Next Article in Journal
A Simple One-Pot Method for the Synthesis of BiFeO3/Bi25FeO40 Heterojunction for High-Performance Photocatalytic Degradation Applications
Next Article in Special Issue
MicroRNAs in Plasma-Derived Extracellular Vesicles as Non-Invasive Biomarkers for Eosinophilic Esophagitis
Previous Article in Journal
Harnessing Mesenchymal Stromal Cells for Advanced Wound Healing: A Comprehensive Review of Mechanisms and Applications
Previous Article in Special Issue
Autoimmune Thyroid Disease in Patients with Down Syndrome—Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients

1
Department of Physiopathology, Faculty of Medicine, Medical University of Gdansk, 80-210 Gdansk, Poland
2
Pomeranian Rheumatology Center, 81-759 Sopot, Poland
3
Department of Embryology, Faculty of Medicine, Medical University of Gdansk, 80-210 Gdansk, Poland
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 197; https://doi.org/10.3390/ijms26010197
Submission received: 25 November 2024 / Revised: 23 December 2024 / Accepted: 27 December 2024 / Published: 29 December 2024

Abstract

:
Rheumatoid arthritis (RA), an autoimmune disease with complex pathogenesis, is characterized by an immune imbalance reflected, e.g., in the disturbed cytokines’ profile. Various viruses and bacteria can cause the upregulation of pro-inflammatory cytokines influencing RA development. In particular, oral cavity dysbiosis, observed in multiple chronic diseases including periodontitis, may be linked to RA. The cytokine profile (IL-1β, IP-10, IL-29, GM-CSF, IFN-α2, IFN-β, TGF-β1, MPC-1, TNF-α, IFN-γ, IL-6, IL-10, IL-17A, IL-12p70, IL-2, and IL-4) of RA patients’ saliva was evaluated using flow cytometry and benchmarked with their levels in saliva of healthy controls and patients with other rheumatic diseases. The levels of IL-1β, IP-10, IL-2, and IL-4 were significantly elevated in RA patients’ saliva compared to other studied groups. To define the potential role of the most suspicious microbial agents (Epstein–Barr Virus (EBV), Cytomegalovirus, Parvovirus B19, Porphyromonas gingivalis, and Segatella copri) for RA pathogenesis, the amounts of their DNA in the saliva of patients with RA were assessed in all the groups mentioned above. The EBV and P. gingivalis DNA levels measured by qRT-PCR were significantly higher in RA patients’ saliva than in other groups, indicating either the important role of these agents in RA pathogenesis or the higher susceptibility of RA patients for those infectious factors. The comprehension of the association of specific cytokine profiles in RA and the occurrence of specific viral and/or bacterial infections can be a key to a better understanding of RA pathogenesis. These results illustrate the complexity of the immunological profile of RA, show the high diagnostic potential of saliva, and provide insight into how various infections can contribute to RA development.

1. Introduction

The exact nature of rheumatoid arthritis (RA) outset is not well known. The diagnosis of RA depends on the coexistence of clinical symptoms and the occurrence of specific biomarkers, including antibodies against cyclic citrullinated peptide antigen (anti-CCP) and rheumatoid factor (RF) [1]. The pathogenesis of this autoimmune disease involves various agents, including genetic and environmental factors. Among the most common factors are HLADRB1 polymorphism, female hormones (especially estrogen), diet, cigarette smoking, viruses, and bacteria [2,3,4]. RA is considered as a systemic disease; outside the joints, it also adversely affects the cardiovascular system, bone marrow, immune system, and salivary glands [5,6,7]. RA is characterized by dysfunctions in both innate and adaptive immune systems. Cells of the innate system like macrophages, neutrophils, and natural killer (NK) cells are involved in joint inflammation. On the other hand, antigen-presenting cells (APCs), which can also belong to both the innate and adaptive immune system, participate in inflammation and secrete and stimulate the release of pro-inflammatory cytokines like interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) [8]. The impact of those cytokines on the development of RA is indisputable. Not surprisingly, the development of therapies involving monoclonal antibodies capable of blocking the signaling of IL-6 and TNF-α is considered a milestone in the treatment of severe RA [9]. Besides IL-6 and TNF-α, different cytokines including granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-17 (IL-17), interleukin-21 (IL-21), and interleukin-23 (IL-23) can play an important role in RA development and are potential factors that are also considered in current and future RA therapies [10]. According to DrugBank information from June 11, 2024, inhibitors of some of the mentioned cytokines (Anakinra (IL-1 receptor antagonist), Secukinumab, and Ixekizumab (antibodies against IL-17A)) are approved for RA treatment [11]. The production of cytokines can be induced through various factors also involving bacterial and viral antigens [12]. Among cytokines typical for an immune reaction against a pathogen, type I interferon (IFN), type II interferon (IFN-γ), IL-1β, interleukin-12 (IL-12), and TNF-α can be distinguished. Moreover, the role of these cytokines in autoimmunity initiation is well established [8].
Different pathogens’ participation in autoimmunity development has been an object of research for decades. Latent or active viral infections, as well as bacterial infections or the disruption of microbiota homeostasis, can participate in RA pathogenesis [13]. Viruses can stimulate the immune system through various mechanisms, among which the most common are molecular mimicry, bystander activation, and epitope spreading [14]. Molecular mimicry is a process that occurs due to structural similarity between foreign antigens and self-peptides. It results in the activation of autoreactive T and B cells, and the production of pro-inflammatory cytokines [15]. Epstein–Barr Virus (EBV), Cytomegalovirus (CMV), and Parvovirus B19 (PB19) are often cited as major viral risk factors for autoimmune disease development. The antibodies directed against their elements are commonly detected among patients with RA in significantly higher titers than in healthy people [14].
The potential role of bacterial infection participation in autoimmunity development is becoming a growing topic of research nowadays. Particular attention has begun to be paid to the potential role of oral microbiome dysbiosis in the development of RA. The oral microbiome consists of symbiotic, commensal, and pathogenic organisms residing in the oral cavity. In a healthy oral microbiome, the vast majority of them are Gram-positive aerobic bacteria. Disbalance influenced by changes in the oral environment can lead to periodontitis (PD) development [16]. In PD, the healthy microbiome living in periodontal pockets is replaced by the Gram-negative anaerobic bacteria. PD is mostly caused by so-called “red-complex” bacteria including Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola [17]. In the context of the development of RA, P. gingivalis provokes the greatest interest. This bacterium, due to peptidyl-arginine deaminase (PAD) activity, is capable of citrullinating the host’s peptides, including fibrin and α-enolase, which results in the production of different anti-CCP antibodies, like anti-cyclic citrullinated peptide and anti-citrullinated enolase peptide (anti-CEP). These two types of ACPA (anti-citrullinated protein antibodies) can be detected in both PD and RA patients [18,19].
Segatella copri (S. copri, formerly Prevotella copri) is a gut microbiota bacterium commonly found in high abundance in RA patients’ fecal samples. Its potential role in RA pathogenesis may be due to the stimulation of the T helper (Th) 17 cell population and induction of Th17-cell-related cytokine production (IL-6 and IL-23) [20]. Moreover, S. copri can be found in the oral cavity of RA patients, which indicates that this bacterium, which is not only limited to the gut, can play a role in RA outset and development [7,21].
There are multiple papers evaluating cytokine levels in RA patients and the association of chosen pathogens with this disease, although presented results differ significantly between the sources, making their interpretation difficult [22,23]. Moreover, most studies show results of comparisons between RA patients and healthy volunteers only, even though the group of rheumatic diseases is far more diverse. In the vast majority of these studies, serum, plasma, or synovial fluid are used as a material for immunological or microbiological assessment, and there are very few reports on the use of saliva for this purpose. The cytokines levels in serum and mononuclear cells in the same group of patients were already measured by Brzustewicz E. et al. in a previous study. This study proved differences in cytokine concentrations between patients with undifferentiated arthritis and healthy controls. Moreover, the immune status of the patients changed during treatment [24]. In our study, we aimed to compare the levels of a broad spectrum of cytokines in the saliva of RA patients, group of patients with other rheumatic diseases (ORD), and healthy volunteers using the flow cytometry technique. Moreover, we also checked the saliva samples of people from the abovementioned groups for amounts of DNA from EBV, CMV, Parvovirus B19, P. gingivalis, and S. copri using a quantitative real-time polymerase chain reaction (qRT-PCR).

2. Results

2.1. Levels of Anti-Viral Response Cytokines

Our study aimed to assess the possible differences in the concentrations of saliva cytokines between RA patients and patients with other rheumatic diseases. Additionally, the cytokines levels obtained for RA patients were also compared with those present in the saliva of healthy volunteers (HC).
Among all the analyzed cytokines from the anti-viral panel (GM-CSF, IFN-α2, IFN-β, IFN-γ, IL-1β, IL-8, IL-10, IL-12p70, IL-29, interferon gamma-induced protein 10 (IP-10)), only the concentrations of IL-1β and IP-10 were significantly higher in the saliva of RA patients than in the saliva of ORD patients (Figure 1B,E). Additionally, the IL-1β level was also significantly higher in RA patients’ saliva in comparison to healthy volunteers (Figure 1E).

2.2. Levels of Inflammation-Associated Cytokines

Surprisingly, out of the cytokines measured in the inflammation response panel, only the concentrations of non-inflammatory IL-2 and IL-4 were significantly higher in RA patients’ saliva in comparison to patients with ORD (Figure 2A and Figure 2B, respectively). The rest of the measured cytokines from that panel (IL-6, IL-17A, monocyte chemoattractant protein-1 (MPC-1), transforming growth factor β1 (TGF-β1), TNF-α) did not significantly differ between the studied groups (Figure 2C–G). There was also no significant difference between all measured cytokines in the saliva of RA patients and healthy subjects. Interestingly, much fewer saliva samples from RA patients contained undetectable levels of either IL-2 or IL-4 (6/14 for IL-2 and 4/14 for IL-4) compared to ORD (10/13 and 10/12, respectively) and to HC (10/13 and 7/13, respectively).

2.3. Numbers of Copies of Viral and Bacterial DNA

Three viruses (CMV, EBV, and Parvovirus B19) and two bacteria (S. copri and P. gingivalis) were detected and measured in the saliva samples of patients and healthy volunteers by qRT-PCR.
The results in all viral qRT-PCRs were considered positive at levels above 10 copies (cp)/µL. EBV loads above this level were obtained in 42.86% of the samples of DNA isolated from RA patients’ saliva, 15.79% of the samples of DNA isolated from healthy subjects, and 11.76% of the samples of DNA isolated from patients with other rheumatic diseases. The differences in proportions of positive samples were not significant. In the case of CMV and Parvovirus B19, all obtained results in every analyzed group were below 10 cp/µL; therefore, they were treated as negative ones.
The comparison of fold change, obtained from a qRT-PCR by Tukey’s multiple comparison tests (Figure 3), revealed significantly higher EBV load in RA patients’ saliva samples in comparison to both healthy volunteers and patients with ORD. CMV and Parvovirus B19 DNA were not detected in all studied groups; therefore, no differences were present. In all cases, the internal control of each sample was at the expected level, ensuring the reliability of results.
In the case of P. gingivalis, positive samples were those with concentrations greater than 13 × 106 cp/µL. P. gingivalis load above this level was obtained in 42.86% of the DNA saliva samples isolated from patients with RA, 5.88% of the DNA samples isolated from healthy subjects, and 18.75% of the DNA saliva samples isolated from patients with other rheumatic diseases. The only significant difference in the proportion of samples positive for P. gingivalis were between RA and HC (p-value = 0.0143). For S. copri, positive samples were obtained at a level higher than 10 cp/µL. S. copri load above this level was obtained in 7.69% of the DNA saliva samples isolated from RA patients, 23.52% of the DNA samples isolated from healthy subjects, and 10.52% of the DNA samples isolated from patients with other rheumatic diseases. In the case of S. copri, differences in proportions of positive samples were not significant.
Tukey’s multiple comparison test proved that the P. gingivalis fold change in DNA isolated from RA patients was significantly higher in comparison to both healthy subjects and patients with ORD (Figure 4A). There were no statistically significant differences in S. copri fold change (Figure 4B).

2.4. There Are Correlations Between Measured Cytokines and Patients’ Clinical Features

Figure 5 presents results from the Spearman correlation analysis between clinical features of patients and cytokines levels in their saliva samples. At p < 0.01, statistical significance was observed for correlations between hemoglobin level and IL-2 level, as well as joint swelling in ACR scale and MPC-1 level, where the first correlation was negative and the second was positive. Moreover, with significance at p < 0.005, correlations between IL-2 level and erythrocyte sedimentation rate (ESR), IL-6 level and ALAT, and IL-29 level and the number of swelling joints in the DAS28 scale were observed. All of these correlations were positive. Other correlations with statistical significance with at least p < 0.05 are also presented in Figure 5.
Figure 6 shows the correlations between concentrations of all measured cytokines and their delta Ct values obtained from qRT-PCR. To generate the plot, Spearman coefficients and p-values were computed. Statistically significant correlations were present in the abundance between cytokines, and most of them were positive ones. Delta CT results obtained from qRT-PCR in the vast majority did not correlate with cytokines and each other in a statistically significant way. The only exception was the value of Delta Ct obtained for EBV, which significantly (p < 0.05) correlated with the level of TGF-β1, lowering its concentration in saliva.

3. Discussion

In our study, we aimed to compare levels of cytokines, as well as viral and bacterial DNA levels, in the saliva of RA patients, patients with other rheumatic diseases, and healthy volunteers. For cytokine measurement, we chose flow cytometry, as this technique allows for the determination of many cytokines levels at once. To determine the amount of DNA in saliva, we used qRT-PCR, according to the ease, speed, and accuracy of this method. Both of these methods allowed us to limit the amount of material used for analysis. Because we aimed for saliva as our experimental material, the volume of accessible material was a crucial limiting factor, as it is well known that, in many rheumatic diseases, the problem with salivary gland activity is quite common.
One of the measured cytokines was IL-1β, a pro-inflammatory cytokine, commonly detected in higher levels in the sera of RA patients [25]. IL-1β is produced by monocytes and macrophages [26] as a precursor protein termed pro-IL-1β; the mature protein is created due to the activity of caspase-1 triggered in the NLRP inflammasome [27]. This cytokine plays a crucial role in RA pathogenesis and progression by inducing the production of other cytokines (e.g., chondrocytes and synovial mononuclear cells), enhancing matrix metalloproteinases (MMPs) release by fibroblasts, and consecutive bone erosion [28]. We observed significantly higher levels of IL-1β in the saliva of RA patients in comparison to healthy volunteers. Apart from the abovementioned impact of IL-1β on MMP activity, it is also one of the major inflammatory mediators, and an elevated level of this cytokine is commonly observed during chronic inflammatory diseases [29]. In another study, a higher level of IL-1β was also detected in samples from ORD patients (ankylosing spondylitis [30] and osteoarthritis [31]). Our observations indicated elevated levels of this cytokine in RA patients’ saliva in comparison to ORD, which can suggest the more extensive role of this cytokine in RA than in ORD; but, on the other hand, it can be the result of selecting different biological material (saliva in our study and sera in the cited papers) for analysis. Moreover, we found out that the level of IL-1β positively correlates with IP-10, the level of which was also significantly higher in RA patients in comparison to healthy subjects. This result may have been because both of these molecules are produced during ongoing inflammation, but there are no reports at this point suggesting, e.g., positive feedback between them or any other type of cooperation suggesting their possible net effect on RA development. IP-10 is a chemokine, the production of which is induced by IFN-γ in various cell types including macrophages, endothelial cells, and fibroblasts [32]. We found it not surprising, then, that there is a strong positive correlation between IFN-γ and IP-10 levels in RA patients’ saliva. Like other chemokines, IP-10 plays a role in leukocyte trafficking and can be involved in various infectious and inflammatory processes, as well as autoimmune rheumatic disease development [33]. According to Lee et al.’s studies, IP-10 induces cell migration through C-X-C chemokine receptor 3 (CXCR3) and can play a role in the progression of arthritis by CXCR3 and toll-like receptor-4 (TLR4) [32].
IL-2 is known for its immunomodulatory effect, mostly including the regulation of T cells. IL-2 plays an important role in the development and function of T regulatory cells and is also an important molecule in ensuring the proper function of conventional T cells [34]. According to our study, the IL-2 levels in RA patients’ saliva were significantly higher in comparison to ORDs’ and were detectable in the majority of patients’ saliva samples. Moreover, IL-2 correlates with such parameters as the ESR, level of hemoglobin [g/dL], hematocrit [%], and joint pain in ACR scale. All these parameters reflect disease activity, which indicates that the level of this cytokine is associated with disease severity. That is not surprising per se, because similar findings were already observed in Baochen Li et al.’s study of the RA patients’ sera, where elevated levels of IL-2 were associated with the disease activity parameters, such as ESR, DAS28, and C-reactive protein (CRP). The IL-2 level can impact the disease by influencing the balance between Th17 and Treg cells, where dysregulation is one of the key mechanisms in RA pathogenesis [35]. There is also a relationship between IL-2 level and natural killer (NK) cells, where IL-2 can enhance NK cell cytotoxicity. Interestingly, according to Kogure T et al.’s study, patients with RA are characterized by a lower induction of killer cell inhibitory receptors (KIRs) in response to IL-2. This can be a major reason for the higher susceptibility of RA patients to microbial infections [36].
The last out of the analyzed cytokines, whose level was significantly higher in RA than in ORD patients, was IL-4. This anti-inflammatory cytokine can be produced by various cells like mast cells, basophils, and eosinophils, but, in vast majority, it is produced by T cells. IL-4 is a member of the Th2 cytokine family, with IL-13 inducing the differentiation of naïve T cells into Th2 cells and the activation of B cells and production of antibodies [37]. Moreover, IL-4 plays a crucial role in the regulation of the cells’ proliferation and apoptosis [38]. It would seem logical that, because of its function in differentiating T cells into Th2 cells and the reduction in cytokine production by Th1 cells, increased levels of IL-4 would have the effect of reducing disease severity in patients with RA [39]. The treatment of a collagen-induced arthritis (CIA) mouse model with anti-IL-4 antibodies leads to increased severity of the disease, though, which is associated with the exacerbation of inflammatory reaction. This can indicate the protective role of IL-4 in RA [40]. Even though elevated levels of IL-4 are commonly found among RA patients in different stages of the disease [41,42], some studies suggest that IL-4 is necessary for the disease outset. In some cases, the reduction in IL-4 decreases the amount of autoantibodies, which correlates with diminished disease severity. Due to these observations, IL-4 can play both roles in RA, pathogenic and protective, and a better understanding of its role in RA is necessary [43].
Other studied cytokines, TGF-β1, MPC-1, TNF-α, IL-6, IL-8, IL-10, IL-17A, IL-12p70, IL-29, GM-CSF, IFN-α2, IFN-β, and IFN-γ, did not show any saliva concentration differences between all studied groups. Most of these cytokines play an important role in RA pathogenesis and progression. The usage of inhibitors to some of these cytokines, especially IL-6 and TNF-α in RA therapy, bring very good results in disease suppression [44]. Our results may be explained by the small number of patients in the analyzed groups and the use of saliva as a diagnostic material instead of serum or plasma. Some cytokines are produced directly in the mouth (IL-1β, IL-6, TNF-α), and their concentration in the mouth can be even higher than in the blood. On the other hand, some cytokines (IL-10, IFN-γ) are at lower concentrations in saliva than in blood [45]. The same conclusion can be drawn from our study, where some cytokines are at barely detectable concentrations or below the scale of quantification. Expanding study groups and/or changing the analytical method, for example, to quantitative PCR, which is proven to be more sensitive than flow cytometry, could potentially lead to statistically significant results. However, the detection of mRNA for cytokines will not exactly correlate with the amount of cytokine itself. In our opinion, we measured the possible working concentration of cytokines, which depends both on the amount of production and the possible turnover of the cytokines of interest.
Apart from the cytokines levels, we checked whether there were differences in the specific pathogen load in the saliva samples of RA, ORD, and HC individuals by measuring the amount of DNA from EBV, CMV, and Parvovirus B19 viruses as well as P. gingivalis and S. copri bacteria. Among all of the analyzed viruses, only the load of EBV was significantly higher in RA patients’ saliva than in ORD patients and healthy volunteers. All these viruses are known as possible risk factors for RA development and are typically found in the vast majority of society. Among them, EBV is the most common and it is present in almost 99% of the population [46]. The obtained results are probably not because of the active phase of primary infection because, in contrary to anti-viral antibodies (EBV nuclear antigen 1 (EBNA-1), IgG and capsid antigen (CA) IgG), which persist for life [46], the level of EBV DNA in saliva decreases with time [47]. That can indicate a possible role of viral reactivation in the outset and/or progress of RA. Interestingly, a higher level of EBV DNA in the saliva of RA patients is possibly due to more intensive replication of this virus in the oral epithelia of RA patients. Fetchner S. et al. observed the increased EBV reactivation cycles among RA patients in preclinical stages, which can support our hypothesis [48]. Nonetheless, this possibility should be independently confirmed through the detection of certain biomarkers of reactivation (EBNA-1, CA, and early antigen-diffuse (EA-D)). During replication, the virus expresses EBNA-1, a major EBV epitope, which was also detected at higher levels in RA patients. Molecular mimicry between some autoantigens and EBNA-1 can lead to tolerance breakdown and the initiation of the disease [49]. Moreover, a higher level of EBV DNA in saliva correlates negatively with TGF-β1 levels. The same situation is observed in EBV-related cancers. TGF-β1 plays a part in the modulation of cell proliferation, adhesion, differentiation, and survival. Moreover, it is a tumor suppressor, and abnormalities in its functioning can lead to the development of cancer and other diseases [50].
S. copri and P. gingivalis DNA levels in saliva were the last measured parameters in all studied groups. The level of P. gingivalis DNA was significantly elevated in saliva from RA patients; the S. copri level did not differ between the studied groups though. S. copri is a gut microbiota bacterium that is also commonly found in the salivary glands of RA patients [21]. The lack of differences between analyzed groups in our study is probably due to their small size. Our results on P. gingivalis were in line with those reported previously in the literature, confirming the association of P. gingivalis with the pathogenesis of RA [23]. Cytokines, produced in both RA and PD, play an important role in their pathogenesis. Some cytokines like IL-1β, IL-17A, IFN-γ, and IL-10 are elevated in gingival crevicular fluid from PD patients [51]. Surprisingly, we did not find any correlations between these cytokines and P. gingivalis level. An explanation of these observations can be that the studied group was small, but there was also the limitation of the material used. Especially interesting in the case of PD and RA connection is IL-17A, whose overproduction is mentioned as linked with chronic inflammation and autoimmune disease development. It is also responsible for the stimulation of releasing other cytokines connected with RA and PD, such as IL-6, IL-8, IL-1β, and IL-10 [52]. In this study, we also observed the correlations between the mentioned cytokines (except IL-1β) and IL-17A, which confirms the regulatory function of this cytokine.

Limitations of the Study

The authors are aware of the limitations of this study. The first limitation is due to the small number of patients in all analyzed groups. Although RA is known to be the most common rheumatic disease, its prevalence is still around 1% in the general population, which makes patient recruitment much more difficult, especially considering that only patients before treatment were recruited. Moreover, the levels of some cytokines are at the limit of quantification and even below. This is due to a still-new concept of the determination of cytokine levels in saliva by flow cytometry, and a lower concentration of some cytokines in comparison to serum. Moreover, in the case of RA patients, the lower activity of the salivary glands can be observed. The manifestation of this can be seen in lower flow rate, reduced pH of saliva, and high incidence of oral dryness [53,54]. Rinderknecht C. et al. discovered that a high flow of saliva can reduce the amount of cytokines, but the direct impact of salivary gland activity on the immune composition of saliva is not well known [55]. Additionally, in our study group, patients with Sjogren syndrome were not included. Despite these limitations, we proved that saliva can be a worthwhile diagnostic material and, even though the analyzed populations of patients are small, there are still some differences between rheumatoid arthritis and other rheumatic diseases worth noticing. On the other hand, it is also important to remember that the usage of saliva as a diagnostic material instead of blood can generate some logistical and cost implications. The collection of saliva is non-invasive (special test tubes are used instead of needles) and does not require qualified personnel, which is needed in the case of blood collection. These things can lower the cost of material collection. Saliva is less stable than blood, though, and requires specific storage and transport procedures, which can also generate additional costs. Depending on the length of time the sample has to withstand until analysis, the cost of saliva usage can be higher or lower than blood. Nonetheless, the use of saliva can be the most practical for those patients who need to be under medical control and have a regular examination, but blood collection is limited due to some aspects, like anemia.

4. Materials and Methods

4.1. Clinical Sample Analysis

The saliva samples from 15 patients with diagnosed RA, 19 patients with other rheumatic diseases (see Table 1 for details), and 20 healthy age- and sex-matched controls (HC) were collected using Salivette® tubes (51.1534, Sarstedt, Nümbrecht, Germany). The saliva was obtained from all recruited patients before starting any treatment. All tubes were centrifuged at 2250 rpm for 3 min; after that, samples were stored at −80 °C until further use. Patients participating in the study were enrolled at the Regional Hospital for Rheumatic Diseases in Sopot, Poland. Both patients and controls were subjected to a series of laboratory tests, including RA serological markers like RF and anti-CCP, as well as ESR and assessment of concentrations of CRP, as well as blood count, alanine aminotransferase (ALT), aspartate aminotransferase (AST), mean cell haemoglobin (MCH), and others. A clinical assessment of the patient’s condition was also conducted, which included disease activity score (DAS28), swollen joint count (SJC), tender joint count (TJC), American College of Rheumatology (ACR) tender score, ACR swollen score, and Health Assessment Questionnaire (HAQ). Laboratory and clinical data not included in Table 1 are attached in Appendix A and Appendix B.
This study was approved by the Local Independent Committee for Ethics in Scientific Research at the Medical University of Gdansk, and written consent was obtained from all patients and healthy volunteers (NKBBN/389/2012).

4.2. Cytokine Quantification by Flow Cytometer

Cytokine level determination in saliva was conducted using two LEGENDplexTM sets: LEGENDplexTM HU Essential Immune Response Panel w/VbP (740930, BioLegend, San Diego, CA, USA) and LEGENDplexTM Human Anti-Virus Response Panel w/VbP (740390, BioLegend, San Diego, CA, USA) according to the manufacturer’s protocol. These sets allow for the semiquantitative estimation of the concentrations of IL-1β, IP-10, IL-29, GM-CSF, IFN-α2, IFN-β, TGF-β1, MPC-1, TNF-α, IFN-γ, IL-6, IL-10, IL-17A, IL-12p70, IL-2, and IL-4.
Briefly, the detection beads were sonicated to remove aggregates and the Standard Cocktail was diluted to yield initial concentrations of measured cytokines and then serially diluted in the assay buffer to allow for the creation of the standard curve. Saliva and standard samples (25 µL) were separately mixed with 25 µL of the assay buffer and 25 µL of vortexed pre-mix of detection beads in a 96-well plate and agitated at 800 rpm/min for 2 h at room temperature. After incubation, the beads were centrifuged and washed once with the wash buffer and incubated for 1 h at RT with the Detection Antibodies. Next, 25 µL of streptavidin-phycoerythrin (SA-PE) was added to each well and incubated for half an hour prior to final washing and dilution of beads in 150 µL of wash buffer. The samples were then transferred to cytometric tubes and analyzed using the flow cytometer (BD FACSAriaTM III Cell Sorter, Becton, Dickinson and Company, Franklin Lakes, NJ, USA).

4.3. Cytometric Raw Data Analysis

Concentration of cytokines in each saliva sample and the standard were measured in duplicates; therefore, the mean value of obtained results was used in further statistical analysis. The raw cytometric data were analyzed using FlowJo 10.8.0 (Becton, Dickinson and Company, Franklin Lakes, NJ, USA). The mean fluorescence intensity (MFI) of phycoerythrin (PE) emitted by the Detection Antibody was used to measure the concentration of each analyte.
The cytokine concentrations were calculated with GraphPad Prism version 8.0.1 (GraphPad Software, San Diego, CA, USA). Concentrations were estimated using x = log(x) transformation and non-linear regression matching by the method of least squares and expressed as pg/mL.

4.4. Viral DNA Extraction

Viral DNA extraction was performed using a Viral DNA/RNA kit (034-100, A&A Biotechnology, Gdansk, Poland) according to the manufacturer’s protocol. Briefly, 100 µL of saliva, 400 µL R9F buffer, and 4 µL of universal internal control (UNIC/GP/050, GeneProof, Brno, Czech Republic) were mixed. After that, the mixture was vortexed and incubated for 10 min at room temperature. Next, 250 µL of isopropanol was added and mixed by inverting the sample several times. The entire volume was then applied to mini-columns from the kit and was centrifuged at 13,400 rpm for 1 min. The mini-columns were placed in new tubes and washed with 700 µL of A1 flush buffer. After centrifugation, the filtrate from the tubes was removed and 300 µL of A1 flush buffer was added and washed again. In the next step, the mini-columns were placed in sterile tubes and washed with 40 µL of nuclease-free water to elute DNA. Tubes were incubated at room temperature for 3 min and centrifuged at 13,400 rpm for 1 min. The DNA concentration was measured using a spectrophotometer (EpochTM, BioTek® Instruments, Winooski, VT, USA). After that, the probes were stored at −20 °C until further determination. The same procedure was carried out with nuclease-free water, which was later used in qRT-PCR as a negative control.

4.5. Bacterial DNA Extraction

Bacterial DNA extraction was performed using a Genomic Mini AX Bacteria+ kit (060-60M, A&A Biotechnology), according to the manufacturer’s protocol. Briefly, 1 mL of saliva was suspended in 1 mL 2xBS (bacterial suspension) buffer and precisely mixed. To the mixture, 4 µL of lysozyme (50 mg/mL) and 10 µL of mutanolysine were added, mixed, and incubated at 50 °C for 40 min. After that, 2 mL of L1.4 lysing solution and 40 µL of proteinase K were added and incubated at 50 °C for 20 min. During the incubation, the solution was mixed by inverting tubes multiple times. In the meantime, to prepare columns, 800 µL of K1 balancing solution was applied. After the incubation was ended, the tubes were intensively vortexed for 15 s and centrifuged at 13,400 rpm for 5 min. The supernatant was then transferred to balanced columns for gravitational elution. After that, 1.5 mL of K2 rinse solution was added to the column and, again, gravitational elution followed. This step was repeated two times and, finally, 100 µL of K3 elution solution was added. Columns were transferred to precipitation tubes and 1 mL of K3 elution solution was added. In the next step, to precipitate the proteins, 800 µL of PM (precipitation mixture) was added, mixed, and centrifuged at 10,000 rpm for 10 min. The supernatant was carefully removed, and the pellet was resuspended in 500 µL of ethanol (70%), mixed, and centrifuged at 10,000 rpm for 3 min. Again, the supernatant was removed and the pellet was dried for 5 min at room temperature. After that, the pellet was resuspended in nuclease-free water (40 µL). The DNA concentration was measured spectrophotometrically directly after the extraction, and the material was stored at −20 °C until further use.

4.6. Real-Time Quantitative Polymerase Chain Reaction—Viral Assay

The detection and quantification of viral DNA in saliva was carried out with GeneProof diagnostic tests (GeneProof a.s., Brno-jih, Czech Republic), matched to the sought virus (GeneProof Parvovirus B19 PCR Kit (B19/ISEX/100), GeneProof Epstein–Barr Virus (EBV) PCR Kit (EBV/GP/100), and GeneProof Cytomegalovirus (CMV) PCR Kit (CMV/ISEX/100)). All used kits contained positive controls; moreover, internal controls were added to all samples. Briefly, 5 µL of a DNA sample containing internal control was mixed with 15 µL MasterMix and added directly into the wells of a 96-well PCR plate and used in qRT-PCR. Thermal cycling was performed according to the protocol in a PikoReal 96 Real-Time PCR System (Thermo Scientific, Waltham, MA, USA) with 1 cycle of PCR activation at 95 °C for 10 min, followed by 45 amplification cycles, each consisting of a denaturation step (95 °C, 5 s), annealing (60 °C, 40 s), and elongation (72 °C, 20 s). The fluorescence intensity was measured at FAM and HEX channels.

4.7. Real-Time Quantitative Polymerase Chain Reaction—Bacterial Assay

The qRT-PCR detection and quantification of P. gingivalis and S. copri in isolated DNA was performed with DyNAmo™ ColorFlash SYBR® Green qPCR kit (F416L, Thermo Scientific, Waltham, MA, USA). Isolated DNA (at a final concentration of 10 ng/µL) was added to the mixture containing 10 µL of MasterMix (Thermo Scientific, Waltham, MA, USA) and 1 µL of primers specifically for bacteria (Table 2; Genomed S.A., Warsaw, Poland), 0.1 µL ROX reference dye, and nuclease-free water. The final reaction volume was 20 µL. The qRT-PCR was performed in 96-well PCR plates in a PikoReal 96 Real-Time PCR System. The thermal cycling included the following steps, obtained experimentally: activation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C (S. copri) or 51 °C (P. gingivalis) for 30 s, and elongation on 72 °C for 30 s. Each sample was also prepared with starters for 16S rRNA considered as the internal control for bacterial DNA. The negative control was a sample where DNA was replaced by nuclease-free water, while the positive controls were S. copri DNA (DSM 18205, Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany) in a concentration of 1 × 102 copies/µL and P. gingivalis (DSM 20709, Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany) in a concentration of 1 × 107 copies/µL.

4.8. qRT-PCR Raw Data Analysis

The change fold obtained for each group for all sought bacteria and viruses was calculated with the 2(-delta delta C(T)) method (2−ΔΔCT).
The significance of differences in positive sample proportion among groups was evaluated using the Chi-square test in GraphPad 8.0.1 statistical software (GraphPad Software, San Diego, CA, USA), version 8.0.1.

4.9. Statistical Analysis

Shapiro–Wilk test was used to evaluate the normality of flow cytometric data distribution. Because the data were not normally distributed, non-parametric tests were applied for further analysis.
Mann–Whitney U test for two groups comparison (e.g., HC vs. RA) and Kruskal–Wallis test for three-group comparison (HC vs. RA vs. ORD) were used. The results with p < 0.05 were considered statistically significant.
Parametric Tukey’s multiple comparison test was used to interpret normalized data of 2−ΔΔCT analysis of qRT-PCR results.
The potential correlations between patients’ clinical features and cytokine levels, as well as qRT-PCR results, were assessed using the Spearman correlation test. The results are presented in the heatmap, retrieved from Python version 3.11, including libraries like pandas, matplotlib, seaborn, and scipy stats.

5. Conclusions

Due to the complexity of RA pathogenesis, some mechanisms of its outset are still not known or ambiguous. Although viruses’ and bacteria’s role in RA development is almost certain, a better understanding of their role in RA pathogenesis is still needed, especially in the context of diagnosis and possible strategies of treatment. The vast majority of RA diagnoses are based on clinical features and two basic biomarkers: ACPA and RF. In this study, we determine that cytokines, viruses, and bacteria seem to play an important role in RA pathogenesis. Moreover, the levels of all measured factors can be detected in saliva, which, in the future, can limit the usage of blood for diagnosis. Our findings are another step toward a better understanding of the pathogenesis of RA, although many of the mechanisms and links in the process remain unknown.

Author Contributions

Conceptualization, E.B. and J.W.; methodology, A.K. and A.D.; software, A.K.; formal analysis, A.K. and A.D.; investigation, A.K. and A.D.; resources, M.S. and M.B.; data curation, A.K.; writing—original draft preparation, A.K. and A.D.; writing—review and editing, E.B., J.W. and A.D.; visualization, A.K.; supervision, E.B.; project administration, E.B.; funding acquisition, E.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the program “Excellence Initiative—Research University” from the Medical University of Gdansk (71-01415).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Local Independent Committee for Ethics in Scientific Research at the Medical University of Gdansk (NKBBN/389/2012).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All raw data will be made available upon request.

Acknowledgments

We thank Izabella Bzoma and Edyta Brzustewicz for the collection of material used in this study.

Conflicts of Interest

The authors declare that they have no competing interests.

Appendix A

Table A1. General and immunological characteristics of patients (HC—healthy controls, RA—patients with rheumatoid arthritis, ORD—patients with other rheumatic diseases).
Table A1. General and immunological characteristics of patients (HC—healthy controls, RA—patients with rheumatoid arthritis, ORD—patients with other rheumatic diseases).
PatientsAgeSexDisease Activity Score (DAS) 28 The Health Assessment Questionnaire (HAQ)American College of Rheumatology (ACR) Joint PainACR Joint SwellingTotal Score of Joint PainTotal Score of Joint SwellingNumber of Painful Joints DAS28 Number of Swelling Joints DAS28 Rheumatoid Factor (RF)Anti-Cyclic Citrullinated Peptide (Anti-CCP) [U/mL]Neutrocytes [%]Lymphocytes [%]Monocytes [%]Eosinophils [%]Basophils [%]
ORD142female1.81-001100<10-45.642.39.32.50.3
ORD241female3.860.375224422<10<756.733.86.22.40.9
ORD322female4.560.5005050180<10<762.526.010.11.30.1
ORD432female3.600.6253344--<10<762.929.55.81.70.1
ORD534female0.640.25010210017<749.340.96.23.30.3
ORD638female2.100.250324331<10<751.438.08.51.90.2
ORD724female1.680.250223321<10<745.247.75.61.30.2
ORD846female2.91-304150<10<753.133.110.52.90.4
ORD943female1.360001102<10<758.327.710.23.60.2
ORD1023female4.171.000559926096<738.951.77.22.00.2
ORD1120female3.380.750306310023<761.529.57.51.10.4
ORD1246female2.040----00<10-54.436.36.62.10.6
ORD1352female3.530.875----21<10<746.641.18.53.50.3
ORD1453female00223300<10<768.324.55.81.30.1
ORD1556female--0011--<10<741.946.38.72.70.4
ORD1643female1.950223310<10------
ORD1756female4.901.1253041115<10<757.930.86.54.50.3
ORD1844female2.020.625223303<10<752.435.47.33.41.5
ORD1936male0.900223302<10<746.438.712.02.40.5
RA144female4.650.62533778421268.869.723.85.70.60.2
RA261female4.131.3751032--1124.7965.722.47.93.80.2
RA355female5.260.3752266141106481.450.136.810.12.80.2
RA433female6.260.37555101012713>50071.020.96.11.60.4
RA539female2.670303040<10<754.430.786.70.2
RA618female5.011.375256910105717.3145.443.08.23.10.3
RA742female4.080.3753344101<10<759.829.18.42.50.2
RA847female4.950.875232346<10<766.722.08.62.50.2
RA951female4.070.750324473<10<767.420.28.83.10.5
RA1050female4.351.6252255311272.1871.421.84.91.60.3
RA1155female5.180.750556688<10<756.531.27.24.30.8
RA1242female5.932.00055101012828455.063.623.58.54.10.3
RA1355male4.9802244--<10<767.921.66.73.40.4
RA1423female4.670.62533881107917.8571.217.29.32.10.2
RA1551male3.600.875337740143>50062.027.09.11.60.3
HC141male--------<10<752.335.78.62.60.8
HC231female--------<10<743.943.19.23.10.7
HC332female--------<10<746.743.37.02.70.3
HC443female--------<10<736.647.811.63.50.5
HC542female--------<10<748.440.48.62.50.1
HC647female--------<10<759.329.55.85.20.2
HC755female--------11<756.535.66.41.20.3
HC846female--------<10<755.532.28.43.70.2
HC934female--------<10<760.430.56.32.10.7
HC1057male--------<10<751.434.311.92.00.4
HC1148female--------304<760.828.18.62.40.1
HC1228female--------<10<757.229.610.52.00.7
HC1343female--------<10<755.335.87.21.60.1
HC1442female--------<10<744.544.39.80.90.5
HC1544male--------<10<765.925.57.31.20.1
HC1635female--------<10<757.630.011.40.80.2
HC1739female--------<10<757.230.18.83.40.5
HC1826female--------<10<741.844.89.73.00.7
HC1934female--------<10<738.347.611.02.90.2
HC2026female--------<10<754.931.311.02.70.1

Appendix B

Table A2. Patients’ biochemical features (HC, RA, and ORD).
Table A2. Patients’ biochemical features (HC, RA, and ORD).
PatientsHemoglobin [g/dL]Hematocrit [%]Mean Corpuscular Volume (MCV) [fL]Mean Corpuscular Hemoglobin (MCH) [pg/cell]Mean Corpuscular Hemoglobin Concentration (MCHC) [g/dL]Red Cell Distribution Width (RDW) [%]Platelet Count Test (PLT) × 109/LMean Platelet Volume (MPV) [fL]Erythrocyte Sedimentation Rate (ESR) [mm/hr]Glucose [mg/dL]Creatinine [mg/dL]Glomerular Filtration Rate (GFR) [mL/min/1.73m2]Uric Acid [mg/dL]Albumin [g/dL]C-Reactive Protein (CRP) [mg/dL]Alanine Aminotransferase (ALAT) [U/L]
ORD111.937.181.226.032.114.126610.06920.85>604.346.5011
ORD214.041.986.028.733.413.14789.823970.65>604.749.05.919
ORD313.440.791.930.232.913.726110.526880.82>606.141.30.410
ORD414.242.284.728.533.612.926611.2181090.58>605.346.31.322
ORD512.336.387.529.633.912.622612.12910.82>603.644.00.312
ORD614.141.087.830.234.412.420911.72910.65>603.846.00.315
ORD714.542.082.728.534.512.120011.62910.80>605.150.6012
ORD812.235.587.730.134.413.133410.44850.67>603.747.4011
ORD913.038.894.631.733.513.53189.64850.87>604.047.30.510
ORD1014.441.988.430.434.412.423811.73790.86>605.351.7016
ORD1114.141.488.530.134.112.926211.121070.80>603.750.0016
ORD1212.538.580.526.232.515.431411.8171000.85>603.848.71.316
ORD1315.545.195.632.834.413.328410.915990.71>603.651.6015
ORD1413.94289.929.833.113.233410.026930.71>603.246.80.811
ORD1514.241.986.429.333.912.722910.59930.84>604.545.50.514
ORD1713.939.689.631.435.112.120211.98860.76>604.949.12.828
ORD1812.237.382.927.132.715.429011.57880.88>60--013
ORD1916.847.688.531.235.312.925410.12820.80>605.548.20.729
RA112.938.689.629.933.413.537210.48830.64>603.146.11.331
RA213.640.487.129.333.713.127110.925980.97595.344.51.819
RA312.93782.628.834.913.521412.418880.75>604.348.61.514
RA412.436.486.729.534.113.424510.43210.68>603.349.30.718
RA512.836.785.229.734.917.627510.75950.79>603.546.9018
RA613.640.585.628.833.613.232711.918910.62>60-40.40.711
RA712.638.786.428.132.612.922411.85870.65>603.644.40.512
RA812.737.983.127.933.513.030310.327960.61>602.245.04.514
RA914.14290.330.333.613.831811.61310.71>605.245.91.326
RA1013.438.489.531.234.913.017410.110910.81>604.646.31.432
RA1112.940.78727.631.712.922510.5191120.60>606.145.23.028
RA1213.640.881.427.133.314.734610.623930.82>604.541.27.911
RA1312.438.877.824.832.023.233010.232960.89>603.741.315.523
RA1410.934.579.725.231.614.150110.244880.61>603.941.717.68
RA1514.643.491.930.933.613.125910.2141390.82>604.242.61.012
HC115.145.779.526.333.013.928410.46850.91>605.747.0026
HC213.841.191.730.833.613.62969.75890.83>605.00.83011
HC312.837.289.230.734.412.22969.721840.84>603.642.913.715
HC411.53482.327.833.814.330910.219880.71>603.446.0015
HC514.241.187.430.234.512.526010.98890.96>603.242.76.210
HC612.737.991.330.633.513.229610.415950.82>603.143.61.712
HC712.937.890.93134.112.428011.240870.76>604.642.42.116
HC810.732.774.324.332.716.43609.755840.73>603.90.73.316
HC912.437.676.725.333.015.734410.9411010.88>606.845.12.221
HC1015.945.686.730.234.913.915111.491071.20>606.444.30.920
HC1114.442.190.732.234.712.321411.44820.75>604.043.80.716
HC1214.340.482.129.135.413.617012.610961.02>604.946.407
HC13154383.529.134.911.834210.69870.79>603.446.32.720
HC1413.138.79331.533.913.733811.59890.65>603.444.0014
HC1513.439.18529.134.313.523512.533880.75>605.00.84.217
HC1612.537.79230.533.214.028510.48830.75>603.344.508
HC171441.678.926.633.713.32759.522840.77>605.742.110.114
HC1813.138.286.829.834.312.922911.810830.79>603.948.0011
HC191338.284.528.834.013.325912.14760.77>603.841.23.317
HC2013.439.192.931.834.312.524412.32870.67>605.547.0017

References

  1. Gilbert, B.T.P.; Lamacchia, C. Predicting the Onset of Rheumatoid Arthritis. Jt. Bone Spine 2023, 90, 105556. [Google Scholar] [CrossRef]
  2. Liao, K.P.; Alfredsson, L.; Karlson, E.W. Environmental Influences on Risk for Rheumatoid Arthritis. Curr. Opin. Rheumatol. 2009, 21, 279–283. [Google Scholar] [CrossRef] [PubMed]
  3. Salliot, C.; Nguyen, Y.; Boutron-Ruault, M.-C.; Seror, R. Environment and Lifestyle: Their Influence on the Risk of RA. J. Clin. Med. 2020, 9, 3109. [Google Scholar] [CrossRef] [PubMed]
  4. Bo, M.; Jasemi, S.; Uras, G.; Erre, G.L.; Passiu, G.; Sechi, L.A. Role of Infections in the Pathogenesis of Rheumatoid Arthritis: Focus on Mycobacteria. Microorganisms 2020, 8, 1459. [Google Scholar] [CrossRef]
  5. Soroczyńska-Cybula, M.; Bryl, E.; Smoleńska, Ż.; Witkowski, J.M. Varying Expression of Four Genes Sharing a Common Regulatory Sequence May Differentiate Rheumatoid Arthritis from Ageing Effects on the CD4+ Lymphocytes: Genes Sharing a Regulatory Motif in Helper Cells. Immunology 2011, 132, 78–86. [Google Scholar] [CrossRef] [PubMed]
  6. Witkowski, J.M.; Soroczyńska-Cybula, M.; Bryl, E.; Smoleńska, Ż.; Jóźwik, A. Klotho—A Common Link in Physiological and Rheumatoid Arthritis-Related Aging of Human CD4+ Lymphocytes. J. Immunol. 2007, 178, 771–777. [Google Scholar] [CrossRef]
  7. Tong, Y.; Zheng, L.; Qing, P.; Zhao, H.; Li, Y.; Su, L.; Zhang, Q.; Zhao, Y.; Luo, Y.; Liu, Y. Oral Microbiota Perturbations Are Linked to High Risk for Rheumatoid Arthritis. Front. Cell. Infect. Microbiol. 2020, 9, 475. [Google Scholar] [CrossRef]
  8. Afrasiabi, S.; Chiniforush, N.; Partoazar, A.; Goudarzi, R. The Role of Bacterial Infections in Rheumatoid Arthritis Development and Novel Therapeutic Interventions: Focus on Oral Infections. J. Clin. Lab. Anal. 2023, 37, e24897. [Google Scholar] [CrossRef]
  9. Ridgley, L.A.; Anderson, A.E.; Pratt, A.G. What Are the Dominant Cytokines in Early Rheumatoid Arthritis? Curr. Opin. Rheumatol. 2018, 30, 207–214. [Google Scholar] [CrossRef]
  10. Kondo, N.; Kuroda, T.; Kobayashi, D. Cytokine Networks in the Pathogenesis of Rheumatoid Arthritis. Int. J. Mol. Sci. 2021, 22, 10922. [Google Scholar] [CrossRef]
  11. Available online: https://go.drugbank.com/ (accessed on 1 July 2024).
  12. Arend, W.P. Physiology of Cytokine Pathways in Rheumatoid Arthritis. Arthritis Care Res. Off. J. Am. Coll. Rheumatol. 2001, 45, 101–106. [Google Scholar] [CrossRef]
  13. Johnson, D.; Jiang, W. Infectious Diseases, Autoantibodies, and Autoimmunity. J. Autoimmun. 2023, 137, 102962. [Google Scholar] [CrossRef]
  14. Kudaeva, F.M.; Speechley, M.R.; Pope, J.E. A Systematic Review of Viral Exposures as a Risk for Rheumatoid Arthritis. Semin. Arthritis Rheum. 2019, 48, 587–596. [Google Scholar] [CrossRef]
  15. Rojas, M.; Restrepo-Jiménez, P.; Monsalve, D.M.; Pacheco, Y.; Acosta-Ampudia, Y.; Ramírez-Santana, C.; Leung, P.S.C.; Ansari, A.A.; Gershwin, M.E.; Anaya, J.-M. Molecular Mimicry and Autoimmunity. J. Autoimmun. 2018, 95, 100–123. [Google Scholar] [CrossRef] [PubMed]
  16. Kozak, M.; Pawlik, A. The Role of the Oral Microbiome in the Development of Diseases. Int. J. Mol. Sci. 2023, 24, 5231. [Google Scholar] [CrossRef] [PubMed]
  17. Murugaiyan, V.; Utreja, S.; Hovey, K.M.; Sun, Y.; LaMonte, M.J.; Wactawski-Wende, J.; Diaz, P.I.; Buck, M.J. Defining Porphyromonas Gingivalis Strains Associated with Periodontal Disease. Sci. Rep. 2024, 14, 6222. [Google Scholar] [CrossRef]
  18. Ahmadi, P.; Mahmoudi, M.; Kheder, R.K.; Faraj, T.A.; Mollazadeh, S.; Abdulabbas, H.S.; Esmaeili, S.-A. Impacts of Porphyromonas Gingivalis Periodontitis on Rheumatoid Arthritis Autoimmunity. Int. Immunopharmacol. 2023, 118, 109936. [Google Scholar] [CrossRef] [PubMed]
  19. Tar, I.; Csősz, É.; Végh, E.; Lundberg, K.; Kharlamova, N.; Soós, B.; Szekanecz, Z.; Márton, I. Salivary Citrullinated Proteins in Rheumatoid Arthritis and Associated Periodontal Disease. Sci. Rep. 2021, 11, 13525. [Google Scholar] [CrossRef] [PubMed]
  20. Kim, D.; Kim, W. Editorial: Can Prevotella copri Be a Causative Pathobiont in Rheumatoid Arthritis? Arthritis Rheumatol. 2016, 68, 2565–2567. [Google Scholar] [CrossRef]
  21. Amend, L.; Gilbert, B.T.P.; Pelczar, P.; Böttcher, M.; Huber, S.; Witte, T.; Finckh, A.; Strowig, T. Characterization of Serum Biomarkers and Antibody Responses against Prevotella spp. in Preclinical and New-Onset Phase of Rheumatic Diseases. Front. Cell. Infect. Microbiol. 2023, 12, 1096211. [Google Scholar] [CrossRef]
  22. Miljanovic, D.; Cirkovic, A.; Jermic, I.; Basaric, M.; Lazarevic, I.; Grk, M.; Miskovic, R.; Despotovic, A.; Banko, A. Markers of Epstein–Barr Virus Infection in Association with the Onset and Poor Control of Rheumatoid Arthritis: A Prospective Cohort Study. Microorganisms 2023, 11, 1958. [Google Scholar] [CrossRef]
  23. Arvikar, S.L.; Collier, D.S.; Fisher, M.C.; Unizony, S.; Cohen, G.L.; McHugh, G.; Kawai, T.; Strle, K.; Steere, A.C. Clinical Correlations with Porphyromonas Gingivalis Antibody Responses in Patients with Early Rheumatoid Arthritis. Arthritis Res. Ther. 2013, 15, R109. [Google Scholar] [CrossRef] [PubMed]
  24. Brzustewicz, E.; Bzoma, I.; Daca, A.; Szarecka, M.; Bykowska, M.S.; Witkowski, J.M.; Bryl, E. Heterogeneity of the Cytokinome in Undifferentiated Arthritis Progressing to Rheumatoid Arthritis and Its Change in the Course of Therapy. Move toward Personalized Medicine. Cytokine 2017, 97, 1–13. [Google Scholar] [CrossRef]
  25. Ruscitti, P.; Cipriani, P.; Cantarini, L.; Liakouli, V.; Vitale, A.; Carubbi, F.; Berardicurti, O.; Galeazzi, M.; Valenti, M.; Giacomelli, R. Efficacy of Inhibition of IL-1 in Patients with Rheumatoid Arthritis and Type 2 Diabetes Mellitus: Two Case Reports and Review of the Literature. J. Med. Case Rep. 2015, 9, 123. [Google Scholar] [CrossRef] [PubMed]
  26. Cutolo, M. Effects of DMARDs on IL-Ra Levels in Rheumatoid Arthritis: Is There Any Evidence ? Clin. Exp. Rheumatol. 2002, 20, S26–S31. [Google Scholar]
  27. Kay, J. The Role of Interleukin-1 in the Pathogenesis of Rheumatoid Arthritis. Rheumatology 2004, 43, iii2–iii9. [Google Scholar] [CrossRef] [PubMed]
  28. Brennan, F.M.; McInnes, I.B. Evidence That Cytokines Play a Role in Rheumatoid Arthritis. J. Clin. Investig. 2008, 118, 3537–3545. [Google Scholar] [CrossRef] [PubMed]
  29. Burger, D.; Dayer, J.-M.; Palmer, G.; Gabay, C. Is IL-1 a Good Therapeutic Target in the Treatment of Arthritis? Best Pract. Res. Clin. Rheumatol. 2006, 20, 879–896. [Google Scholar] [CrossRef] [PubMed]
  30. Mercado, M.V.-D.; Garcia-Gonzalez, A.; Muñoz-Valle, J.F.; Garcia-Iglesias, T.; Martinez-Bonilla, G.; Bernard-Medina, G.; Sanchez-Ortiz, A.; Ornelas-Aguirre, J.M.; Salazar-Paramo, M.; Gamez-Nava, J.I.; et al. Interleukin 1β (IL-1β), IL-10, Tumor Necrosis Factor-α, and Cellular Proliferation Index in Peripheral Blood Mononuclear Cells in Patients with Ankylosing Spondylitis. J. Rheumatol. 2002, 29, 522–526. [Google Scholar]
  31. Daheshia, M.; Yao, J.Q. The Interleukin 1β Pathway in the Pathogenesis of Osteoarthritis. J. Rheumatol. 2008, 35, 2306–2312. [Google Scholar] [CrossRef]
  32. Lee, J.-H.; Kim, B.; Jin, W.J.; Kim, H.-H.; Ha, H.; Lee, Z.H. Pathogenic Roles of CXCL10 Signaling through CXCR3 and TLR4 in Macrophages and T Cells: Relevance for Arthritis. Arthritis Res. Ther. 2017, 19, 163. [Google Scholar] [CrossRef] [PubMed]
  33. Politti, U. Rheumatoid Arthritis and the Alpha-Chemokine IP-10. Clin. Ter. 2014, 165, e447–e451. [Google Scholar] [CrossRef]
  34. Lan, R.Y.; Selmi, C.; Gershwin, M.E. The Regulatory, Inflammatory, and T Cell Programming Roles of Interleukin-2 (IL-2). J. Autoimmun. 2008, 31, 7–12. [Google Scholar] [CrossRef]
  35. Li, B.; Guo, Q.; Wang, Y.; Su, R.; Gao, C.; Zhao, J.; Li, X.; Wang, C. Increased Serum Interleukin-2 Levels Are Associated with Abnormal Peripheral Blood Natural Killer Cell Levels in Patients with Active Rheumatoid Arthritis. Mediat. Inflamm. 2020, 2020, 1–15. [Google Scholar] [CrossRef] [PubMed]
  36. Kogure, T.; Niizawa, A.; Hai, L.X.; Fujinaga, H.; Shimada, Y.; Ochiai, H.; Terasawa, K. Effect of Interleukin 2 on Killer Cell Inhibitory Receptors in Patients with Rheumatoid Arthritis. Ann. Rheum. Dis. 2001, 60, 166–169. [Google Scholar] [CrossRef]
  37. Heeb, L.E.M.; Egholm, C.; Boyman, O. Evolution and Function of Interleukin-4 Receptor Signaling in Adaptive Immunity and Neutrophils. Genes Immun. 2020, 21, 143–149. [Google Scholar] [CrossRef]
  38. Luzina, I.G.; Keegan, A.D.; Heller, N.M.; Rook, G.A.W.; Shea-Donohue, T.; Atamas, S.P. Regulation of Inflammation by Interleukin-4: A Review of “Alternatives”. J. Leukoc. Biol. 2012, 92, 753–764. [Google Scholar] [CrossRef] [PubMed]
  39. Hussein, Y.M. Influence of Interleukin-4 Gene Polymorphisms and Interleukin-4 Serum Level on Susceptibility and Severity of Rheumatoid Arthritis in Egyptian Population. Cytokine 2013, 61, 849–855. [Google Scholar] [CrossRef] [PubMed]
  40. Yoshino, S. Effect of a Monoclonal Antibody against Interleukin-4 on Collagen-Induced Arthritis in Mice. Br. J. Pharmacol. 1998, 123, 237–242. [Google Scholar] [CrossRef] [PubMed]
  41. Rivas, D.; Mozo, L.; Zamorano, J.; Gayo, A.; Torre-Alonsot, J.C.; Rodrlguezt, A.; Guti, C. Upregulated Expression of IL-4 Receptors and Increased Levels of IL-4 in Rheumatoid Arthritis Patients. J. Autoimmun. 1995, 8, 587–600. [Google Scholar] [CrossRef]
  42. Petersen, L.E.; Baptista, T.S.A.; Molina, J.K.; Motta, J.G.; Do Prado, A.; Piovesan, D.M.; De Nardi, T.; Viola, T.W.; Vieira, É.L.M.; Teixeira, A.L.; et al. Cognitive Impairment in Rheumatoid Arthritis: Role of Lymphocyte Subsets, Cytokines and Neurotrophic Factors. Clin. Rheumatol. 2018, 37, 1171–1181. [Google Scholar] [CrossRef] [PubMed]
  43. Dong, C.; Fu, T.; Ji, J.; Li, Z.; Gu, Z. The Role of Interleukin-4 in Rheumatic Diseases. Clin. Exp. Pharmacol. Physiol. 2018, 45, 747–754. [Google Scholar] [CrossRef]
  44. Sebba, A.; Bingham, C.O.; Bykerk, V.P.; Fiore, S.; Ford, K.; Janak, J.C.; Pappas, D.A.; Blachley, T.; Dave, S.S.; Kremer, J.M.; et al. Comparative Effectiveness of TNF Inhibitor vs IL-6 Receptor Inhibitor as Monotherapy or Combination Therapy with Methotrexate in Biologic-Experienced Patients with Rheumatoid Arthritis: An Analysis from the CorEvitas RA Registry. Clin. Rheumatol. 2023, 42, 2037–2051. [Google Scholar] [CrossRef]
  45. Szabo, Y.Z.; Slavish, D.C. Measuring Salivary Markers of Inflammation in Health Research: A Review of Methodological Considerations and Best Practices. Psychoneuroendocrinology 2021, 124, 105069. [Google Scholar] [CrossRef] [PubMed]
  46. Banko, A.; Cirkovic, A.; Jeremic, I.; Basaric, M.; Grk, M.; Miskovic, R.; Lazarevic, I.; Miljanovic, D. Uncovering the Role of Epstein–Barr Virus Infection Markers for Remission in Rheumatoid Arthritis. Biomedicines 2023, 11, 2375. [Google Scholar] [CrossRef] [PubMed]
  47. Fafi-Kremer, S.; Morand, P.; Brion, J.; Pavese, P.; Baccard, M.; Germi, R.; Genoulaz, O.; Nicod, S.; Jolivet, M.; Ruigrok, R.W.H.; et al. Long-Term Shedding of Infectious Epstein-Barr Virus after Infectious Mononucleosis. J. Infect. Dis. 2005, 191, 985–989. [Google Scholar] [CrossRef]
  48. Fechtner, S.; Berens, H.; Bemis, E.; Johnson, R.L.; Guthridge, C.J.; Carlson, N.E.; Demoruelle, M.K.; Harley, J.B.; Edison, J.D.; Norris, J.A.; et al. Antibody Responses to Epstein-Barr Virus in the Preclinical Period of Rheumatoid Arthritis Suggest the Presence of Increased Viral Reactivation Cycles. Arthritis Rheumatol. 2022, 74, 597–603. [Google Scholar] [CrossRef]
  49. Balandraud, N.; Roudier, J. Epstein-Barr Virus and Rheumatoid Arthritis. Jt. Bone Spine 2018, 85, 165–170. [Google Scholar] [CrossRef] [PubMed]
  50. Velapasamy, S.; Dawson, C.; Young, L.; Paterson, I.; Yap, L. The Dynamic Roles of TGF-β Signalling in EBV-Associated Cancers. Cancers 2018, 10, 247. [Google Scholar] [CrossRef] [PubMed]
  51. Rahajoe, P.S.; Smit, M.J.; Kertia, N.; Westra, J.; Vissink, A. Cytokines in Gingivocrevicular Fluid of Rheumatoid Arthritis Patients: A Review of the Literature. Oral Dis. 2019, 25, 1423–1434. [Google Scholar] [CrossRef] [PubMed]
  52. Techatanawat, S.; Surarit, R.; Chairatvit, K.; Khovidhunkit, W.; Roytrakul, S.; Thanakun, S.; Kobayashi, H.; Khovidhunkit, S.P.; Izumi, Y. Salivary and Serum Interleukin-17A and Interleukin-18 Levels in Patients with Type 2 Diabetes Mellitus with and without Periodontitis. PLoS ONE 2020, 15, e0228921. [Google Scholar] [CrossRef]
  53. Mohammed Fadhil, H.N.; Ahmed, K.M. Evaluation of Salivary Flow Rate, pH and Anti-CCP Antibodies in Relation to Oral Manifestations in Patients with Rheumatoid Arthritis: A Matched Case-Control Study in Sulaimaniyah, Iraq. Saudi Dent. J. 2024, 36, 1606–1610. [Google Scholar] [CrossRef]
  54. Moen, K.; Bertelsen, L.; Hellem, S.; Jonsson, R.; Brun, J. Salivary Gland and Temporomandibular Joint Involvement in Rheumatoid Arthritis: Relation to Disease Activity. Oral Dis. 2005, 11, 27–34. [Google Scholar] [CrossRef]
  55. Rinderknecht, C.; Filippi, C.; Ritz, N.; Fritschi, N.; Simmen, U.; Filippi, A.; Diesch-Furlanetto, T. Associations between Salivary Cytokines and Oral Health, Age, and Sex in Healthy Children. Sci. Rep. 2022, 12, 15991. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The differences in anti-viral response cytokine levels between RA patients and patients with other rheumatic diseases (ORD), as well as between RA patients and healthy controls (HC). Graphs show the concentrations of following cytokines: (A) GM-CSF, (B) IFN-α2, (C) IFN-β, (D) IFN-γ, (E) IL-1β, (F) IL-8, (G) IL-10, (H) IL-12p70, (I) IL-29, and (J) IP-10. Median with 95% Cl; Mann–Whitney U test, * p < 0.05.
Figure 1. The differences in anti-viral response cytokine levels between RA patients and patients with other rheumatic diseases (ORD), as well as between RA patients and healthy controls (HC). Graphs show the concentrations of following cytokines: (A) GM-CSF, (B) IFN-α2, (C) IFN-β, (D) IFN-γ, (E) IL-1β, (F) IL-8, (G) IL-10, (H) IL-12p70, (I) IL-29, and (J) IP-10. Median with 95% Cl; Mann–Whitney U test, * p < 0.05.
Ijms 26 00197 g001
Figure 2. The differences in inflammation response cytokine levels between RA patients and patients with other rheumatic diseases (ORD), and the differences between RA patients and healthy controls (HC). Graphs show the concentrations of following cytokines: (A) IL-2, (B) IL-4, (C) IL-6, (D) IL-17A, (E) MPC-1, (F) TGF-β1, and (G) TNF-α. Median with 95% Cl; Mann–Whitney U test, * p < 0.05. The dotted line in graph (D) depicts the minimum value threshold equal to zero.
Figure 2. The differences in inflammation response cytokine levels between RA patients and patients with other rheumatic diseases (ORD), and the differences between RA patients and healthy controls (HC). Graphs show the concentrations of following cytokines: (A) IL-2, (B) IL-4, (C) IL-6, (D) IL-17A, (E) MPC-1, (F) TGF-β1, and (G) TNF-α. Median with 95% Cl; Mann–Whitney U test, * p < 0.05. The dotted line in graph (D) depicts the minimum value threshold equal to zero.
Ijms 26 00197 g002
Figure 3. The differences in fold change (2−ΔΔCT) of EBV between RA patients, patients with other rheumatic diseases (ORD), and healthy controls (HC). Fold change with 95% Cl; Tukey’s multiple comparison test, *** p < 0.0001.
Figure 3. The differences in fold change (2−ΔΔCT) of EBV between RA patients, patients with other rheumatic diseases (ORD), and healthy controls (HC). Fold change with 95% Cl; Tukey’s multiple comparison test, *** p < 0.0001.
Ijms 26 00197 g003
Figure 4. The differences in fold change (2−ΔΔCT) of selected bacteria between RA patients, patients with other rheumatic diseases (ORD), and healthy controls (HC). Fold change with 95% Cl; Tukey’s multiple comparison test, *** p < 0.0001. (A) Results for S. copri, (B) results for P. gingivalis.
Figure 4. The differences in fold change (2−ΔΔCT) of selected bacteria between RA patients, patients with other rheumatic diseases (ORD), and healthy controls (HC). Fold change with 95% Cl; Tukey’s multiple comparison test, *** p < 0.0001. (A) Results for S. copri, (B) results for P. gingivalis.
Ijms 26 00197 g004
Figure 5. Heatmap of correlation of measured cytokine levels with patients’ clinical features (* p < 0.5, ** p < 0.01, *** p < 0.005 by Spearman’s correlation test).
Figure 5. Heatmap of correlation of measured cytokine levels with patients’ clinical features (* p < 0.5, ** p < 0.01, *** p < 0.005 by Spearman’s correlation test).
Ijms 26 00197 g005
Figure 6. Heatmap of correlation of cytokine levels with delta Ct obtained from qRT-PCR (* p < 0.5, ** p < 0.01, *** p < 0.001 by Spearman‘s correlation test).
Figure 6. Heatmap of correlation of cytokine levels with delta Ct obtained from qRT-PCR (* p < 0.5, ** p < 0.01, *** p < 0.001 by Spearman‘s correlation test).
Ijms 26 00197 g006
Table 1. Basic characteristics of patients with RA, ORD, and HC.
Table 1. Basic characteristics of patients with RA, ORD, and HC.
PatientsSexAgeDiagnosisDAS-28RF
(UI/mL)
Anti-CCP
(U/mL)
ESR
(mm/h)
CRP
(mg/dL)
ORD 1female42other1.81<10 60
ORD 2female41psoriatic arthritis3.86<10<7235.9
ORD 3female22other4.56<10<7260.4
ORD 4female32psoriatic arthritis3.60<10<7181.3
ORD 5female34osteoarthritis0.6417<720.3
ORD 6female38other2.10<10<720.3
ORD 7female24other1.68<10<720
ORD 8female46other2.91<10<740
ORD 9female43osteoarthritis1.36<10<740.5
ORD 10female23ankylosing spondylitis4.1796<730
ORD 11female20ankylosing spondylitis3.3823<720
ORD 12female46osteoarthritis2.04<10-171.3
ORD 13female52osteoarthritis3.53<10<7150
ORD 14female53osteoarthritis0<10<7260.8
ORD 15female56other0<10<790.5
ORD 16female43other1.95<10---
ORD 17female56psoriatic arthritis4.90<10<782.8
ORD 18female44psoriatic arthritis2.02<10<770
ORD 19male36ankylosing spondylitis0.90<10<720.7
RA 1female44rheumatoid arthritis4.6521268.8081.3
RA 2female61rheumatoid arthritis4.131124.79251.8
RA 3female55rheumatoid arthritis5.26106481.40181.5
RA 4female33rheumatoid arthritis6.2613>500320.7
RA 5female39rheumatoid arthritis2.67<10<750
RA 6female18rheumatoid arthritis5.015717.31180.7
RA 7female42rheumatoid arthritis4.08<10<750.5
RA 8female47rheumatoid arthritis4.95<10<7274.5
RA 9female51rheumatoid arthritis4.07<10<7131.3
RA 10female50rheumatoid arthritis4.351272.18101.4
RA 11female55rheumatoid arthritis5.18<10<7193.0
RA 12female42rheumatoid arthritis5.9328455237.9
RA 13male55rheumatoid arthritis4.98<10<73215.5
RA 14female23rheumatoid arthritis4.677917.854417.6
RA 15male51rheumatoid arthritis3.60143>500141
HC 1male41healthy control-<10<760
HC 2female31healthy control-<10<750
HC 3female32healthy control-<10<72113.7
HC 4female43healthy control-<10<7190
HC 5female42healthy control-<10<786.2
HC 6female47healthy control-<10<7151.7
HC 7female55healthy control-11<7402.1
HC 8female46healthy control-<10<7553.3
HC 9female34healthy control-<10<7412.2
HC 10male57healthy control-<10<790.9
HC 11female48healthy control-304<740.7
HC 12female28healthy control-<10<7100
HC 13female43healthy control-<10<792.7
HC 14female42healthy control-<10<790
HC 15male44healthy control-<10<7334.2
HC 16female35healthy control-<10<780
HC 17female39healthy control-<10<72210.1
HC 18female26healthy control-<10<7100
HC 19female34healthy control-<10<743.3
HC 20female26healthy control-<10<720
Table 2. Primers used in qRT-PCR studies of bacterial DNA.
Table 2. Primers used in qRT-PCR studies of bacterial DNA.
Primer NameSequenceNumber of NucleotidesTarget Gene
Internal control, FTTCTTAAGTCTGATGTGAAAAGC2216S rRNA
Internal control, RTGGACTACCAGGGTATCTAATC22
S. copri genome-specific, FTTTTGCTGTAGGAGGGGTTG20Glycosyl transferase, group 1 PREVCOP_06806
S. copri genome-specific, RGGGCTGCATAAAGCAAAGAC20
P. gingivalis genome-specific, FTCCACACCCGAAGCAGTAAC20hmuY gene
P. gingivalis genome-specific, RTGCCACTTTCGCCACAATTG20
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Korzeniowska, A.; Daca, A.; Szarecka, M.; Bykowska, M.; Witkowski, J.; Bryl, E. Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients. Int. J. Mol. Sci. 2025, 26, 197. https://doi.org/10.3390/ijms26010197

AMA Style

Korzeniowska A, Daca A, Szarecka M, Bykowska M, Witkowski J, Bryl E. Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients. International Journal of Molecular Sciences. 2025; 26(1):197. https://doi.org/10.3390/ijms26010197

Chicago/Turabian Style

Korzeniowska, Aleksandra, Agnieszka Daca, Maria Szarecka, Małgorzata Bykowska, Jacek Witkowski, and Ewa Bryl. 2025. "Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients" International Journal of Molecular Sciences 26, no. 1: 197. https://doi.org/10.3390/ijms26010197

APA Style

Korzeniowska, A., Daca, A., Szarecka, M., Bykowska, M., Witkowski, J., & Bryl, E. (2025). Differences in Salivary Cytokinome and Pathogen Load Between Rheumatoid Arthritis and Other Rheumatic Disease Patients. International Journal of Molecular Sciences, 26(1), 197. https://doi.org/10.3390/ijms26010197

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop