadherin in lung cancer. Med. Oncol. Northwood Lond. Engl. 2015, 32, 344. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Qiu, M.; Jiang, F.; Zhang, S.; Yang, X.; Wang, J.; Xu, L.; Yin, R. MiR-145 regulates cancer stem-like properties and epithelial-to-mesenchymal transition in lung adenocarcinoma-initiating cells. Tumour Biol. J. Int. Soc. Oncodev. Biol. Med. 2014, 35, 8953–8961. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wu, C.; Wang, Y.; Wen, S.; Wang, J.; Chen, Z.; He, Q.; Feng, D. MicroRNA-145 inhibits cell proliferation by directly targeting ADAM17 in hepatocellular carcinoma. Oncol. Rep. 2014, 32, 1923–1930. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.; Ebeling, M.C.; Zaman, M.S.; Sikander, M.; Yallapu, M.M.; Chauhan, N.; Yacoubian, A.M.; Behrman, S.W.; Zafar, N.; Kumar, D.; et al. MicroRNA-145 targets MUC13 and suppresses growth and invasion of pancreatic cancer. Oncotarget 2014, 5, 7599–7609. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Guo, H.; Zhang, H.; Wang, H.; Qian, G.; Fan, X.; Hoffman, A.R.; Hu, J.; Ge, S. Putative tumor suppressor miR-145 inhibits colon cancer cell growth by targeting oncogene Friend leukemia virus integration 1. Cancer 2011, 117, 86–95. [Google Scholar] [CrossRef] [PubMed]
- Takagi, T.; Iio, A.; Nakagawa, Y.; Naoe, T.; Tanigawa, N.; Akao, Y. Decreased expression of microRNA-143 and -145 in human gastric cancers. Oncology 2009, 77, 12–21. [Google Scholar] [CrossRef]
- Kou, B.; Gao, Y.; Du, C.; Shi, Q.; Xu, S.; Wang, C.Q.; Wang, X.; He, D.; Guo, P. miR-145 inhibits invasion of bladder cancer cells by targeting PAK1. Urol. Oncol. 2014, 32, 846–854. [Google Scholar] [CrossRef]
- Wu, D.; Li, M.; Wang, L.; Zhou, Y.; Zhou, J.; Pan, H.; Qu, P. microRNA-145 inhibits cell proliferation, migration and invasion by targeting matrix metallopeptidase-11 in renal cell carcinoma. Mol. Med. Rep. 2014, 10, 393–398. [Google Scholar] [CrossRef]
- Ostenfeld, M.S.; Bramsen, J.B.; Lamy, P.; Villadsen, S.B.; Fristrup, N.; Sørensen, K.D.; Ulhøi, B.; Borre, M.; Kjems, J.; Dyrskjøt, L.; et al. miR-145 induces caspase-dependent and -independent cell death in urothelial cancer cell lines with targeting of an expression signature present in Ta bladder tumors. Oncogene 2010, 29, 1073–1084. [Google Scholar] [CrossRef]
- Wang, S.; Bian, C.; Yang, Z.; Bo, Y.; Li, J.; Zeng, L.; Zhou, H.; Zhao, R.C. miR-145 inhibits breast cancer cell growth through RTKN. Int. J. Oncol. 2009, 34, 1461–1466. [Google Scholar] [PubMed]
- Dong, R.; Liu, X.; Zhang, Q.; Jiang, Z.; Li, Y.; Wei, Y.; Li, Y.; Yang, Q.; Liu, J.; Wei, J.-J.; et al. miR-145 inhibits tumor growth and metastasis by targeting metadherin in high-grade serous ovarian carcinoma. Oncotarget 2014, 5, 10816–10829. [Google Scholar] [CrossRef]
- Mak, I.W.Y.; Singh, S.; Turcotte, R.; Ghert, M. The epigenetic regulation of SOX9 by miR-145 in human chondrosarcoma. J. Cell. Biochem. 2015, 116, 37–44. [Google Scholar] [CrossRef]
- Cioce, M.; Ganci, F.; Canu, V.; Sacconi, A.; Mori, F.; Canino, C.; Korita, E.; Casini, B.; Alessandrini, G.; Cambria, A.; et al. Protumorigenic effects of mir-145 loss in malignant pleural mesothelioma. Oncogene 2014, 33, 5319–5331. [Google Scholar] [CrossRef]
- Wan, X.; Cheng, Q.; Peng, R.; Ma, Z.; Chen, Z.; Cao, Y.; Jiang, B. ROCK1, a novel target of miR-145, promotes glioma cell invasion. Mol. Med. Rep. 2014, 9, 1877–1882. [Google Scholar] [CrossRef] [PubMed]
- Koo, S.; Martin, G.; Toussaint, L.G. MicroRNA-145 Promotes the Phenotype of Human Glioblastoma Cells Selected for Invasion. Anticancer Res. 2015, 35, 3209–3215. [Google Scholar]
- Condrat, C.E.; Thompson, D.C.; Barbu, M.G.; Bugnar, O.L.; Boboc, A.; Cretoiu, D.; Suciu, N.; Cretoiu, S.M.; Voinea, S.C. miRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 2020, 9, 276. [Google Scholar] [CrossRef] [PubMed]
- Coradduzza, D.; Solinas, T.; Balzano, F.; Culeddu, N.; Rossi, N.; Cruciani, S.; Azara, E.; Maioli, M.; Zinellu, A.; De Miglio, M.R.; et al. miRNAs as Molecular Biomarkers for Prostate Cancer. J. Mol. Diagn. 2022, 24, 1171–1180. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Jung, G.; Kim, J.H.; Byun, S.-S.; Hong, S.K. Role of prostate health index to predict Gleason score upgrading and high-risk prostate cancer in radical prostatectomy specimens. Sci. Rep. 2021, 11, 17447. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, Y.; Zhang, F.; Ji, Z.; Yang, P.; Tian, Y. Predicting Gleason sum upgrading from biopsy to radical prostatectomy pathology: A new nomogram and its internal validation. BMC Urol. 2021, 21, 3. [Google Scholar] [CrossRef]
- Rajarajan, D.; Kaur, B.; Penta, D.; Natesh, J.; Meeran, S.M. miR-145-5p as a predictive biomarker for breast cancer stemness by computational clinical investigation. Comput. Biol. Med. 2021, 135, 104601. [Google Scholar] [CrossRef] [PubMed]
- Cho, W.C.; Wong, C.F.; Li, K.P.; Fong, A.H.; Fung, K.Y.; Au, J.S. miR-145 as a Potential Biomarker and Therapeutic Target in Patients with Non-Small Cell Lung Cancer. Int. J. Mol. Sci. 2023, 24, 10022. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Han, Y.; Liu, F.; Ruan, L. Downregulations of miR-449a and miR-145-5p Act as Prognostic Biomarkers for Endometrial Cancer. J. Comput. Biol. 2020, 27, 834–844. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ta, W.-W.; Sun, P.-F.; Meng, Y.-F.; Zhao, C.-Z. Diagnostic and prognostic significance of serum miR-145-5p expression in glioblastoma. Int. J. Clin. Exp. Pathol. 2019, 12, 2536–2543. [Google Scholar] [PubMed]
- Zhang, Y.; Wen, X.; Hu, X.-L.; Cheng, L.-Z.; Yu, J.-Y.; Wei, Z.-B. Downregulation of miR-145-5p correlates with poor prognosis in gastric cancer. Eur. Rev. Med. Pharmacol. Sci. 2016, 20, 3026–3030. [Google Scholar]
- Hu, W.; Chen, W.-M.; Jiao, J.-B. Plasma miR-145 as a novel biomarker for the diagnosis and radiosensitivity prediction of human cervical cancer. J. Int. Med. Res. 2017, 45, 1054–1060. [Google Scholar] [CrossRef]
- Li, H.; Huang, G.; Lai, Y.; Ni, L.; Lai, Y. A Panel of Three Serum MicroRNAs as a Potential Diagnostic Biomarker for Urothelial Carcinoma. Oncol. Res. Treat. 2022, 45, 344–352. [Google Scholar] [CrossRef] [PubMed]
- McNally, C.J.; Ruddock, M.W.; Moore, T.; McKenna, D.J. Biomarkers That Differentiate Benign Prostatic Hyperplasia from Prostate Cancer: A Literature Review. Cancer Manag. Res. 2020, 12, 5225–5241. [Google Scholar] [CrossRef] [PubMed]
- McNally, C.J.; Watt, J.; Kurth, M.J.; Lamont, J.V.; Moore, T.; Fitzgerald, P.; Pandha, H.; McKenna, D.J.; Ruddock, M.W. A Novel Combination of Serum Markers in a Multivariate Model to Help Triage Patients Into “Low-” and “High-Risk” Categories for Prostate Cancer. Front. Oncol. 2022, 12, 837127. [Google Scholar] [CrossRef]
- Eklund, M.; Nordström, T.; Aly, M.; Adolfsson, J.; Wiklund, P.; Brandberg, Y.; Thompson, J.; Wiklund, F.; Lindberg, J.; Presti, J.C.; et al. The Stockholm-3 (STHLM3) Model can Improve Prostate Cancer Diagnostics in Men Aged 50-69 yr Compared with Current Prostate Cancer Testing. Eur. Urol. Focus 2018, 4, 707–710. [Google Scholar] [CrossRef]
- Ye, D.; Shen, Z.; Zhou, S. Function of microRNA-145 and mechanisms underlying its role in malignant tumor diagnosis and treatment. Cancer Manag. Res. 2019, 11, 969–979. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.W.; Jo, H.-S.; Bae, S.; Seo, Y.; Song, P.; Song, M.; Yoon, J.H. Application of Proteomics in Cancer: Recent Trends and Approaches for Biomarkers Discovery. Front. Med. 2021, 8, 747333. [Google Scholar] [CrossRef] [PubMed]
- De Vargas Roditi, L.; Jacobs, A.; Rueschoff, J.H.; Bankhead, P.; Chevrier, S.; Jackson, H.W.; Hermanns, T.; Fankhauser, C.D.; Poyet, C.; Chun, F.; et al. Single-cell proteomics defines the cellular heterogeneity of localized prostate cancer. Cell Rep. Med. 2022, 3, 100604. [Google Scholar] [CrossRef] [PubMed]
- Goldman, M.J.; Craft, B.; Hastie, M.; Repečka, K.; McDade, F.; Kamath, A.; Banerjee, A.; Luo, Y.; Rogers, D.; Brooks, A.N.; et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat. Biotechnol. 2020, 38, 675–678. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Qu, H.; Wang, S.; Chater, J.M.; Wang, X.; Cui, Y.; Yu, L.; Zhou, R.; Jia, Q.; Traband, R.; et al. CancerMIRNome: An interactive analysis and visualization database for miRNome profiles of human cancer. Nucleic Acids Res. 2022, 50, D1139–D1146. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.-Y.; Lin, Y.-C.; Cui, S.; Huang, Y.; Tang, Y.; Xu, J.; Bao, J.; Li, Y.; Wen, J.; Zuo, H.; et al. miRTarBase update 2022: An informative resource for experimentally validated miRNA-target interactions. Nucleic Acids Res. 2022, 50, D222–D230. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.; Liu, Y.; Zheng, C.; Qu, H. dbEMT 2.0: An updated database for epithelial-mesenchymal transition genes with experimentally verified information and precalculated regulation information for cancer metastasis. J. Genet. Genom. Yi Chuan Xue Bao 2019, 46, 595–597. [Google Scholar] [CrossRef]
- Vasaikar, S.V.; Deshmukh, A.P.; Hollander, P.D.; Addanki, S.; Kuburich, N.A.; Kudaravalli, S.; Joseph, R.; Chang, J.T.; Soundararajan, R.; Mani, S.A. EMTome: A resource for pan-cancer analysis of epithelial-mesenchymal transition genes and signatures. Br. J. Cancer 2021, 124, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Venny 2.1.0. Available online: https://bioinfogp.cnb.csic.es/tools/venny/ (accessed on 29 June 2023).
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef]
- Lánczky, A.; Győrffy, B. Web-Based Survival Analysis Tool Tailored for Medical Research (KMplot): Development and Implementation. J. Med. Internet Res. 2021, 23, e27633. [Google Scholar] [CrossRef] [PubMed]
- Warde-Farley, D.; Donaldson, S.L.; Comes, O.; Zuberi, K.; Badrawi, R.; Chao, P.; Franz, M.; Grouios, C.; Kazi, F.; Lopes, C.T.; et al. The GeneMANIA prediction server: Biological network integration for gene prioritization and predicting gene function. Nucleic Acids Res. 2010, 38 (Suppl. 2), W214–W220. [Google Scholar] [CrossRef] [PubMed]
- Kern, F.; Aparicio-Puerta, E.; Li, Y.; Fehlmann, T.; Kehl, T.; Wagner, V.; Ray, K.; Ludwig, N.; Lenhof, H.-P.; Meese, E.; et al. miRTargetLink 2.0—Interactive miRNA target gene and target pathway networks. Nucleic Acids Res. 2021, 49, W409–W416. [Google Scholar] [CrossRef] [PubMed]
- Mazzara, S.; Rossi, R.L.; Grifantini, R.; Donizetti, S.; Abrignani, S.; Bombaci, M. CombiROC: An interactive web tool for selecting accurate marker combinations of omics data. Sci. Rep. 2017, 7, 45477. [Google Scholar] [CrossRef]
GENE SET | GENE SET ID | Description | Count/ List Total | Adjusted p-Value 1 | Gene Symbol |
---|---|---|---|---|---|
KEGG | hsa05215 | Prostate cancer | 9/238 | 3.37 × 10−4 | CDKN1A; EGFR; IGF1R; ERG; NRAS; MDM2; BRAF; PDGFD; E2F3 |
Disease Ontology | DOID:10283 | prostate cancer | 29/238 | 7.82 × 10−8 | MUC1; MYO6; CDKN1A; IRS1; EGFR; MYC; IFNB1; IGF1R; VEGFA; SERPINE1; ESR1; NUDT1; MDM2; MMP1; MMP12; MMP14; SMAD3; SMAD4; PDGFD; CTNND1; SP1; RPS6KA3; IGFBP5; MUC4; ABCC1; SET; HIF1A; PXN; MSH3 |
DOID:10286 | prostate carcinoma | 7/238 | 3.15 × 10−2 | EGFR; MYC; IGF1R; VEGFA; ESR1; MMP14; PDGFD | |
DisGeNET | umls:C0936223 | Metastatic Prostate Carcinoma | 13/238 | 6.37 × 10−5 | KLF4; MUC1; CDKN1A; EGFR; MYC; VEGFA; JAG1; ERG; MMP14; CD44; CTNND1; SENP1; HIF1A |
umls:C0007112 | Adenocarcinoma of prostate | 11/238 | 6.54 × 10−5 | EGFR; VEGFA; SERPINE1; ESR1; ERG; ILK; CD44; BRAF; PSAT1; DUSP6; HIF1A | |
umls:C1654637 | androgen independent prostate cancer | 10/238 | 2.58 × 10−4 | CDKN1A; PPP3CA; EGFR; FSCN1; ESR1; ERG; ADAM17; PTP4A2; PSAT1; HIF1A | |
umls:C0278838 | Prostate cancer recurrent | 3/238 | 2.77 × 10−2 | EGFR; SOX9; PSAT1 | |
umls:C1328504 | Hormone refractory prostate cancer | 4/238 | 4.79 × 10−2 | EGFR; FSCN1; ESR1; PSAT1 |
GENE SET | GENE SET ID | Description | Count/ List Total | Adjusted p-Value 1 | Gene Symbol |
---|---|---|---|---|---|
KEGG | hsa04350 | TGF-beta signaling pathway | 11/238 | 7.52 × 10−6 | MYC; SMAD3; SMAD5; TGFBR2; SMAD4; SP1; ZFYVE9; ROCK1; RPS6KB1; TGFB2; SMAD2 |
hsa04520 | Adherens junction | 8/238 | 2.37 × 10−4 | YES1; EGFR; IGF1R; ACTB; SMAD3; TGFBR2; SMAD4; CTNND1 | |
hsa04510 | Focal adhesion | 12/238 | 1.18 × 10−3 | EGFR; IGF1R; VEGFA; ITGB8; PAK4; ILK; BRAF; ACTB; PDGFD; ROCK1; TNR; PXN | |
REACTOME | R-HSA-1474244 | Extracellular matrix organization | 12/238 | 3.14 × 10−2 | SERPINE1; ITGB8; ADAM17; F11R; MMP1; MMP12; MMP14; COL5A1; CD44; P4HA1; TNR; TGFB2 |
R-HSA-446728 | Cell junction organization | 6/238 | 3.28 × 10−2 | ILK; CDH2; F11R; ACTB; CTNND1; PXN | |
R-HSA-1442490 | Collagen degradation | 5/238 | 3.44 × 10−2 | ADAM17; MMP1; MMP12; MMP14; COL5A1 | |
GO-BP | GO:0010810 | regulation of cell-substrate adhesion | 15/238 | 1.38 × 10−5 | FZD7; VEGFA; SERPINE1; JAG1; NEDD9; ILK; MMP12; MMP14; RREB1; SMAD3; CDK6; ANGPT2; ROCK1; CCDC80; WASHC2C |
GO:0031589 | cell-substrate adhesion | 19/238 | 1.45 × 10−5 | FZD7; VEGFA; SERPINE1; JAG1; NEDD9; ILK; CTGF; MMP12; MMP14; RREB1; CD44; SMAD3; CDK6; ANGPT2; ROCK1; CCDC80; MUC4; PXN; WASHC2C | |
GO:0010464 | regulation of mesenchymal cell proliferation | 7/238 | 1.99 × 10−5 | STAT1; MYC; VEGFA; IRS2; SOX9; TGFBR2; CTNNBIP1 | |
GO:0048762 | mesenchymal cell differentiation | 14/238 | 4.83 × 10−5 | STAT1; JAG1; DDX17; HDAC2; SOX9; SOX11; SMAD3; TGFBR2; SMAD4; ERBB4; HMGA2; HIF1A; TGFB2; SMAD2 | |
GO:0010632 | regulation of epithelial cell migration | 16/238 | 5.21 × 10−5 | KLF4; MAP3K3; VEGFA; ADAM17; ETS1; RREB1; SOX9; TGFBR2; SP1; ARF6; ANGPT2; SRPX2; HBEGF; HIF1A; CD40; TGFB2 | |
GO:0001837 | epithelial to mesenchymal transition | 11/238 | 8.39 × 10−5 | JAG1; DDX17; HDAC2; SOX9; SMAD3; TGFBR2; SMAD4; HMGA2; HIF1A; TGFB2; SMAD2 | |
GO:0010631 | epithelial cell migration | 17/238 | 9.64 × 10−5 | KLF4; MAP3K3; VEGFA; ADAM17; ETS1; RREB1; SOX9; TGFBR2; SP1; ARF6; ANGPT2; SRPX2; HBEGF; HIF1A; PXN; CD40; TGFB2 | |
GO:0001952 | regulation of cell-matrix adhesion | 9/238 | 4.96 × 10−4 | VEGFA; SERPINE1; JAG1; ILK; MMP12; MMP14; SMAD3; CDK6; ROCK1 | |
MSigDB | HALLMARK_EMT | HALLMARK_EMT | 11/238 | 4.15 × 10−2 | VEGFA; SERPINE1; CTGF; CDH2; MEST; MMP1; MMP14; COL5A1; CD44; SNTB1; TGFBI |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Armstrong, L.; Willoughby, C.E.; McKenna, D.J. The Suppression of the Epithelial to Mesenchymal Transition in Prostate Cancer through the Targeting of MYO6 Using MiR-145-5p. Int. J. Mol. Sci. 2024, 25, 4301. https://doi.org/10.3390/ijms25084301
Armstrong L, Willoughby CE, McKenna DJ. The Suppression of the Epithelial to Mesenchymal Transition in Prostate Cancer through the Targeting of MYO6 Using MiR-145-5p. International Journal of Molecular Sciences. 2024; 25(8):4301. https://doi.org/10.3390/ijms25084301
Chicago/Turabian StyleArmstrong, Lee, Colin E. Willoughby, and Declan J. McKenna. 2024. "The Suppression of the Epithelial to Mesenchymal Transition in Prostate Cancer through the Targeting of MYO6 Using MiR-145-5p" International Journal of Molecular Sciences 25, no. 8: 4301. https://doi.org/10.3390/ijms25084301
APA StyleArmstrong, L., Willoughby, C. E., & McKenna, D. J. (2024). The Suppression of the Epithelial to Mesenchymal Transition in Prostate Cancer through the Targeting of MYO6 Using MiR-145-5p. International Journal of Molecular Sciences, 25(8), 4301. https://doi.org/10.3390/ijms25084301