Next Article in Journal
Antarctic Ecosystem Recovery Following Human-Induced Habitat Change: Recolonization of Adélie Penguins (Pygoscelis adeliae) at Cape Hallett, Ross Sea
Next Article in Special Issue
An Illusion of Barriers to Gene Flow in Suburban Coyotes (Canis latrans): Spatial and Temporal Population Structure across a Fragmented Landscape in Southern California
Previous Article in Journal
Diversity, Ecological Characteristics and Identification of Some Problematic Phytopathogenic Fusarium in Soil: A Review
Previous Article in Special Issue
Herbivore Influence on Post-Fire California Sage Scrub Plant and Soil Microbial Assemblages
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 15
Issue 1
10.3390/d15010050
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Mustard Invasions on Soil Microbial Abundances and Fungal Assemblages in Southern California

by
Zachary R. Wakefield
*,
André R. O. Cavalcanti
,
Lucía Driessen
,
Ana Jaramillo
,
Edward J. Crane III
,
Giuliano Richetta
and
Wallace M. Meyer III
*
Department of Biology, Pomona College, Claremont, CA 91711, USA
*
Authors to whom correspondence should be addressed.
Diversity 2023, 15(1), 50; https://doi.org/10.3390/d15010050
Submission received: 28 October 2022 / Revised: 21 December 2022 / Accepted: 23 December 2022 / Published: 1 January 2023
(This article belongs to the Special Issue Ecology and Conservation of the Endangered Sage Scrub Ecosystem)
Browse Figures
Review Reports Versions Notes

Abstract

:
Although mustards (family, Brassicaceae) are common across southern California, research has not focused on the effects of type-conversion of native California sage scrub (CSS) to areas dominated by invasive mustards. To better understand how mustard invasions, primarily the short-pod mustard, Hirschfeldia incana, impact soil microbial assemblages, we examined microbial abundance and assemblages from intact CSS and adjacent mustard-dominated soils at three sites. We also explored if germination rates for various plant species differed between CSS and mustard soils. We found that mustard invasions reduce soil microbial abundances by more than 50% and alter soil fungal assemblages. Fungal richness, diversity, and evenness did not differ between habitats, highlighting that these habitats harbor unique microbial assemblages. While mustard allelopathy is predicted to be the primary driver of these changes, mustard invasions also increased soil pH. Although functional consequences of these shifts are unknown, low mustard germination in CSS soils supports biological resistance to mustard invasion in CSS. Overall, our results demonstrate that mustard invasions, H. incana in particular, exert a strong selecting force on soil microbial assemblages, which can influence effective CSS restoration and preservation of ecosystem services.

1. Introduction

Invasive plants can alter the abundances of soil fungi and bacteria and impact the assemblage structure of soil microbiotas [1,2,3,4,5]. Changes in soil microbe abundances and assemblage structure can have cascading effects, influencing important ecosystem processes (e.g., microbial respiration rates and soil C storage) [2,3,6,7] and modifying plant assemblages by differentially influencing germination and growth of native and invasive plant species [5,8,9,10]. Consequently, plant invasions often elicit changes in soil seed banks, impacting seedling germination trends and further complicating restoration of native ecosystems and ecosystem services [11,12,13,14]. However, how invasive plants impact soil biotas depends on the identity of the invader [3]. Therefore, evaluating how various invasive plants impact soil microbial assemblages is of critical importance.
California sage scrub (CSS) is an endangered ecosystem type, typified by drought-deciduous shrubs, that was once widespread in low elevation areas of southern California [15]. CSS is part of the California Floristic Providence, a biodiversity hotspot that harbors many endemic plant and animal species [16,17,18]. Currently, intact CSS occupies less than 10% its original range, with much of what remains impacted by non-native plants [11,17,19]. Much of the original CSS habitat has been type-converted to non-native grasslands and mustard habitats. Although mustards (family, Brassicaceae) are common, most investigations have focused on the effects of type conversion of CSS to non-native grasslands [2,3,6,9,20,21,22,23]. However, Caspi et al. [3] highlight that non-native grasslands and mustard habitats may differ in their influence on soil biotas. Consequently, studies exploring the effects of mustard invasions in southern California are needed to better understand the impacts of these increasingly widespread and abundant species.
Type conversion from CSS to invasive mustard habitat likely has significant effects on soil microbial assemblages [3,4,10,24]. For example, several mustard species release allelochemicals, which can reduce fungal abundances [24,25,26]. The most common allelochemical is glucosinolate sinigrin, which is present in below- and above-ground mustard tissues [24,25,27,28]. Reductions in soil fungal, and potentially bacterial, abundances can reduce soil respiration rates and increase carbon and nitrogen storage in southern California soils [3]. In addition, sinigrin has been shown to inhibit the germination of arbuscular mycorrhizal fungi by >50%, eliminating a critical nutrient uptake pathway for plants that compete with mustard invaders [29,30]. While we have predictions about how invasive mustards may influence soil microbes in southern California based on research on different mustard species elsewhere, and at a few sites in the region, a better understanding of how mustard invasions impact soil microbes in southern California is needed to better predict their effects on CSS biotas and regional ecosystem services.
Changes in soil microbial assemblages can also influence plant community structure and native plant restoration efforts [9,10,31,32,33]. In Southern California, soil seed banks are typically dominated by invasive species [11,14]. Even in CSS near areas with high abundances of invasives, species germination can be affected. For example, Cox and Allen [11] found that non-native grass seeds were dominant in CSS soil near type-converted sites. However, patterns associated with non-native grass invasions may not explain mustard invasions. For example, Loesberg and Meyer [34] found that mustard (Brassica nigra) seeds are preferred by many common seed predators in intact CSS environments, while non-native grass seeds were avoided. In addition, germination of Brassica nigra seeds was significantly reduced by CSS soil microbiota, while grass seeds were not impacted [10]. Therefore, in contrast to invasions by non-native grasses, CSS may be better at biologically resisting invasion of mustards.
To better understand how mustard invasions are impacting soil microbial assemblages in Southern California, where mustard species, particularly the short-pod mustard, Hirschfeldia incana, are becoming widespread and abundant, we explored microbial abundance and assemblage structure in soil from intact CSS and in adjacent mustard-dominated areas at three sites. We also explored if germination rates for various plant species differed between CSS and mustard soils. We hypothesized that: (i) microbial abundances are lower in mustard habitats [4,24,26,35]; (ii) microbial (fungal) assemblages differ between habitat types with mustard areas having lower microbial richness and diversity [2,36,37,38,39]; and (iii) germination rates are higher for non-native seeds and lower for native seeds in mustard soils than in CSS soil [10,11,14]. In addition, we examined if the relative abundances of arbuscular mycorrhizal fungi (AMF), ectomycorrhizal fungi (EMF), and pathogenic fungi differ among habitat types as a preliminary examination of how mustard invasions impact functionally important fungal groups [10,29,30].

2. Materials and Methods

2.1. Study Site

This study was conducted at three sites in the western Pomona Valley and neighboring San Jose Hills in eastern Los Angeles County: the Robert J. Bernard Biological Field Station in Claremont, California (34°6′44″ N, 117°42′43″ W); the Frank J. Bonelli Park in San Dimas, California (34°4′45″ N, 117°48′30″ W); and the Voorhis Reserve in Pomona, California (34°3′26″ N, 117°49′55″ W). The site within Bonelli Park is 1.4 miles northeast of the site in the Voorhis Reserve, and the site in the Bernard Field Station is nearly 5 miles east–northeast of the site in Bonelli Park. All sites are at an elevation between 270 and 450 m. We collected soil from natural areas to limit the effects of factors such as grazing and fire control regimes. Each site had both a mustard-dominated area and an adjacent intact CSS area (less than 80 m apart) (Figure 1). We defined the CSS habitat as areas dominated by native drought-deciduous shrubs (e.g., Artemisia californica and Eriogonum fasciculatum) with <5% non-native species by visual estimate. Artemisia californica was the most common shrub at all three sites. Invasive mustard habitat was defined as containing <5% cover of native species. Mustard habitats at our sites consisted of >85% Brassica nigra and H. incana cover, with H. incana being the most abundant and often the only mustard species present. Mustard habitats at each of our sites included other common non-native annuals (e.g., Eriodium spp.) at low abundances; tree tobacco (Nicotiana glauca) and the Maltese-star thistle (Centaurea melitensis) were common at the Voorhis reserve, where the mustard habitat was less monotypic.
The CSS ecosystem is native to low elevational areas in southern California. CSS is characterized by a Mediterranean climate and drought-deciduous shrubs, which grow in the cool-moist months (October through May) when water is not a limiting factor. In southern California, a gradient of different microclimates and species dominances spans from the coast to regions classified as inland CSS habitats, which include our sites [15,40,41,42]. Although mean annual temperatures are relatively consistent across low-elevation sites in the Los Angeles area [3], climate and weather patterns are distinct (i.e., coastal regions experience milder winters and summers, higher humidity, and less flash-flooding) [43].

2.2. Soil Collection and Processing

To compare soil microbial abundances and assemblage structure between habitats and sites, we collected soil from the top 10 cm (A horizon) from each habitat type (CSS or mustard) at the three sites, being sure to exclude plant material on the surface (O horizon). Because differences in angle and aspect may influence soil conditions, we made sure to collect soil from sites with similar slope positions. In addition, we recognize that soil taxonomy can vary within localized areas, even meters, due to various geological factors. While we used existing soil maps to identify sites with similar parent material and soil profiles, Caspi et al. [2] highlighted that soil surveys are a useful first approximation and cannot be used to assess differences across the small scales we are studying. Soil pit data from the Bernard Field Station confirm that soils in both habitats are composed of structureless granite alluvium without carbonates. However, we do not have similar data for the two habitats at Bonelli Park or the Voorhis Reserve; thus, differences in soil properties should be interpreted conservatively. All soil in CSS was collected from underneath A. californica shrubs (e.g., within the dripline), while soil from mustard habitats were collected in areas where H. incana was abundant and at least 5 m from the nearest CSS shrub. We collected soil in late spring (1 and 2 June 2022). Although most drought-deciduous native shrubs had not become dormant, most mustard plants had completed their growing period. Within each habitat at each site, we randomly sampled six plots.
At each of our 36 plots (six plots for each habitat at each site), we collected three soil samples for microbial analyses and for our greenhouse germination experiment: (i) 200 mL of soil for analysis of soil microbial abundances and different soil properties (pH, soil moisture, SOM); (ii) 50 mL of soil for DNA analyses to determine microbial assemblages; and (iii) approximately 500 mL of soil for the greenhouse experiment. We placed soil collected for the greenhouse experiment from each habitat at each site into the same sterilized five-gallon bucket and homogenized the soil before greenhouse experiments for a total of six homogenized soil samples. We also opportunistically took 250 mL samples from these homogenized soil samples for sediment size analyses. In the field, all samples were stored in a cooler with dry ice. Once we returned from the field, we immediately shipped samples collected to examine microbial abundances to Earthfort™ for analyses on the day of collection and placed DNA samples into a −20 °C freezer.
To better understand soil properties among sites and between habitats, we conducted a variety of tests. First, we sent six samples to the UC Davis Analytical Laboratory (Davis, CA, USA) for sediment size analysis—one for each habitat at each site. Second, we measured soil organic matter content, using the loss-on-ignition method, burning small subsamples with a muffle furnace at 500 °C for 4 hrs. Next, we sent all 36 of the 200 mL samples to Earthfort™ Laboratories (Corvallis, OR, USA) to determine active and total fungi and bacteria. Active bacteria and fungi (µg/g) were measured using fluorescein diacetate staining to produce fluorescence when in contact with fungi that are metabolically active [44]. Total fungi and bacteria (µg/g) were quantified using enumeration through direct microscopy. Total bacteria were identified using fluorescein isothiocyante method [45,46] while total fungi were determined by converting length and width measurements. Soil moisture content (%) and pH was also measured by Earthfort Laboratories using the saturated paste method.
To examine differences in fungal assemblages between habitats, we extracted DNA from soil using the MoBio PowerSoil DNA extraction kit according to kit procedures. We used approximately 0.25 g of soil from each sample and sent extracted DNA to Molecular Research LP (MR DNA; http://www.mrdnalab.com (accessed on 20 June 2022)) for sequencing using primers to amplify the fungal ITS region: fungal ITS sequences: ITS1F12 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC).
These primers (with a barcode on the forward primer) were used in a 30-cycle PCR using the HotStarTaq PlusMasterMix Kit (Qiagen, USA) at −94 °C for 3 min, followed by 28 cycles at 94 °C for 30 s, 53 °C for 40 s and 72 °C for 1 min, with a final elongation step of 5 min at 72 °C. After PCR, the samples were pooled and a DNA library constructed using the Illumina TruSeq DNA library preparation protocol and sequenced using the Illumina MiSeq v3 2 × 300 bp sequencing platform following the manufacturer’s guidelines (Illumina, San Diego, CA, USA). All raw sequence reads are available at GenBank under BioProject PRJNA891695.

2.3. Greenhouse Experiment

We initially designed a greenhouse experiment to explore plant–soil feedback effects on the germination and growth of three common CSS plant species (Supplementary Material File S1) using an approach similar to the experiment conducted by Singh and Meyer [10]. However, in our experiment, germination rates of all target plant species were low (<4%), but germination of other non-target species was high. Consequently, we shifted our focus to record germination of all non-target plant species that sprouted.
We monitored germination over six weeks, from 3 June to 14 July 2022, by recording the plant species and the number of individuals that sprouted in 420 Ray Leach containersTM (RCL3; 2.5 cm diameter, 12 cm depth) filled with 50 mL of homogenized soil. We had 70 containers from each habitat type at each site. We randomized the locations of the containers across six container holders in the open area of the Pomona College greenhouse. Temperatures were maintained at 24–26 °C during the day and 21–24 °C at night. We also rotated the container holders to different positions daily to mitigate the influence of different positions (the section of the greenhouse we used is partially sunny). We checked all containers daily and watered containers using a mist irrigation system. During the first half of the experiment, we watered 10–15 min total each day, by watering for ~2 to 3 min at times spaced evenly throughout the day using the automated system. In the second half of the experiment, we adjusted the automated system to water for only 6–10 min each day. Each seedling was photographed and removed following identification (typically 5 to 8 days after germination). In instances where we could not identify an individual’s species in the first 10 days, they were transplanted into larger containers so that they could develop further.

2.4. Analyses

2.4.1. Soil Abiotic and Biotic Properties

For sediment size analyses, we did not have replicates; thus, we report values of percent sand, silt, and clay for each habitat at each site. To test if soil pH, soil organic matter, soil moisture, and total and active abundances of fungi and bacteria differed among sites and between habitats, we used two-factor PERMANOVAs using site and habitat as fixed factors. For pairwise comparisons among sites, we used permutation-based t tests using a Bonferroni adjusted α of 0.017 for multiple testing. In instances where there were significant site x habitat interactions, we ran three pair-wise comparisons examining differences between CSS and mustard habitats within each site (α = 0.17). We largely expected that soil properties would differ among sites, and we focused our results on differences among habitat types, i.e., how mustard invasions influence these properties. Similarity matrices were constructed using the Euclidian distance algorithm. All analyses were run using PRIMER-E with the PERMONOVA+ add on [47].

2.4.2. Fungal Assemblage Analyses

Reads were processed using Qiime2 [48]. All samples were imported into Qiime2, and the ITS1 region was extracted from each read using the Q2_ITSxpress plugin [49]. Extracted reads were processed using DADA2 [50] (using the q2-dada2 qiime plugin) to generate a table of unique amplicon sequence variants (ASV) and their counts per sample. Taxonomy for each ASV was determined using the q2-feature-classifier plugin [51] classify-consensus-vsearch taxonomy classifier against the Unite database version 8.3 for eukaryotic ASVs [52]. ASVs classified as fungal were kept for further analyses.
Samples were rarified to 4,000 reads based on the number of reads of the sample with fewer reads, and alpha and beta diversity measures were calculated using Qiime’s diversity plugin. The high sequence variability of the ITS region makes multiple sequence alignment of this region highly unreliable for distantly related groups of fungi, which results in unreliable phylogenetic trees [53]. Because of this, phylogenetic-based measures of alpha and beta diversity are not recommended for ITS-based fungal amplicon samples.
To test if fugal assemblages differ between habitats and sites, we developed similarity matrices using the Bray–Curtis algorithm in Qiime and uploaded this matrix into PRIMER-E for analyses. We used a two-factor PERMANOVA using site and habitat as fixed factors. Similar to total and active bacteria analyses, we used two-factor PERMANOVAs using the Euclidian distances to examine differences in Shannon diversity, species richness, and evenness (Pielou) for fungi.
To test if different habitats harbor different compositions of common and functionally important fungal taxa, we compared the relative abundances of common fungi Basidiomycota and Ascomycota and functionally important species Glomeromycota (AMF) Pucciniomycotina (pathogens), and five orders composed mostly of EMF: Agricales, Boletales, Cantharellales, Pezizales, and Helotiales [54] using two-factor PERMANOVAs with site and habitat type as factors [54,55]. When interpreting findings for AMF, it is important to recognize that the use of the ITS1 marker may not be appropriate in fully assessing Glomeromycota abundances [56,57]. Similarity matrices were developed using the Euclidian algorithm.

2.4.3. Germination Analyses

We analyzed germination data using a Chi-square goodness of fit test for all species with more than 30 total seedlings observed (Ei > 5 for six soil origins). We also performed a Chi-square goodness of fit test for total invasive species across the six habitats, testing the null hypothesis that germination rates for a species were equal across habitats. Because we were performing three Chi-squared tests, our Bonferroni-corrected α was 0.017.

3. Results

3.1. Soil Properties

Soil properties differed among sites and between habitats (Table 1). While only one sample per site was collected for sediment size analysis, the CSS soil at Bonelli Park had elevated silt and clay content (Table 1). Soil pH was reduced in CSS soil compared with mustard soil (F1 = 9.4; p = 0.005). pH also varied across sites (F2 = 9.0; p = 0.001), but there was no interaction effect (F2 = 2.1; p = 0.14). Soil organic matter (SOM) did not differ between habitats (F1 = 0.2; p = 0.648). However, soil organic matter differed among sites (F2 = 45.1; p = 0.001), and there was a significant site by habitat interaction (F2 = 10.0; p = 0.001). Pairwise differences revealed that there was no difference in SOM between habitat types at the Bernard Field Station (t = 0.602; p = 0.508) or Bonelli Park (t = 2.1; p = 0.044), but soil organic matter was elevated in mustard soil at the Voorhis Reserve (t = 3.9; p = 0.005). Soil moisture differed between habitats (F1 = 10.2, p = 0.003) and sites (F2 = 101.9, p= 0.0001), and there was a significant site by habitat interaction (F2 = 13.9; p = 0.0001). Pair-wise comparisons revealed that soil moisture was elevated in the CSS habitat at Bonelli Park (t = 4.5, p = 0.001), but not between habitats at either the Bernard Field Station (t = 0.39, p = 0.75) or the Voorhis Reserve (t = 0.48, p = 0.66).

3.2. Microbial Abundances

Active and total bacteria differed among sites and between habitats, with abundances elevated in CSS habitats (Figure 2). There was a significant interaction effect for total bacteria. Active fungi did not differ among sites or habitats. However, total fungi was elevated in CSS habitats (Figure 2).

3.3. Fungal Assemblages

Microbial assemblages differed across sites (F2 = 2.3; p = 0.001) and between habitats (F1 = 3.2; p = 0.001). Additionally, we found a significant site x habitat interaction (F2 = 1.6; p = 0.001) (Figure 3).
Fungal richness (F2 = 2.9; p = 0.068), Pielou evenness (F2 = 1.5; p = 0.25), and Shannon diversity (F2 = 2.1; p = 0.13) did not differ across sites. Likewise, fungal richness (F1 = 0.015; p = 0.90), Pielou evenness (F1 = 0.091; p = 0.76), and Shannon diversity (F1 = 0.017; p = 0.90) did not differ between habitats. There were no site x habitat interaction effects for richness (F2 = 3.4; p = 0.057), Pielou evenness (F2 = 0.39; p = 0.69), or Shannon diversity (F2 = 0.90; p = 0.43).
For most fungal taxa assessed, there were no differences in relative abundances between habitat types or among sites (Table 2). However, we found that Ascomycota had ~25% higher relative abundances in CSS soil, and the relative abundance of Pucciniomycotina, our plant pathogen taxonomic group, was three times more abundant in CSS soil. Conversely, Pezizales (EMF) had higher relative abundances in mustard soil. Boletales, which had higher relative abundances at Bonelli Park than at either Voorhis or the Bernard Field Station, was the only taxonomic group that differed across sites (Table 2).

3.4. Seedling Germination

A total of 227 seedlings were germinated over the course of our greenhouse experiment. Across the entire sample, mustard (family, Brassicaceae) species were the most common. Germination frequencies for Brassicaceae (χ2 = 211.8; p = 0.001), Nicotiana glauca (χ2 = 87.6; p = 0.001), and total invasive species (χ2 = 329.0; p = 0.001) were different across soil origins (Table 3).

4. Discussion

Similar to other studies that explored the effects of mustard invasions on soil microbes [2,3,10,24], we found that microbial abundances were reduced in mustard habitats dominated by H. incana in southern California. While active fungi did not differ between CSS and mustard habitats, total fungi, and active and total bacteria were elevated in CSS soils, highlighting that H. incana invasions reduce soil microbe abundances. Caspi et al. [3] found a reduced abundance of active fungi in two mustard sites relative to CSS habitats. However, Caspi et al. [3] collected samples in early spring, while our samples were collected in late spring when sites were experiencing hot, dry conditions. These hot, dry environmental conditions are hypothesized to be a strong selecting force for microbial assemblages in Mediterranean semi-arid environments [58] and likely influence microbial activity. For example, soil moisture values at our sites were below 5%, and below 2 and 0.5% at the Voorhis and the BFS, respectively, with lower values being associated with sites with higher concentrations of sand and lower concentrations of clay. We found elevated soil moisture in CSS at Bonelli Park relative to the mustard habitat. While this may help explain why active bacteria at this site were elevated in CSS, we did not observe elevated active fungi concentrations in the CSS habitat. In addition, we observed similar patterns for both active fungi and bacteria at the BFS despite low (<0.5%) soil humidity in both habitat types. These results highlight that the timing of sample collection may be an important consideration when interpreting how disturbances influence microbial abundance, especially abundances of active microbes in southern California systems [37].
In addition to differences in microbial abundance, our study found that CSS and mustard habitats host different fungal assemblages. These differences were not associated with declines in fungal richness, diversity, or evenness, supporting the finding that mustard areas support different microbial taxa and not a subset of the CSS assemblage that may be expected with significant declines in abundances. In addition, while differences in soil fungal assemblages among sites were observed, habitat type had the strongest influence, highlighting that mustard invasions exert a strong selecting force on soil fungi. This was expected, as allelochemicals emitted by mustards have been shown to have strong effects on soil fungal and bacterial abundances, particularly mycorrhizal fungi [59,60]. Differences in fungal assemblages between habitats were observed despite differences in SOM and soil moisture among sites. However, attributing differences to just allelochemicals may be inappropriate, as differences in soil pH between habitats were also observed, with soils in CSS being more acidic. While controlled experiments are needed to isolate the importance of various factors in shaping soil fungal assemblages, our experimental design attempted to control for many factors that influence differences in microbial assemblages (e.g., climate, parent material, species pools) by sampling both habitats in close proximity at each site. Therefore, we feel confident that our results inform to what happens following type-conversion of CSS to areas dominated by non-native mustards in southern California, i.e., soils become more neutral and harbor distinct microbial assemblages.
Unfortunately, we remain in our infancy regarding determining how mustard invasions influence functionally important fungal taxa. It is difficult to incorporate the findings of reduced microbial abundances with differences, or no differences, in the relative abundance of various fungal taxa. It is possible that mustard habitats have reduced abundances of some taxa without observing differences in relative abundances. For example, despite numerous studies indicating that mustards reduce AMF abundances [29,30,59,60], we found that the relative abundances of Glomeromycota (all arbuscular mycorrhizal fungi) did not differ between habitats or across sites. However, total fungal abundances were at least twice as high in CSS at two sites (Bernard Field Station and Bonelli Park). Combining overall declines in abundances with no observed change in relative abundance suggests that AMF abundances were reduced in the mustard habitat at these sites. This reasoning could also be applied to other taxa where no differences in relative abundances were observed. However, it does not apply when relative abundances of fungal taxa are elevated in mustard soils, as we found with Pezizales, the only ectomycorrhizal fungi order where relative abundances differed among habitat types. Relative abundances of Pezizales at Bonelli were on average 40 times greater in mustard soils, highlighting that overall abundance of this taxon may be elevated in mustard soils at this site. Similar patterns were not observed at other sites. For taxa with elevated relative abundances in CSS, such as Pucciniomycotina, a subphylum that consists primarily of plant pathogens [55], one may assume that the overall abundances are significantly elevated. While other methods are better at quantifying how habitat modifications influence fungal and other microbial abundances and determining if changes in those abundances have a functional impact (see Pakpour and Klironomos [59]), our data provide a foundational first step to identify hypotheses about how mustard invasions influence fungal assemblages in southern California. In addition, the data provide a baseline to explore how microbial assemblages differ among sites, years, and habitats across the region.
Changes in soil microbial communities can also impact plant assemblages. Previous studies have shown that soil microbes collected from different plant communities influence plant germination and growth [9,10,61,62,63], which can modify plant assemblage structure. While little attention has been focused on mustard invasions, Singh and Meyer [10] demonstrated that Brassica nigra germination was negatively impacted by soil microbes from CSS, non-native grasslands, and areas dominated by H. incana. While they did not test germination rates of H. incana in soils conditioned by H. incana, the most common mustard in our study sites and region, their results provide insights into patterns observed in this study. First, it may explain why B. nigra abundance was low at our sites, as it increasingly seems that H. incana is the most abundant invasive mustard species in natural areas near our study sites. Second, it informs the results from our germination experiment. Whereas Cox and Allen [11] found that non-native grasses germinated successfully in soil taken from both CSS and adjacent non-native grass-dominated areas, we found that mustard germination was elevated in mustard soils. While mustard seedling abundances were low in CSS, mustards and other invasives were still more common than native plants. Still, our germination results support the finding that H. incana has a difficult time becoming established in CSS areas, even in CSS areas near abundant H. incana populations. While differences may be explained by poor recruitment of mustard seeds into CSS, or increased seed predation by common CSS granivores that prefer B. nigra seeds [34], the possibility that CSS microbial assemblages deleteriously impact H. incana germination and growth should be an active area of inquiry, as plant–soil feedbacks in CSS may also explain lowered abundances of mustards in CSS.
Overall, our study demonstrates that mustard invasions, primarily invasion by H. incana, in Southern California, reduce soil microbial abundances and modify soil fungal assemblages. Contrary to our hypotheses, fungal species richness, diversity, and evenness did not differ between habitats, highlighting that these two habitats harbor unique microbial assemblages. The extent to which mustard allelopathy may be the primary driver of reduced soil fungal and bacterial abundances and modifications in assemblage structure is unknown, as mustard invasions also increase soil pH, with more neutral soils being found in mustard habitats. As CSS and mustard areas consistently harbor different fungal assemblages across sites and soil microbes are drivers of geochemical processes, reductions in abundances and changes in assemblage structure of both bacteria and fungi can have effects on ecosystem functioning [64,65,66,67]. In this case, reductions in microbial abundances likely reduce soil respiration and enhance soil C and N storage [2,3], although further research is still required to confirm this. Currently, functional consequences of shifts in assemblage structure are unknown and need to be further elucidated. However, there is evidence that intact CSS may be able to biologically resist invasion of mustards, as evidenced by low mustard germination and high microbe pathogen abundances in CSS soils. Characterizing fungal assemblages in the two habitats provides foundational information for future studies to examine how invasions influence microbial assemblage structure. Previous studies in southern California have primarily focused on type conversion of CSS to non-native grasslands. However, invasion by mustards, H. incana in particular, has differing effects on soil microbial communities, highlighting that CSS restoration and preservation of key ecosystem services may require different approaches depending on the identity of the invader.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d15010050/s1, Supplementary File S1. Germination of target species in soil collected from six origin habitats in southern California (Mustard and California Sage Scrub habitat at three nature reserves). Twenty seeds of each target species (P. distans, S. apiana, and E. fasciculatum) were planted in each of the six soil origin habitats. Overall, germination was <5%.

Author Contributions

Conceptualization, Z.R.W. and W.M.M.III; methodology, Z.R.W., A.R.O.C., L.D., A.J., E.J.C.III, G.R. and W.M.M.III; software, Z.R.W., A.R.O.C. and W.M.M.III; validation, Z.R.W., A.R.O.C. and W.M.M.III; formal analysis, Z.R.W. and A.R.O.C.; investigation, Z.R.W., A.R.O.C., L.D., A.J., E.J.C.III, G.R. and W.M.M.III; resources, W.M.M.III; data curation, Z.R.W. and A.R.O.C.; writing—original draft preparation, Z.R.W. and W.M.M.III; writing—review and editing, all authors; visualization, Z.R.W. and W.M.M.III; supervision, W.M.M.III and A.R.O.C.; project administration, Z.R.W. and W.M.M.III; funding acquisition, W.M.M.III. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Pomona College Biology Department and the Pomona College Summer Undergraduate Research Program (SURP), specifically the Corwin Hansch and Bruce Telzer Undergraduate Research Fund and the Dale N. Robertson Fund for Undergraduate Research, the Pomona College Biology Department, and the Shultz and Schenk families.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All ecological data can be found in the KNB network (link: doi:10.5063/F1WW7G38). Molecular data can be retrieved from: GenBank (BioProject PRJNA891695).

Acknowledgments

Access to our research sites was provided by the Robert J. Bernard Field Station, Bonelli Park (license #001225), and the Voorhis Reserve. Support was provided by Fabien Jammes, Ross Pringle, and Seohyeon Lee at the Pomona College greenhouse facility. Consultation on fungal analyses was provided by Mia Maltz. Consultation on interpreting fungal and bacterial abundances was provided by Kinser Nyden and Matthew Slaughter at Earthfort Laboratories. Consultation on plant identification was provided by the Theodore Payne Foundation support team and by Diane Thomson.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Buerdsell, S.L.; Milligan, B.G.; Lehnhoff, E.A. Invasive plant benefits a native plant through plant-soil feedback but remains the superior competitor. NeoBiota 2021, 64, 119–136. [Google Scholar] [CrossRef]
  2. Caspi, T.; Estrada, L.; Dowling, A.V.; Su, E.; Leshchinskiy, M.; Cavalcanti, A.R.O.; Crane, E.J.; Robins, C.R.; Meyer, W.M. Carbon and nitrogen in the topsoils of inceptisols and mollisols under native sage scrub and non-native grasslands in Southern California. Geoderma Reg. 2018, 14, e00172. [Google Scholar] [CrossRef]
  3. Caspi, T.; Hartz, L.A.; Soto Villa, A.E.; Loesberg, J.A.; Robins, C.R.; Meyer, W.M. Impacts of invasive annuals on soil carbon and nitrogen storage in Southern California depend on the identity of the invader. Ecol. Evol. 2019, 9, 4980–4993. [Google Scholar] [CrossRef] [PubMed]
  4. Rodriguez, D.; Casagrande, G.; Carmona-Galindo, V.D. Effects of black mustard allelopathy on the fitness and life history strategies of buffalo gourd in southern california. Bios 2016, 87, 98–103. [Google Scholar] [CrossRef]
  5. Verbeek, J.D.; Kotanen, P.M. Soil-mediated impacts of an invasive thistle inhibit the recruitment of certain native plants. Oecologia 2019, 190, 619–628. [Google Scholar] [CrossRef]
  6. Andrews, H.M.; Jenerette, G.D. Exotic grass litter modulates seasonal pulse dynamics of CO2 and N2O, but not NO, in Mediterranean-type coastal sage scrub at the wildland-urban interface. Plant Soil 2020, 456, 339–353. [Google Scholar] [CrossRef]
  7. Bell, J.K.; Siciliano, S.D.; Lamb, E.G. A Survey of invasive plants on grassland soil microbial communities and ecosystem services. Sci Data 2020, 7, 86. [Google Scholar] [CrossRef] [Green Version]
  8. Eldridge, D.J.; Travers, S.K.; Val, J.; Ding, J.; Wang, J.-T.; Singh, B.K.; Delgado-Baquerizo, M. Experimental evidence of strong relationships between soil microbial communities and plant germination. J. Ecol. 2021, 109, 2488–2498. [Google Scholar] [CrossRef]
  9. Pickett, B.; Irvine, I.C.; Bullock, E.; Arogyaswamy, K.; Aronson, E. Legacy effects of invasive grass impact soil microbes and native shrub growth. Invasive Plant Sci. Manag. 2019, 12, 22–35. [Google Scholar] [CrossRef]
  10. Singh, M.; Meyer, W.M. Plant-soil feedback effects on germination and growth of native and non-native species common across Southern California. Diversity 2020, 12, 217. [Google Scholar] [CrossRef]
  11. Cox, R.D.; Allen, E.B. Composition of soil seed banks in Southern California coastal sage scrub and adjacent exotic grassland. Plant Ecol. 2008, 198, 37–46. [Google Scholar] [CrossRef]
  12. Dong, H.; Liu, T.; Liu, Z.; Song, Z. Fate of the soil seed bank of giant ragweed and its significance in preventing and controlling its invasion in grasslands. Ecol. Evol. 2020, 10, 4854–4866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Liu, Z.; Ge, X.; Fu, Z.; Liu, J. Alternanthera Philoxeroides invasion affects the soil seed bank of reed community. Environ. Exp. Bot. 2020, 180, 104196. [Google Scholar] [CrossRef]
  14. Puritty, C.E.; Esch, E.H.; Castro, S.P.; Ryan, E.M.; Lipson, D.A.; Cleland, E.E. Drought in Southern California coastal sage scrub reduces herbaceous biomass of exotic species more than native species, but exotic growth recovers quickly when drought ends. Plant Ecol. 2019, 220, 151–169. [Google Scholar] [CrossRef]
  15. Rundel, P.W. Sage Scrub. In Terrestrial Vegetation of California, 3rd ed.; Barbour, M.G., Keeler-Wolf, T., Schoenherr, A.A., Eds.; University of California Press: Oakland, CA, USA, 2007; pp. 208–228. [Google Scholar]
  16. Dinerstein, E.; Olson, D.; Joshi, A.; Vynne, C.; Burgess, N.D.; Wikramanayake, E.; Hahn, N.; Palminteri, S.; Hedao, P.; Noss, R.; et al. An ecoregion-based approach to protecting half the terrestrial realm. BioScience 2017, 67, 534–545. [Google Scholar] [PubMed]
  17. Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; da Fonseca, G.A.B.; Kent, J. Biodiversity hotspots for conservation priorities. Nature 2000, 403, 853–858. [Google Scholar] [PubMed]
  18. Reid, T.S.; Murphy, D.D. Providing a regional context for local conservation action: A natural community conservation plan for the Southern California coastal sage scrub. BioScience 1995, 45 (Suppl. 1), S84–S90. [Google Scholar] [CrossRef]
  19. Talluto, M.V.; Suding, K.N. Historical change in coastal sage scrub in Southern California, USA in relation to fire frequency and air pollution. Landsc. Ecol. 2008, 23, 803–815. [Google Scholar] [CrossRef]
  20. Cox, R.D.; Preston, K.L.; Johnson, R.F.; Minnich, R.A.; Allen, E.B. Influence of landscape-scale variables on vegetation conversion to exotic annual grassland in Southern California, USA. Glob. Ecol. Conserv. 2014, 2, 190–203. [Google Scholar] [CrossRef] [Green Version]
  21. Finks, S.S.; Weihe, C.; Kimball, S.; Allison, S.D.; Martiny, A.C.; Treseder, K.K.; Martiny, J.B.H. Microbial community response to a decade of simulated global changes depends on the plant community. Elem. Sci. Anthr. 2021, 9, 00124. [Google Scholar] [CrossRef]
  22. Goldstein, L.J.; Suding, K.N. Intra-annual rainfall regime shifts competitive interactions between coastal sage scrub and invasive grasses. Ecology 2014, 95, 425–435. [Google Scholar] [CrossRef] [PubMed]
  23. Hawkes, C.V.; Wren, I.F.; Herman, D.J.; Firestone, M.K. Plant invasion alters nitrogen cycling by modifying the soil nitrifying community. Ecol. Lett. 2005, 8, 976–985. [Google Scholar] [CrossRef] [PubMed]
  24. Oduor, A.; van Kleunen, M.; Stift, M. Allelopathic effects of native and invasive Brassica nigra do not support the novel-weapons hypothesis. Am. J. Bot. 2020, 107, 1106–1113. [Google Scholar] [CrossRef] [PubMed]
  25. Turk, M.A.; Tawaha, A.M. Allelopathic effect of black mustard (Brassica nigra L.) on germination and growth of wild oat (Avena fatua L.). Crop Prot. 2003, 22, 673–677. [Google Scholar] [CrossRef]
  26. Tawaha, A.M.; Turk, M.A. Allelopathic Effects of black mustard (Brassica nigra) on germination and growth of wild barley (Hordeum spontaneum). J. Agron. Crop Sci. 2003, 189, 298–303. [Google Scholar] [CrossRef]
  27. Oduor, A.M.O.; Lankau, R.A.; Strauss, S.Y.; Gómez, J.M. Introduced Brassica Nigra populations exhibit greater growth and herbivore resistance but less tolerance than native populations in the native range. New Phytol. 2011, 191, 536–544. [Google Scholar] [CrossRef]
  28. Rivera-Vega, L.J.; Krosse, S.; de Graaf, R.M.; Garvi, J.; Garvi-Bode, R.D.; van Dam, N.M. Allelopathic effects of glucosinolate breakdown products in Hanza (Boscia senegalensis (Pers.) Lam.) processing waste water. Front. Plant Sci. 2015, 6, 532. [Google Scholar] [CrossRef] [Green Version]
  29. Poon, G.T.; Maherali, H. Competitive interactions between a nonmycorrhizal invasive plant, Alliaria petiolata, and a suite of mycorrhizal grassland, old field, and forest species. PeerJ 2015, 3, e1090. [Google Scholar] [CrossRef] [Green Version]
  30. Stinson, K.A.; Campbell, S.A.; Powell, J.R.; Wolfe, B.E.; Callaway, R.M.; Thelen, G.C.; Hallett, S.G.; Prati, D.; Klironomos, J.N. Invasive plant suppresses the growth of native tree seedlings by disrupting belowground mutualisms. PLoS Biol. 2006, 4, e140. [Google Scholar] [CrossRef]
  31. Blossey, B.; Nuzzo, V.; Dávalos, A. Climate and rapid local adaptation as drivers of germination and seed bank dynamics of Alliaria petiolata (Garlic Mustard) in North America. J. Ecol. 2017, 105, 1485–1495. [Google Scholar] [CrossRef]
  32. Callaway, R.M.; Ridenour, W.M. Novel weapons: Invasive success and the evolution of increased competitive ability. Front. Ecol. Environ. 2004, 2, 436–443. [Google Scholar] [CrossRef]
  33. Zhang, Z.; Liu, Y.; Yuan, L.; Weber, E.; van Kleunen, M. Effect of allelopathy on plant performance: A meta-analysis. Ecol. Lett. 2021, 24, 348–362. [Google Scholar] [CrossRef] [PubMed]
  34. Loesberg, J.A.; Meyer, W.M. Granivory in California sage scrub: Implications for common plant invaders and ecosystem conservation. Plant Ecol. 2021, 222, 1089–1100. [Google Scholar] [CrossRef]
  35. Orrock, J.L.; Witter, M.S.; Reichman, O.J. Apparent competition with an exotic plant reduces native plant establishment. Ecology 2008, 89, 1168–1174. [Google Scholar] [CrossRef]
  36. Burke, D.J.; Chan, C.R. Effects of the invasive plant Garlic Mustard (Alliaria petiolata) on bacterial communities in a Northern Hardwood Forest soil. Can. J. Microbiol. 2010, 56, 81–86. [Google Scholar] [CrossRef] [PubMed]
  37. Cox, E.; Cavalcanti, A.R.O.; Crane, E.J.; Meyer, W.M. Soil bacterial assemblage responses to wildfire in low elevation Southern California habitats. PLoS ONE 2022, 17, e0266256. [Google Scholar] [CrossRef] [PubMed]
  38. Jin, X.; Wang, J.; Li, D.; Wu, F.; Zhou, X. Rotations with Indian Mustard and Wild Rocket suppressed cucumber Fusarium Wilt disease and changed rhizosphere bacterial communities. Microorganisms 2019, 7, 57. [Google Scholar] [CrossRef] [Green Version]
  39. Pérez Castro, S.; Cleland, E.E.; Wagner, R.; Sawad, R.A.; Lipson, D.A. Soil microbial responses to drought and exotic plants shift carbon metabolism. ISME J. 2019, 13, 1776–1787. [Google Scholar] [CrossRef]
  40. Kirkpatrick, J.B.; Hutchinson, C.F. The community composition of Californian coastal sage scrub. Plant Ecol. 1977, 35, 21–33. [Google Scholar] [CrossRef]
  41. Kirkpatrick, J.B.; Hutchinson, C.F. The environmental relationships of Californian coastal sage scrub and some of its component communities and species. J. Biogeogr. 1980, 7, 23–38. [Google Scholar] [CrossRef]
  42. Paysen, T.E.; Derby, J.A.; Black, H.; Bleich, V.C.; Mincks, J.W. A Vegetation Classification System Applied to Southern California; General Techical Report PSW-45; U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station: Albany, CA, USA, 1980; Volume 45, 33p. [Google Scholar]
  43. Mooney, H.; Zavaleta, E. (Eds.) Ecosystems of California; University of California Press: Oakland, CA, USA, 2016. [Google Scholar]
  44. Schnürer, J.; Rosswall, T. Fluorescein Diacetate hydrolysis as a measure of total microbial activity in soil and litter. Appl. Environ. Microbiol. 1982, 43, 1256–1261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Babiuk, L.A.; Paul, E.A. The use of fluorescein isothiocyanate in the determination of the bacterial biomass of grassland soil. Can. J. Microbiol. 1970, 16, 57–62. [Google Scholar] [CrossRef] [PubMed]
  46. Van Veen, J.A.; Paul, E.A. Conversion of biovolume measurements of soil organisms, grown under various moisture tensions, to biomass and their nutrient content. Appl. Environ. Microbiol. 1979, 37, 686–692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Clarke, K.R.; Gorley, R.N. PRIMER V6: User Manual/Tutorial; PRIMER-E: Plymouth, UK, 2006. [Google Scholar]
  48. Bolyen, D.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
  49. Rivers, A.R.; Weber, K.C.; Gardner, T.G.; Liu, S.; Armstrong, S.D. ITSxpress: Software to rapidly trim internally transcribed spacer sequences with quality scores for marker gene analysis. F1000Research 2018, 7, 1418. [Google Scholar] [CrossRef] [Green Version]
  50. Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581. [Google Scholar] [CrossRef] [Green Version]
  51. Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Gregory Caporaso, J. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome. 2018, 6, 90. [Google Scholar] [CrossRef]
  52. Abarenkov, K.; Zirk, A.; Põldmaa, K.; Piirmann, T.; Pöhönen, R.; Ivanov, F.; Adojaan, K.; Kõljalg, U. Third-party annotations: Linking PlutoF platform and the ELIXIR Contextual Data ClearingHouse for the reporting of source material annotation gaps and inaccuracies. Biodivers. Inf. Sci. Stand. 2021, 5, e74249. [Google Scholar] [CrossRef]
  53. Fouquier, J.; Rideout, J.R.; Bolyen, E.; Chase, J.; Shiffer, A.; McDonald, D.; Knight, R.; Caporaso, J.G.; Kelley, S.T. Ghost-tree: Creating hybrid-gene phylogenetic trees for diversity analyses. Microbiome 2016, 4, 11. [Google Scholar] [CrossRef] [Green Version]
  54. Tedersoo, L.; May, T.W.; Smith, M.E. Ectomycorrhizal lifestyle in fungi: Global diversity, distribution, and evolution of phylogenetic lineages. Mycorrhiza 2010, 20, 217–263. [Google Scholar] [CrossRef]
  55. Aime, M.C.; Toome, M.; McLaughlin, D.J. Pucciniomycotina. In Systematics and Evolution: Part A; McLaughlin, D.J., Spatafora, J.W., Eds.; The Mycota; Springer: Berlin/Heidelberg, Germany, 2014; pp. 271–294. [Google Scholar]
  56. Francioli, D.; Lentendu, G.; Lewin, S.; Kolb, S. DNA Metabarcoding for the characterization of terrestrial microbiota—Pitfalls and solutions. Microorganisms 2021, 9, 361. [Google Scholar] [CrossRef] [PubMed]
  57. Öpik, M.; Davison, J.; Moora, M.; Zobel, M. DNA-based detection and identification of Glomeromycota: The virtual taxonomy of environmental sequences. Botany 2014, 92, 135–147. [Google Scholar] [CrossRef]
  58. Yuste, J.C.; Fernandez-Gonzalez, A.J.; Fernandez-Lopez, M.; Ogaya, R.; Penuelas, J.; Lloret, F. Functional diversification within bacterial lineages promotes wide functional overlapping between taxonomic groups in a Mediterranean forest soil. FEMS Microbiol. Ecol. 2014, 90, 54–67. [Google Scholar] [CrossRef] [PubMed]
  59. Pakpour, S.; Klironomos, J. The invasive plant, Brassica nigra, degrades local mycorrhizas across a wide geographical landscape. R. Soc. Open Sci. 2015, 2, 150300. [Google Scholar] [CrossRef] [Green Version]
  60. Schreiner, R.P.; Koide, R.T. Mustards, mustard oils and mycorrhizas. New Phytol. 1993, 123, 107–113. [Google Scholar] [CrossRef]
  61. Bozzolo, F.H.; Lipson, D.A. Differential responses of native and exotic coastal sage scrub plant species to N additions and the soil microbial community. Plant Soil 2013, 371, 37–51. [Google Scholar] [CrossRef]
  62. Miller, E.C.; Perron, G.G.; Collins, C.D. Plant-driven changes in soil microbial communities influence seed germination through negative feedbacks. Ecol. Evol. 2019, 9, 9298–9311. [Google Scholar] [CrossRef] [Green Version]
  63. Yelenik, S.G.; Levine, J.M. The role of Plant–Soil Feedbacks in driving native-species recovery. Ecology 2011, 92, 66–74. [Google Scholar] [CrossRef]
  64. Allison, V.J.; Miller, R.M.; Jastrow, J.D.; Matamala, R.; Zak, D.R. Changes in soil microbial community structure in a tallgrass prairie chronosequence. Soil Sci. Soc. Am. J. 2005, 69, 1412–1421. [Google Scholar] [CrossRef] [Green Version]
  65. Fierer, N.; Leff, J.W.; Adams, B.J.; Nielsen, U.N.; Bates, S.T.; Lauber, C.L.; Owens, S.; Gilbert, J.A.; Wall, D.H.; Caporaso, J.G. Cross-biome metagenomic analyses of soil microbial communities and their functional attributes. Proc. Natl. Acad. Sci. USA 2012, 109, 21390–21395. [Google Scholar] [CrossRef]
  66. Manning, P. The impact of nitrogen enrichment on ecosystems and their services. In Soil Ecology and Ecosystem Services; Oxford University Press: Oxford, UK, 2012. [Google Scholar]
  67. Wardle, D.A. The influence of biotic interactions on soil biodiversity. Ecol. Lett. 2006, 9, 870–886. [Google Scholar] [CrossRef] [PubMed]
Diversity 15 00050 g001 550
Figure 1. Photograph of CSS habitat (A) and mustard habitat (B) at the Bernard Field Station and Voorhis Reserve, respectively. Soil was collected under Artemisia californica and mustards in the CSS and non-native mustard habitats at each site.
Figure 1. Photograph of CSS habitat (A) and mustard habitat (B) at the Bernard Field Station and Voorhis Reserve, respectively. Soil was collected under Artemisia californica and mustards in the CSS and non-native mustard habitats at each site.
Diversity 15 00050 g001
Diversity 15 00050 g002 550
Figure 2. Active and total bacterial and fungal abundances in native CSS (green) and invasive mustard habitats (yellow) at the three study sites: Robert J. Bernard Field Station (BFS), Bonelli Park (BON), and Voorhis Reserve (VOR). Sites with different capital letters indicate that sites differ in fungal or bacterial abundance following pairwise comparisons (α = 0.017).
Figure 2. Active and total bacterial and fungal abundances in native CSS (green) and invasive mustard habitats (yellow) at the three study sites: Robert J. Bernard Field Station (BFS), Bonelli Park (BON), and Voorhis Reserve (VOR). Sites with different capital letters indicate that sites differ in fungal or bacterial abundance following pairwise comparisons (α = 0.017).
Diversity 15 00050 g002
Diversity 15 00050 g003 550
Figure 3. Multidimensional scaling (MDS) plot displaying fungal assemblages at six soil collection locations. Data were analyzed at six plots for each soil origin (three underneath invasive mustard habitat, three underneath native CSS); 2D stress = 0.19.
Figure 3. Multidimensional scaling (MDS) plot displaying fungal assemblages at six soil collection locations. Data were analyzed at six plots for each soil origin (three underneath invasive mustard habitat, three underneath native CSS); 2D stress = 0.19.
Diversity 15 00050 g003
Table
Table 1. Soil properties (pH, percent soil organic matter, soil moisture, and sediment size) at three sites with adjacent mustard and CSS habitat in Pomona Valley, Southern California. † denotes that habitats differ in those soil properties, while superscript letters highlight significant pairwise differences (α = 0.017) found following a significant site x habitat interaction.
Table 1. Soil properties (pH, percent soil organic matter, soil moisture, and sediment size) at three sites with adjacent mustard and CSS habitat in Pomona Valley, Southern California. † denotes that habitats differ in those soil properties, while superscript letters highlight significant pairwise differences (α = 0.017) found following a significant site x habitat interaction.
Site Sediment Size
  HabitatpH †SOM (%)Soil Moisture (%) †Sand (%)Silt (%)Clay (%)
Bernard Field Station
  CSS5.2 ± 0.333.0 ± 0.650.4 ± 0.1381146
  Mustard6.1 ± 0.223.3 ± 0.990.4 ± 0.2578157
Bonelli Park
  CSS5.9 ± 0.4912 ± 3.54.2 ± 0.86452629
  Mustard6.6 ± 0.449 ± 1.12.4 ± 0.46781111
Voorhis Reserve
  CSS6.5 ± 0.535.0 ± 0.95 a1.5 ± 0.29721513
  Mustard6.5 ± 0.769 ± 1.99 b1.7 ± 0.63651818
Table
Table 2. Relative abundance of common and functionally important fungal taxa in CSS and mustard habitats at our three study sites. EMF refers to ectomycorrhizal fungi, and AMF to arbuscular mycorrhizal fungi. Statistical results (F and p values) are provided for our main test factors (habitat and site).
Table 2. Relative abundance of common and functionally important fungal taxa in CSS and mustard habitats at our three study sites. EMF refers to ectomycorrhizal fungi, and AMF to arbuscular mycorrhizal fungi. Statistical results (F and p values) are provided for our main test factors (habitat and site).
FunctionBernard Field StationBonelli ParkVoorhis ReserveHabitatSite
 TaxonCSSMustardCSSMustardCSSMustardF1pF2p
 Ascomycota80 ± 1150 ± 2460 ± 2140 ± 2360 ± 1870 ± 157.10.011.50.22
 Basidiomycota4 ± 3.230 ± 2910 ± 2720 ± 3110 ± 1310 ± 131.60.220.070.93
Plant Pathogens
 Pucciniomycotina0.3 ± 0.310.12 ± 0.0980.3 ± 0.390.1 ± 0.290.8 ± 0.610.2 ± 0.136.60.012.40.10
EMF
 Agaricales0.1 ± 0.1020 ± 3010 ± 1610 ± 320 ± 5.510 ± 142.80.110.120.89
 Boletales00.003 ± 0.00820.3 ± 0.560.02 ± 0.047001.30.282.00.04
 Cantharellales1 ± 3.37 ± 6.70.1 ± 0.212 ± 4.75 ± 8.30.9 ± 0.930.460.511.10.35
 Pezizales00.4 ± 0.370.1 ± 0.224 ± 6.00.01 ± 0.0161 ± 1.64.10.021.30.29
 Helotiales3 ± 6.01.1 ± 0.902 ± 2.60.5 ± 0.480.9 ± 0.731 ± 1.20.920.420.420.79
AMF
 Glomeromycota0.02 ± 0.0530.05 ± 0.0900000 ± 0.101.50.261.10.36
Table
Table 3. Germination in soil collected from native CSS and invasive mustard habitats in Pomona Valley, Southern California (June–July 2022). Species and categories with significant differences between soil origins (as determined by Chi-square goodness of fit test) are bolded.
Table 3. Germination in soil collected from native CSS and invasive mustard habitats in Pomona Valley, Southern California (June–July 2022). Species and categories with significant differences between soil origins (as determined by Chi-square goodness of fit test) are bolded.
Plant IdentificationBernard Field StationBonelli ParkVoorhis Reserve
CSSMustardCSSMustardCSSMustard
Plant Species Totals
Brassicaceaespp. 1121380160
Nicotiana glauca10600124
Non-native grasses (Poaceae spp.) 1000042
Melilotus officinalis1004000
Amsinckia intermedia1020000
Centaurea melitensis1000001
Marrubium vulgare1001000
Total invasive plants129880687
Pseudognaphalium californicum111231
Artemisia californica000111
Crassula connata010000
Plagiobothrys sp.010000
Total native plants131342
Solanacaea spp. 2000002
1 Confirmed invasive species, 2 unknown origin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wakefield, Z.R.; Cavalcanti, A.R.O.; Driessen, L.; Jaramillo, A.; Crane, E.J., III; Richetta, G.; Meyer, W.M., III. Effects of Mustard Invasions on Soil Microbial Abundances and Fungal Assemblages in Southern California. Diversity 2023, 15, 50. https://doi.org/10.3390/d15010050

AMA Style

Wakefield ZR, Cavalcanti ARO, Driessen L, Jaramillo A, Crane EJ III, Richetta G, Meyer WM III. Effects of Mustard Invasions on Soil Microbial Abundances and Fungal Assemblages in Southern California. Diversity. 2023; 15(1):50. https://doi.org/10.3390/d15010050

Chicago/Turabian Style

Wakefield, Zachary R., André R. O. Cavalcanti, Lucía Driessen, Ana Jaramillo, Edward J. Crane, III, Giuliano Richetta, and Wallace M. Meyer, III. 2023. "Effects of Mustard Invasions on Soil Microbial Abundances and Fungal Assemblages in Southern California" Diversity 15, no. 1: 50. https://doi.org/10.3390/d15010050

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop