Next Article in Journal
Biodiversity of Gelatinous Organisms in the Western Adriatic Sea and Identification of Their Echo Traces in Acoustic Data
Previous Article in Journal
An Integrative Taxonomic Revision of the Freshwater Atyid Shrimps (Crustacea: Decapoda: Caridea) of Micronesia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Metarhizium dianzhongense sp. nov. and New Record of M. bibionidarum (Clavicipitaceae, Hyocreales) Attacking Insects from China

1
Institute of Agriculture, Yunnan University, Kunming 650091, China
2
CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, China
3
Yunnan Key Laboratory for Fungal Diversity and Green Development, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, China
4
College of Life Science and Technology, Guangxi University, Nanning 530004, China
5
College of Ecology and Environment, Yunnan University, Kunming 650091, China
*
Authors to whom correspondence should be addressed.
Diversity 2024, 16(4), 201; https://doi.org/10.3390/d16040201
Submission received: 29 February 2024 / Revised: 20 March 2024 / Accepted: 21 March 2024 / Published: 27 March 2024

Abstract

The genus Metarhizium is one of the most significant entomopathogenic fungi with diverse morphological characteristics and host species. Species of Metarhizium have been widely used for pest control as an environmentally safe alternative to chemical pesticides. This study reports a new species of Metarhizium and a new record of M. bibionidarum from China. The taxonomic positions of the two species within Metarhizium were assessed by morphological and multi-gene phylogenetic data. This assessment confirmed that the new species M. dianzhongense on white grubs (Coleoptera) is a sister to M. ellipsoideum on adult leafhoppers (Hemiptera) and represents a distinctive fungus according to the morphological and phylogenetic evidence. The two species, M. dianzhongense and M. bibionidarum, were described and illustrated. Pathogenicity tests by M. bibionidarum and M. dianzhongense were performed on early instar larvae of the significant agricultural pest Spodoptera frugipera (Lepidoptera). The results demonstrated that both M. bibionidarum and M. dianzhongense exhibit significant insecticidal activity against larvae of S. frugipera, providing new fungal resources for the development of an eco-friendly biocontrol agent against this pest.

1. Introduction

Metarhizium is one of the most interesting genera of entomopathogenic fungi (EPF); it is known as “green muscardine fungus” because it mostly produces green conidia on its arthropod hosts. The genus was established by Sorokīn (1879) based on the type species M. anisopliae (Metschn.) Sorokīn attacking the wheat cockchafer Anisoplia austriaca (Coleoptera) from Russia. Tulloch [1] revised the genus and recognized only two species, M. anisopliae and M. flavoviride W. Gams & Rozsypal, along with two varieties, M. anisopliae var. anisopliae and M. anisopliae var. majus (J.R. Johnst.) M.C. Tulloch. Species of Metarhizium were historically described by morphological characteristics such as colony color, conidial structure, and sporulation patterns [2], which led to considerable debate regarding their taxonomic statuses.
The advancement of molecular systematics, especially multi-gene phylogenetic analyses that include rDNA gene fragments and functional protein genes, has revolutionized the taxonomy of Metarhizium. The genus Metacordyceps G.H. Sung et al. was erected to include Cordyceps spp. linked to anamorphic Metarhizium and Pochonia Bat. & O.M. Fonsa within the family Clavicipitaceae [3]. The recombination to Metacordyceps was made by adding several teleomorphic species, which accommodated 15 species and 1 variety [4]. Following the adoption of the “One Fungus One Name” standard, Kepler et al. [5] delimited the boundary of Metarhizium by combining the majority of species in Metacordyceps, Nomuraea Maubl., and Chamaeleomyces Sigler, recognizing 34 species. In recent years, numerous new taxa have been added to the genus Metarhizium and enriched its species diversity [6,7,8,9,10,11,12,13,14]. In the most complete taxonomic treatment of Metarhizium and its related genera, Mongkolsamrit et al. [11] reconstructed the phylogenetic framework of Clavicipitaceae focusing on the core Metarhizium clade and established six genera (Keithomyces Samson et al., Marquandomyces Samson et al., Papiliomyces Luangsa-ard et al., Purpureomyces Luangsa-ard et al., Sungia Luangsa-ard et al., and Yosiokobayasia Samson et al.) belonging to the core Metarhizium clade. To date, the genus Metarhizium accommodates 74 species, including 23 species in the M. anisopliae species complex and 13 species in the M. flavoviride species complex [11,14,15,16,17,18,19,20,21,22,23].
As an important and widespread group of EPF, Metarhizium has been used for pest control worldwide for approximately 140 years [24,25]. Various Metarhizium-based biocontrol products are available on the market and have been effectively implemented in managing a broad spectrum of pests worldwide [11,26]. Consequently, precise identifications for Metarhizium species and their host ranges are critical to the high-efficiency biocontrol strategy.
During surveys of EPF in southwestern China, we found a new species and a new record of Metarhizium attacking white grubs and March fly larvae, respectively. Collected specimens of the two species were identified by combining morphological and seven-gene (ITS, nrSSU, nrLSU, tef-1α, rpb1, rpb2, and 5′tef) phylogenetic analyses. The two species were described and illustrated. In addition, pathogenicity tests of the new species M. bibionidarum Nishi & Hiroki Sato and new record M. dianzhongense were performed on larvae of Spodoptera frugipera J. E. Smith.

2. Materials and Methods

2.1. Sample Collection and Isolation

Inst pathogenic specimens were meticulously collected in Yunnan, China, in 2022, with a keen examination of the forest understory, leaf litter, and the undersides of leaves for instances of EPF infection. Specimens were noted and photographed in the field, carefully placed in plastic boxes, and then transported to field stations or laboratories for detailed examination. The material was examined under an Olympus SZ60 microscope. Isolation from the material was conducted as described by Wang et al. [27] with modifications: the conidia from sporulating structures were touched by using a flame-sterilized inoculation needle and streaked on potato–dextrose agar (PDA: potato 200 g/L, dextrose 20 g/L, agar 20 g/L, in 1 L distilled water) plates. Purified strains were maintained in a culture room at 25 °C. Subculturing was performed on new PDA plates to ensure the development of pure colonies. Pure cultures were transplanted onto PDA slants and stored at 4 °C. Dried specimens were deposited in the Cryptogamic Herbarium of the Kunming Institute of Botany, Chinese Academy of Sciences (KUN-HKAS). Pure cultures were deposited in the Culture Collection of Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC).

2.2. Test Material

The initial bioassay experiments were conducted using the selected strains of M. bibionidarum (KUNCC 10806) and M. dianzhongense (KUNCC 10811), which were collected, isolated, and purified in this study. Concurrently, field surveys were conducted to collect insect samples of S. frugiperda in 2022. The 4th-instar larvae of S. frugiperda were bred using lab colonies of the pest noctuids. The test strains were cultured on PDA plates for 14 d at 25 °C under a light/dark condition (L/D = 14:10) and the humidity of 70%. To harvest fungal spores, a solution containing 0.1% Tween 80 was poured onto a culture plate, and the surface of the fungal colony was gently scraped to release the spores. The spore concentration was estimated using a hemocytometer and light microscope. For the bioassay, the spore suspensions were diluted to achieve a concentration of 1 × 108 spores/mL.

2.3. Morphological Observation

Specimens were photographed and examined in the laboratory using a Canon 750D camera and an Olympus SZ60 microscope. For descriptions of colony appearance, the isolated strains were cultured on PDA plates for 14 d at 25 °C under a light/dark condition (L/D = 14:10). The characteristics of colonies (size, texture, and color) were photographed with a Canon 750D camera. For morphological evaluation, microscope slide cultures were prepared by placing small amounts of mycelia on 5 mm diameter PDA medium blocks overlaid by a cover slip. The cultures were then incubated in a Petri dish at 25 °C with a small volume of sterile water. The asexual micro-morphological characteristics (hypha, conidiogenous structure, and conidia) were observed and examined under a light Olympus BX53 microscope.

2.4. DNA Extraction, PCR Amplification, and Sequencing

The genomic DNA of the two species was extracted using the modified CTAB method [27]. The extracted DNA used for PCR amplification was stored at −20 °C. Primer details used for amplifying seven genes (ITS, nrSSU, nrLSU, tef-1α, rpb1, rpb2, and 5′tef) in this study are provided in Table 1. Each 25 µL PCR reaction contained 12.5 µL of 2 × Taq PCR Master Mix (Tiangen Biotech Co., Ltd., Beijing, China), 9.5 µL of RNase-free water (Sangon Bio Co., Ltd., Shanghai, China), 1 µL of each forward and reverse primer (10 µmol/L), 1 µL of DNA template (500 ng/µL). PCR reactions were placed in a LongGene T20 multi-block thermal cycler (Hangzhou LongGene Scientific Instruments Co., Ltd., Hangzhou, China) under the following conditions: for ITS, (1) 3 min at 95 °C, (2) 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, (3) extension at 72 °C for 10 min and 14 °C soak; for tef-1α, (1) 3 min at 95 °C, (2) 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, (3) extension at 72 °C for 10 min and 14 °C soak; for rpb1, (1) 4 min at 95 °C, (2) 30 cycles of denaturation at 94 °C for 50 s, annealing at 52 °C for 50 s, and extension at 72 °C for 1 min, followed by (3) 8 cycles of denaturation at 94 °C for 50 s, annealing at 51 °C for 50 s, and extension at 72 °C for 1 min, (4) extension at 72 °C for 10 min and 14 °C soak; for rpb2, (1) 4 min at 95 °C, (2) 37 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1 min, (3) extension at 72 °C for 10 min and 14 °C soak; for nrLSU, (1) 4 min at 95 °C, (2) 30 cycles of denaturation at 95 °C for 1 min, annealing at 50 °C for 1 min, and extension at 72 °C for 2 min, (3) extension at 72 °C for 8 min and 14 °C soak; for nrSSU, (1) 2 min at 95 °C, (2) 35 cycles of denaturation at 94 °C for 1 min, annealing at 51 °C for 30 s, and extension at 72 °C for 1 min, (3) extension at 72 °C for 10 min and 14 °C soak; for 5′tef, (1) 3 min at 95 °C, (2) 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, (3) extension at 72 °C for 10 min and 14 °C soak. Standard DNA markers (Sangon Bio Co., Ltd., Shanghai, China) of known size and weight were used to quantify the PCR products. The PCR products were separated by electrophoresis in 1% agarose gels, purified using the Gel Band Purification Kit (Bio Teke Co., Ltd., Beijing, China), and then sent to Tsing ke Biotechnology Co., Ltd. for sequencing after the selection of impurity-free and distinct bands. The seven genes of two Metarhizium species generated in this study were submitted to GenBank (https://www.ncbi.nlm.nih.gov/genbank, accessed on 26 February 2024).

2.5. Phylogenetic Analyses

Based on molecular data from recent research in the genus Metarhizium, seven gene sequences (ITS, nrSSU, nrLSU, tef-1α, rpb1, rpb2, and 5′tef) were retrieved and downloaded from the GenBank database. Detailed information is provided in Table 2. Along with the sequencing results from this study, gene sequences for 76 taxonomic units were ultimately obtained. Sequences of seven genes were aligned using MEGA v. 7.0 [32,33]. After sequence alignments, the aligned sequences of seven genes were concatenated. Ambiguously aligned sites were manually eliminated, and gaps were treated as missing data. The sequences of Pochonia Bat. & O.M. Fonsa (P. boninensis Nonaka et al. JCM 18597 and P. chlamydosporia (Goddard) Zare & W. Gams CBS 101244) were selected as the outgroup. Under the Akaike Information Criterion (AIC), ModelFinder is used to select the most appropriate nucleotide substitution model for Bayesian inference (BI) and maximum-likelihood (ML) analyses. The BI analysis was conducted using MrBayes v. 3.2 [34], employing the GTR+G+I model. Four simultaneous Markov chains were run for 2,000,000 generations with a sub-sampling frequency every 100 generations. A burn-in of the first 25% of the total run was discarded. The ML analysis was conducted using IQ-TREE v. 2.1.3 [35] under the TNe+I+R3 model with 1000 ultrafast bootstrap [36]. Trees were visualized with Bayesian posterior probability (BI-PP) and maximum-likelihood bootstrap proportions (ML-BS) in FigTree v. 1.4.4 and edited with Adobe Illustrator CS6.0.

2.6. Pathogenicity Test

The test strain’s spore suspension with a concentration of 1 × 108 spores/mL was used to immerse the selected and consistent-sized healthy 4th-instar larvae of S. frugiperda for approximately 10 s. Subsequently, the larvae were removed and allowed to air dry. They were then placed in a controlled artificial climate chamber at 25 °C and a humidity level of 65% and were individually reared in plastic rearing containers measuring 3 cm in diameter and height, with corn seeds and leaves provided as their food source. The experiment was conducted with three repetitions, each consisting of 12 S. frugiperda larvae.
A 0.1% Tween-80 sterile water treatment was used as the blank control group. Infected and control samples were then reared under standard insect-rearing conditions (as mentioned above) for a duration of nine days. Deceased insects were promptly removed and placed in the moist culture room to confirm their infection. Mortality rates and adjusted mortality rates were calculated as follows. The mortality rate (%) was determined by the following formula: (number of deceased insects/total number of test insects) × 100%. The adjusted mortality rate (%) was calculated using the following formula: (mortality rate in treatment group—mortality rate in control group)/(1—mortality rate in control group) × 100%.

3. Results

3.1. Phylogenetic Analyses

The combined seven-gene dataset comprised 5581 base pairs (bp) after alignments (ITS 581 bp, nrSSU 968 bp, nrLSU 764 bp, tef-1α 871 bp, rpb1 738 bp, rpb2 919 bp, and 5′tef 740 bp). Phylogenetic trees from ML and BI analyses based on the combined seven-gene dataset of 78 taxa showed nearly congruent topologies (Figure 1). It was revealed that all Metarhizium species formed a monophyletic group with high support. The samples of M. bibionidarum collected in this study and described by Nishi et al. [20] both have the same hosts, the March fly larvae (Diptera: Bibionidae). Based on the seven-gene phylogeny, they clustered into a clade with credible bootstrap support (BI-PP = 1 and ML-BP = 100%). The new species M. dianzhongense was sister to M. ellipsoideum Luangsa-ard et al. in the M. cercopidarum complex. However, the three strains of M. dianzhongense (KUNCC 10809, KUNCC 10810, and KUNCC 10811) formed a single derived clade (BI-PP = 1 and ML-BP = 100%).

3.2. Taxonomy

Metarhizium bibionidarum Nishi & Hiroki Sato, Mycological Progress 16(10): 993 (2017) [20], Index Fungorum number: IF819797, Figure 2.
Description: Specimens were found on March fly larvae (Diptera: Bibionidae). The head and thorax of March fly larvae were covered with white mycelia and powdery conidia. The conidia were smooth-walled, yellowish-green to green, cylindrical to ellipsoid with semi-papillate apices, 2.5–3.5 × 5.5–7 μm. Colonies on PDA grew well, attaining a diameter of 27–29 mm in 7 d, and were white, fluffy, and cottony in appearance. Sporulation with peacock-green conidia produced on mycelia started at 7 d after inoculation, reverse white. Hyphae were smooth-walled, hyaline, branched, septate. Conidiophores arising from aerial mycelia were erect and smooth-walled. Phialides were smooth-walled, cylindrical or ellipsoidal, with papillate apices, 7.6–27.3 × 2–3.5 μm. Conidia were smooth-walled, cylindrical to ellipsoidal with semi-papillate apices, arranged in chains, 7.8–10.4 × 2–3 μm.
Host: March fly larvae (Bibionidae, Diptera).
Habitat: On the March fly larvae buried in soil or attached to fallen leaves.
Distribution: Known from France, Japan, and China.
Material examined: China. Yunnan Province: Kunming City, Heilongtan Park, alt. 2150 m, on a March fly larva, 5 September 2022, C.Y. Wei (HKAS 126221, KUNCC 10806); Ibid. 5 September 2022, C.Y. Wei (HKAS 126222, KUNCC 10807); Ibid. 5 September 2022, C.Y. Wei (HKAS 126223, KUNCC 10808).
Notes: Our newly collected three samples are phylogenetically clustered with Metarhizium bibionidarum including strain NBRC 112661 (ex-type, Japan) and CBS 648.67 (France) within the M. flavoviride complex with strong statistical support. M. bibionidarum is closely related to M. gaoligongense Z.H. Chen & L. Xu, M. nornnoi Luangsa-ard et al., and M. pemphigi (Driver & Milner) Kepler et al. The three samples parasitize March fly larvae and produce similar-sized cylindrical to ellipsoidal conidia on PDA. The morphological characteristics on other media lack a clear distinction. M. bibionidarum is known to parasitize Diptera and Coleoptera, in addition to being commonly found in soil [20].
Metarhizium dianzhongense C.Y. Wei, Zhu L. Yang & Y.B. Wang, sp. nov. Fungal Names number: FN571888; Figure 3.
Etymology: The epithet ‘dianzhong’ refers to central Yunnan Province in Chinese, where the holotype was collected.
Holotype: China. Yunnan Province, Chuxiong City, Sanjie Town, 100°69′233 E, 24°52′322 N, alt. 1880 m, on a white grub buried in soil, 5 September 2022, C.Y. Wei (HKAS 126224, holotype; KUNCC 10811, ex-holotype culture). GenBank accession Nos.: ITS = PP256142, nrLSU = PP256150, tef-1α = PP328483, rpb1 = PP294692, rpb2 = PP314010.
Description: Specimens were found on larvae of Scarabaeidae (Coleoptera). The insect body curled up, stiffened, and formed sclerotia. Colonies on PDA attained a diameter of 23–25 mm in 14 d, with mycelia closely appressed to the agar surface, dense, flat. Margins were initially pale yellow to white, white turning to parrot-green with powdery conidia, becoming raised at the center of colonies. Sporulation started 3 d after inoculation, reverse pale yellow. Hyphae were smooth-walled. Conidiophores arising from aerial mycelia were erect, smooth-walled, cylindrical, 7.8–10.4 × 2–3 μm. Phialides were smooth-walled, cylindrical or ellipsoidal with semi-papillate apices, 4–7.5 × 1–3 μm. Conidia were smooth-walled, parrot-green, ellipsoidal or cylindrical with rounded apices, arranged in chains, 7–9 × 2–3 μm.
Host: White grubs, larvae of Scarabaeidae (Coleoptera).
Habitat: On the larvae of Scarabaeidae buried in soil from farmland.
Distribution: Known from Chuxiong City, Yunnan Province, China.
Other material examined: China. Yunnan Province, Chuxiong City, Sanjie Town, 100°53′346 E, 23°58′465 N, alt. 1873 m, on a white grub buried in soil, 13 November 2021, C.Y. Wei (HKAS 126224; KUNCC 10809); Ibid. 13 November 2021, C.Y. Wei (HKAS 126225, KUNCC 10810).
Notes: Phylogenetically, M. dianzhongense is sister to M. ellipsoideum with strong statistical support, forming a separate clade from other Metarhizium species in the M. cercopidarum complex. It is similar to M. ellipsoideum, M. candelabrum, M. cercopidarum, and M. huainamdangense due to the cylindrical and parrot-green conidia with rounded apices [11]. However, M. dianzhongense (14 d, 24 mm) grows faster than M. ellipsoideum (14 d, 14–15 mm), M. candelabrum (14 d, 15 mm), M. cercopidarum (14 d, 15 mm), and M. huainamdangense (14 d, 15 mm) on PDA. The distinctiveness of M. dianzhongense is indicated by its larger conidial size (7–9 × 2–3 μm) compared with M. ellipsoideum (5–7 × 1.5–2 μm) and M. cercopidarum (6–8 × 2 μm). In their natural habitats, M. ellipsoideum, M. candelabrum, M. cercopidarum, and M. huainamdangense parasitize insects of leafhoppers (Hemiptera). However, M. dianzhongense specifically targets larvae of Scarabaeidae (Coleoptera) in farmland and has been observed to infect larvae of S. frugiperda (Lepidoptera) during controlled experiments.
Additionally, there exist significant distinctions between M. dianzhongense and other unmentioned Metarhizium species in this study, namely M. cicadinum (Höhn.) Petch, M. dendrolimatilis Z.Q. Liang et al., M. lepidopterorum W.H. Chen et al., M. lymantriidae Z.H. Chen & L. Xu, M. putuoense Yi Li et al., and M. rongjiangense W.H. Chen et al. [11,15,42,43,44,45]. The six species are mainly parasitic on Hemiptera (M. cicadinum) and Lepidoptera (M. dendrolimatilis, M. lepidopterorum, M. lymantriidae, M. putuoense, and M. rongjiangense) hosts, which distinguishes them from M. dianzhongense (Coleoptera). The morphological characteristics of M. dianzhongense significantly differ from those of the six species in terms of colonies, conidiogenous structures, and conidia. Phylogenetically, M. dianzhongense, belonging to the M. cercopidarum complex clade, is distinct from M. cicadinum (the M. anisopliae complex), M. putuoense (the M. purpureum complex), and M. dendrolimatilis and M. lymantriidae (the M. rileyi complex) [43]. Particularly, M. lepidopterorum and M. rongjiangense now belong to the genus Marquandomyces, which was previously described as Metarhizium [44].

3.3. Pathogenicity to Spodoptera frugipera

After nine days of infection, the M. bibionidarum strain KUNCC 10806 exhibited the highest overall mortality in instar larvae of S. frugiperda, followed by the M. dianzhongense strain KUNCC 108011. The findings showed that mortality in S. frugiperda larvae caterpillars treated with KUNCC 10806 and KUNCC 10811 predominantly occurred within the initial three days after infection. The mortality rates of 94.44% and 86.11% were observed in S. frugiperda larvae caterpillars nine days after infection with KUNCC 10806 and KUNCC 10811, respectively, resulting in induced corrected mortality rates of 93.97% and 84.85%.

4. Discussion

The current species delimitation of fungal complex groups emphasizes the necessity of employing multi-gene phylogeny, as relying solely on morphological characteristics is insufficient for accurate species identification [3,5,11,46]. In this study, two Metarhizium species were identified by combining morphological and seven-gene phylogenetic evidence. The new record of M. bibionidarum infecting March fly larvae and belonging to the M. flavoviride complex is closely related to M. gaoligongense, M. nornnoi, and M. pemphigi. The taxonomic position of the new species M. dianzhongense infecting larvae of Scarabaeidae was determined based on phylogenetic analyses. Metarhizium dianzhongense is clustered in the M. cercopidarum complex and is clearly distinguished from its related species M. ellipsoideum.
In the M. flavoviride complex, thirteen species have been recognized, namely M. argentinense A.C. Gutierrez et al., M. bibionidarum, M. biotecense Luangsa-ard et al., M. blattodeae C. Montalva et al., M. culicidarum Luangsa-ard et al., M. flavoviride, M. frigidum J.F. Bisch. & S.A. Rehner, M. fusoideum Luangsa-ard et al., M. gaoligongense, M. koreanum Kepler et al., M. minus (Rombach, Humber & D.W. Roberts) Kepler et al., M. nornnoi Luangsa-ard et al., and M. pemphigi. The asexual states of all species are naturally observed, while no instances of sexual states have been documented. Some species (M. bibionidarum, M. flavoviride, and M. pemphigi) appear to exhibit a worldwide distribution, while others (M. minus, M. biotecense, M. culicidarum, M. fusoideum, and M. nornnoi) have only been reported in tropical regions [2,3,5,8,11,17,20,22,37]. The M. cercopidarum complex comprises six recognized species, including M. album Petch, M. brasiliense Kepler et al., M. candelabrum Luangsa-ard et al., M. cercopidarum, M. dianzhongense, M. ellipsoideum, and M. huainamdangense Luangsa-ard et al. All species belonging to this group have been reported in tropical and subtropical regions, especially Thailand and China [5,11]. Some species (M. album, M. brasiliense, M. candelabrum, M. cercopidarum, M. ellipsoideum, and M. huainamdangense) parasitize insects of Hemiptera, while the new species M. dianzhongense parasitizes the larvae of Coleoptera [3,5,11,16]. These species, particularly, exhibit a candelabrum-like arrangement of cylindrical phialides, forming a densely packed hymenium [11].
Previous studies have demonstrated that M. anisopliae, M. favoviride, M. majus (J.R. Johnst.) J.F. Bisch. et al., M. rileyi (Farl.) Kepler et al., and Beauveria bassiana (Bals. -Criv.) Vuill. exhibit significant insecticidal activity against various insect pests [23,47,48,49]. M. favoviride is an effective microbial insecticidal against S. litura, with the fungus significantly impairing the immune response of the insect. The larval mortality rate reached 80% when exposed to treatment concentrations of 1 × 109 conidia/mL [50]. Reports have revealed the detection of a significant number of S. frugiperda larvae infected by M. rileyi in various maize-growing regions, particularly in countries such as Mexico and Brazi [49,51]. In laboratory conditions, Perumal et al. [23] observed that M. majus exhibited significant insecticidal activity against S. frugiperda larvae within nine days. The mortality rate of Colorado potato beetle adults caused by discovered native strains reached up to 100% when beetles were treated with conidia containing a concentration of 1 × 107 spores/mL [52]. Our findings demonstrate that the strains of M. bibionidarum and M. dianzhongense, which were isolated from naturally infested larvae of Bibionidae and Scarabaeidae, exhibited significant virulence against S. frugiperda larvae. These results suggest that these two species could serve as viable alternatives to broad-spectrum chemical insecticidal treatment.

Author Contributions

Conceptualization, S.-K.S. and Z.-L.Y.; supervision and validation, Q.F.; software and investigation, L.-Y.X.; methodology, formal analysis, and resources, C.-Y.W.; data management, M.T.; writing—original draft preparation, C.-Y.W. and M.T.; writing—review and editing, Y.-B.W. and C.-Y.W.; project administration and funding acquisition, Y.-B.W. and G.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Science and Technology Planning Project of Yunnan Province (202207AB110016, 202401AS070030); the High Level Talent Introduction Plan, Kunming Institute of Botany, CAS (E16N61); and the Innovation Project of Guangxi Graduate Education (YCBZ2022028).

Institutional Review Board Statement

This article does not contain any studies with human participants or animals performed by any of the authors.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding authors on request. Moreover, sequences were deposited in GenBank http://www.ncbi.nlm.nih.gov/ (accessed on 20 August 2023) under the accession numbers mentioned in the text.

Acknowledgments

The authors gratefully acknowledge Baozheng Chen and Xinling Lai. of the Yunnan Agricultural University for their invaluable assistance and support during the sample collection process; and thanks Hui Xu. of the Yunnan University for technical support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Tulloch, M. The genus metarhizium. Trans. Br. Mycol. Soc. 1976, 66, 407–411. [Google Scholar] [CrossRef]
  2. Chen, Z.; Yang, X.; Sun, N.; Xu, L.; Zheng, Y.; Yang, Y. Species diversity and vertical distribution characteristics of Metarhizium in Gaoligong Mountains, southwestern China. Biodivers. Sci. 2018, 26, 1308. [Google Scholar] [CrossRef][Green Version]
  3. Sung, G.H.; Hywel-Jones, N.L.; Sung, J.M.; Luangsa-Ard, J.J.; Shrestha, B.; Spatafora, J.W. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 2007, 57, 5–59. [Google Scholar] [CrossRef] [PubMed]
  4. Kepler, R.; Sung, G.-H.; Ban, S.; Nakagiri, A.; Chen, M.-J.; Huang, B.; Li, Z.Z.; Spatafora, J. New teleomorph combinations in the entomopathogenic genus Metacordyceps. Mycologia 2012, 104, 182–197. [Google Scholar] [CrossRef] [PubMed]
  5. Kepler, R.M.; Humber, R.A.; Bischoff, J.F.; Rehner, S.A. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia 2014, 106, 811–829. [Google Scholar] [CrossRef] [PubMed]
  6. Sharma, S.K.; Gautam, N. Metacordyceps dhauladharensis sp. nov., a new entomopathogenic fungus from India. Turk. J. Bot. 2015, 39, 520–526. [Google Scholar] [CrossRef]
  7. Chu, H.L.; Chen, W.H.; Wen, T.C.; Liang, Z.Q.; Zheng, F.C.; Liang, J.D.; Han, Y.F. Delimitation of a novel member of genus Metarhizium (Clavicipitaceae) by phylogenetic and network analysis. Phytotaxa 2016, 288, 51–60. [Google Scholar] [CrossRef][Green Version]
  8. Luangsa-Ard, J.J.; Mongkolsamrit, S.; Thanakitpipattana, D.; Khonsanit, A.; Tasanathai, K.; Noisripoom, W.; Humber, R.A. Clavicipitaceous entomopathogens: New species in Metarhizium and a new genus Nigelia. Mycol. Prog. 2017, 16, 369–391. [Google Scholar] [CrossRef]
  9. Lopes, R.B.; Souza, D.A.; Rocha, L.F.; Montalva, C.; Luz, C.; Humber, R.A.; Faria, M. Metarhizium alvesii sp. nov.: A new member of the Metarhizium anisopliae species complex. J. Invertebr. Pathol. 2018, 151, 165–168. [Google Scholar] [CrossRef]
  10. Luz, C.; Rocha, L.F.; Montalva, C.; Souza, D.A.; Botelho, A.B.R.; Lopes, R.B.; Faria, M.; Júnior, I.D. Metarhizium humberi sp. nov. (Hypocreales: Clavicipitaceae), a new member of the PARB clade in the Metarhizium anisopliae complex from Latin America. J. Invertebr. Pathol. 2019, 166, 107216. [Google Scholar] [CrossRef] [PubMed]
  11. Mongkolsamrit, S.; Khonsanit, A.; Thanakitpipattana, D.; Tasanathai, K.; Noisripoom, W.; Lamlertthon, S.; Himaman, W.; Houbraken, J.; Samson, R.; Luangsa-Ard, J. Revisiting Metarhizium and the description of new species from Thailand. Stud. Mycol. 2020, 95, 171–251. [Google Scholar] [CrossRef]
  12. Thanakitpipattana, D.; Tasanathai, K.; Mongkolsamrit, S.; Khonsanit, A.; Lamlertthon, S.; Luangsa-Ard, J. Fungal pathogens occurring on Orthopterida in Thailand. Persoonia-Mol. Phylogeny Evol. Fungi 2020, 44, 140–160. [Google Scholar] [CrossRef]
  13. Yamamoto, K.; Ohmae, M.; Orihara, T. Metarhizium brachyspermum sp. nov. (Clavicipitaceae), a new species parasitic on Elateridae from Japan. Mycoscience 2020, 61, 37–42. [Google Scholar] [CrossRef]
  14. Chen, M.-J.; Lin, Y.; Wang, T.; Zhang, S.-L.; Huang, B. Metarhizium macrosemiae sp. nov. and the anamorph of M. guniujiangense on adult cicada from Guniujiang Nature Preserve, southeastern China. Phytotaxa 2022, 575, 68–78. [Google Scholar] [CrossRef]
  15. Chen, Z.H.; Dai, Y.D.; Chen, K.; Zhang, Y.F.; Xu, L.; Wang, Y.B. Papiliomyces puniceum and Metarhizium lymantriidae: Two new species from the Gaoligong Mountains in southwestern China. Phytotaxa 2023, 594, 53–63. [Google Scholar] [CrossRef]
  16. Driver, F.; Milner, R.J.; Trueman, J.W. A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycol. Res. 2000, 104, 134–150. [Google Scholar] [CrossRef]
  17. Bischoff, J.F.; Rehner, S.A.; Humber, R.A. Metarhizium frigidum sp. nov.: A cryptic species of M. anisopliae and a member of the M. flavoviride complex. Mycologia 2006, 98, 737–745. [Google Scholar] [CrossRef]
  18. Bischoff, J.F.; Rehner, S.A.; Humber, R.A. A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia 2009, 101, 512–530. [Google Scholar] [CrossRef]
  19. Nishi, O.; Iiyama, K.; Yasunaga-Aoki, C.; Shimizu, S. Phylogenetic status and pathogenicity of Metarhizium majus isolated from a fruit beetle larva in Japan. Mycol. Prog. 2015, 14, 58. [Google Scholar] [CrossRef]
  20. Nishi, O.; Shimizu, S.; Sato, H. Metarhizium bibionidarum and M. purpureogenum: New species from Japan. Mycol. Prog. 2017, 16, 987–998. [Google Scholar] [CrossRef]
  21. Chen, Z.; Xu, L.; Yang, X.; Zhang, Y.; Yang, Y. Metarhizium baoshanense sp. nov., a new entomopathogen fungus from southwestern China. Pak. J. Zool. 2018, 50, 1739–1746. [Google Scholar] [CrossRef]
  22. Chen, Z.H.; Zhang, Y.G.; Yang, X.N.; Chen, K.; Liu, Q.; Xu, L. A new fungus Metarhizium gaoligongense from China. Int. J. Agric. Biol. 2018, 20, 2271–2276. [Google Scholar] [CrossRef]
  23. Perumal, V.; Kannan, S.; Alford, L.; Pittarate, S.; Geedi, R.; Elangovan, D.; Marimuthu, R.; Krutmuang, P. First report on the enzymatic and immune response of Metarhizium majus bag formulated conidia against Spodoptera frugiperda: An ecofriendly microbial insecticide. Front. Microbiol. 2023, 14, 1104079. [Google Scholar] [CrossRef] [PubMed]
  24. Nishi, O.; Iiyama, K.; Yasunaga-Aoki, C.; Shimizu, S. Comparison of the germination rates of Metarhizium spp. conidia from Japan at high and low temperatures. Lett. Appl. Microbiol. 2013, 57, 554–560. [Google Scholar] [CrossRef] [PubMed]
  25. González-Hernández, G.A.; Padilla-Guerrero, I.E.; Martínez-Vázquez, A.; Torres-Guzmán, J.C. Virulence Factors of the Entomopathogenic Genus Metarhizium. Curr. Protein Pept. Sci. 2020, 21, 324–330. [Google Scholar] [CrossRef] [PubMed]
  26. Kumar, K.K.; Sridhar, J.; Murali-Baskaran, R.K.; Senthil-Nathan, S.; Kaushal, P.; Dara, S.K.; Arthurs, S. Microbial biopesticides for insect pest management in India: Current status and future prospects. J. Invertebr. Pathol. 2019, 165, 74–81. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, Y.B.; Wang, Y.; Fan, Q.; Duan, D.E.; Zhang, G.D.; Dai, R.Q.; Dai, Y.D.; Zeng, W.B.; Chen, Z.H.; Li, D.D. Multigene phylogeny of the family Cordycipitaceae (Hypocreales): New taxa and the new systematic position of the Chinese cordycipitoid fungus Paecilomyces hepiali. Fungal Divers. 2020, 103, 1–46. [Google Scholar] [CrossRef]
  28. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics; PCR Protoc: A Guide Methods; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
  29. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [PubMed]
  30. Rehner, S.A.; Samuels, G.J. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycol. Res. 1994, 98, 625–634. [Google Scholar] [CrossRef]
  31. Wang, Y.B.; Yu, H.; Dai, Y.D.; Wu, C.K.; Zeng, W.B.; Yuan, F.; Liang, Z.Q. Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China. Mycol. Prog. 2015, 14, 70. [Google Scholar] [CrossRef]
  32. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
  33. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  34. Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  35. Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
  36. Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
  37. Gutierrez, A.C.; Leclerque, A.; Manfrino, R.G.; Luz, C.; Ferrari, W.A.; Barneche, J.; García, J.J.; Lastra, C.C.L. Natural occurrence in Argentina of a new fungal pathogen of cockroaches, Metarhizium argentinense sp. nov. Fungal Biol. 2019, 123, 364–372. [Google Scholar] [CrossRef] [PubMed]
  38. Montalva, C.; Collier, K.; Rocha, L.F.N.; Inglis, P.W.; Lopes, R.B.; Luz, C.; Humber, R.A. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex. Fungal Biol. 2016, 120, 655–665. [Google Scholar] [CrossRef] [PubMed]
  39. Liu, Z.Y.; Liang, Z.; Whalley, A.; Yao, Y.; Liu, A. Cordyceps brittlebankisoides, a new pathogen of grubs and its anamorph, Metarhizium anisopliae var. majus. J. Invertebr. Pathol. 2001, 78, 178–182. [Google Scholar] [CrossRef]
  40. Sigler, L.; Gibas, C.F.C.; Kokotovic, B.; Bertelsen, M.F. Disseminated mycosis in veiled chameleons (Chamaeleo calyptratus) caused by Chamaeleomyces granulomatis, a new fungus related to Paecilomyces viridis. J. Clin. Microbiol. 2010, 48, 3182–3192. [Google Scholar] [CrossRef] [PubMed]
  41. Nonaka, K.; Ōmura, S.; Masuma, R.; Kaifuchi, S.; Masuma, R. Three new Pochonia taxa (Clavicipitaceae) from soils in Japan. Mycologia 2013, 105, 1202–1218. [Google Scholar] [CrossRef] [PubMed]
  42. Petch, T. Notes on entomogenous fungi. Trans. Br. Mycol. Soc. 1931, 16, 55–75. [Google Scholar] [CrossRef]
  43. Chen, W.; Han, Y.; Liang, J.; Liang, Z.; Jin, D. Metarhizium dendrolimatilis, a novel Metarhizium species parasitic on Dendrolimus sp larvae. Mycosphere 2017, 8, 31–37. [Google Scholar] [CrossRef]
  44. Chen, W.-H.; Han, Y.-F.; Liang, J.-D.; Liang, Z.-Q. Morphological and phylogenetic characterization of novel Metarhizium species in Guizhou, China. Phytotaxa 2019, 419, 189–196. [Google Scholar] [CrossRef]
  45. Li, Y.; Zhao, X.-C.; Wu, L.-X.; Wang, Y.; Xu, A.; Lin, W.-F. Blackwellomyces kaihuaensis and Metarhizium putuoense (Hypocreales), Two New Entomogenous Fungi from Subtropical Forests in Zhejiang Province, Eastern China. Forests 2023, 14, 2333. [Google Scholar] [CrossRef]
  46. Kepler, R.M.; Sung, G.H.; Harada, Y.; Tanaka, K.; Tanaka, E.; Hosoya, T.; Bischoff, J.F.; Spatafora, J.W. Host jumping onto close relatives and across kingdoms by Tyrannicordyceps (Clavicipitaceae) gen. nov. and Ustilaginoidea (Clavicipitaceae). Am. J. Bot. 2012, 99, 552–561. [Google Scholar] [CrossRef] [PubMed]
  47. Borisade, O.; Magan, N. Growth and sporulation of entomopathogenic Beauveria bassiana, Metarhizium anisopliae, Isaria farinosa and Isaria fumosorosea strains in relation to water activity and temperature interactions. Biocontrol Sci. Technol. 2014, 24, 999–1011. [Google Scholar] [CrossRef]
  48. Li, M.; Li, S.; Xu, A.; Lin, H.; Chen, D.; Wang, H. Selection of Beauveria isolates pathogenic to adults of Nilaparvata lugens. J. Insect Sci. 2014, 14, 32. [Google Scholar] [CrossRef] [PubMed][Green Version]
  49. Ruiz-Nájera, R.E.; Ruiz-Estudillo, R.A.; Sánchez-Yáñez, J.M.; Molina-Ochoa, J.; Skoda, S.R.; Coutiño-Ruiz, R.; Pinto-Ruiz, R.; Guevara-Hernández, F.; Foster, J.E. Occurrence of entomopathogenic fungi and parasitic nematodes on Spodoptera frugiperda (Lepidoptera: Noctuidae) larvae collected in central Chiapas, México. Fla. Entomol. 2013, 96, 498–503. [Google Scholar] [CrossRef]
  50. Vivekanandhan, P.; Swathy, K.; Alford, L.; Pittarate, S.; Subala, S.P.R.R.; Mekchay, S.; Elangovan, D.; Krutmuang, P. Toxicity of Metarhizium flavoviride conidia virulence against Spodoptera litura (Lepidoptera: Noctuidae) and its impact on physiological and biochemical activities. Sci. Rep. 2022, 12, 16775. [Google Scholar] [CrossRef] [PubMed]
  51. Ordóñez-García, M.; Bustillos-Rodríguez, J.C.; Loya-Márquez, J.; Ríos-Velasco, C.; Jacobo-Cuellar, J.L. Parasitoides de Spodoptera frugiperda (JE Smith)(Lepidoptera: Noctuidae) en Chihuahua, México. Métodos En Ecol. Y Sist. 2015, 10, 67–72. [Google Scholar]
  52. Zemek, R.; Konopická, J.; Jozová, E.; Skoková Habuštová, O. Virulence of Beauveria bassiana strains isolated from cadavers of Colorado potato beetle, Leptinotarsa decemlineata. Insects 2021, 12, 1077. [Google Scholar] [CrossRef]
Figure 1. Phylogenetic placements of Metarhizium dianzhongense and Metarhizium bibionidarum in the genus Metarhizium inferred from BI and ML analyses based on multi-gene dataset (ITS, nrSSU, nrLSU, tef-1α, rpb1, rpb2, and 5′tef). Values at the nodes before and after the backslash are BI posterior probabilities (BI-PP > 0.70) and ML bootstrap proportions (ML-BP > 70%), respectively.
Figure 1. Phylogenetic placements of Metarhizium dianzhongense and Metarhizium bibionidarum in the genus Metarhizium inferred from BI and ML analyses based on multi-gene dataset (ITS, nrSSU, nrLSU, tef-1α, rpb1, rpb2, and 5′tef). Values at the nodes before and after the backslash are BI posterior probabilities (BI-PP > 0.70) and ML bootstrap proportions (ML-BP > 70%), respectively.
Diversity 16 00201 g001
Figure 2. Metarhizium bibionidarum. (AC) Larvae of March fly infected by M. bibionidarum; (D,E) 4th-instar larvae of S. frugiperda killed by M. bibionidarum; (FH) colonies on PDA; (IL) conidiophores and phialides on PDA; (M) conidia on PDA; (N) conidia on insect host. Scale bars: (A) = 5 mm, (B,C) = 2 mm, (D,E) =5 mm, (F,G) = 2 cm, (H) = 5 mm, (I) = 20 µm, (JN) = 10 µm.
Figure 2. Metarhizium bibionidarum. (AC) Larvae of March fly infected by M. bibionidarum; (D,E) 4th-instar larvae of S. frugiperda killed by M. bibionidarum; (FH) colonies on PDA; (IL) conidiophores and phialides on PDA; (M) conidia on PDA; (N) conidia on insect host. Scale bars: (A) = 5 mm, (B,C) = 2 mm, (D,E) =5 mm, (F,G) = 2 cm, (H) = 5 mm, (I) = 20 µm, (JN) = 10 µm.
Diversity 16 00201 g002
Figure 3. Metarhizium dianzhongense. (A) White grub infected by M. dianzhongense; (BD) colonies on PDA; (E,F) 4th-instar larvae of S. frugiperda killed by M. dianzhongense; (GK) conidiophores and phialides on PDA; (L,M) conidia on PDA. Scale bars: (A) = 1 cm, (B,C) = 2 cm, (DF) = 5 mm, (GM) = 10 µm.
Figure 3. Metarhizium dianzhongense. (A) White grub infected by M. dianzhongense; (BD) colonies on PDA; (E,F) 4th-instar larvae of S. frugiperda killed by M. dianzhongense; (GK) conidiophores and phialides on PDA; (L,M) conidia on PDA. Scale bars: (A) = 1 cm, (B,C) = 2 cm, (DF) = 5 mm, (GM) = 10 µm.
Diversity 16 00201 g003
Table 1. Sequences of primers used in this study.
Table 1. Sequences of primers used in this study.
Molecular MarkerPrimer NamePrimer Sequence (5′–3′)Reference
ITSITS4TCCTCCGCTTATTGATATGC[28]
ITS5GGAAGTAAAAGTCGTAACAAGG[28]
tef-1αEF1α-EFGCTCCYGGHCAYCGTGAYTTYAT[17,18]
EF1α-ERATGACACCRACRGCRACRGTYTG[3]
rpb1RPB1-5′FCAYCCWGGYTTYATCAAGAA[17,18]
RPB1-5′RCCNGCDATNTCRTTRTCCATRTA[3]
rpb2RPB2-5′FCCCATRGCTTGTYYRCCCAT[17]
RPB2-5′RGAYGAYMGWGATCAYTTYGG[3]
nrLSULR5ATCCTGAGGGAAACTTC[29]
LRORGTACCCGCTGAACTTAAGC[30]
nrSSUnrSSU-CoFTCTCAAAGATTAAGCCATGC[31]
nrSSU-CoRTCACCAACGGAGACCTTG[31]
5′tefEF1α-IFATGGGTAAGGASGAMAAGACThis study
EF1α-IRGGARGTACCAGTRATCATGTTThis study
Table 2. Voucher information and GenBank accession numbers of sequences used in this study.
Table 2. Voucher information and GenBank accession numbers of sequences used in this study.
SpeciesVoucher
Information
GenBank Accession NumberReference
SSULSUtefrpb1rpb2ITS5′tef
Metarhizium acridumARSEF 7486TEU248845EU248897EU248925HQ331458EU248845[18]
M. acridumARSEF 324EU248844EU248896EU248924HM055449EU248844[18]
M. albumARSEF 2082DQ522560DQ518775DQ522352DQ522398DQ522452AY375446[3]
M. albumARSEF 2179KJ398807KJ398618HM055452[4]
M. alvesiiCG 1123TKY007614KY007612KY007613KC520541[9]
M. anisopliaeARSEF 7487DQ463996DQ468355DQ468370MH604974DQ463996[18]
M. anisopliaeCBS 130.71TMT078868MT078853MT078845MT078861MT078918MT078884MT078928[11]
M. argentinenseCEP 424TMF966624MF966625MF966626[37]
M. argentinenseCEP 414MF784813[37]
M. atrovirensTNM-F 10184JF415950JF415966JN049884JN049882[4]
M. baoshanenseBUM 63.4KY264178KY264175KY264170KY264181KY264184KY264173[21]
M. baoshanenseCCTCC M 2016588KY087812KY087816KY087820KY087824KY087826KY087808[22]
M. baoshanenseCCTCC M 2016589TKY264177KY264174KY264169KY264180KY264183KY264172[21]
M. bibionidarumCBS 64867LC126075LC125907LC125923AB807450[20]
M. bibionidarumNBRC 112661TLC126076LC125908LC125924LC187676[20]
M. bibionidarumHkd35-2LC126077LC125912LC125925AB807804[20]
M. bibionidarumKUNCC 10806PP256146PP256148PP328481PP294690PP314008PP256140PP413396This study
M. bibionidarumKUNCC 10807PP256149PP328482PP294691PP314009PP256141PP413397This study
M. bibionidarumKUNCC 10808PP256145PP256147PP328480PP294689PP314007PP256139PP413395This study
M. biotecenseBCC 51812TMN781937MN781838MN781693MN781745MN781792MN781878[11]
M. biotecenseBCC 51813MN781938MN781839MN781694MN781746MN781793MN781879[11]
M. blattodeaeARSEF 12850TKU182917KU182918KU182916KU182915[38]
M. blattodeaeMY 00896HQ165657HQ165719HQ165678HQ165739HQ165638HQ165697[8]
M. brachyspermumCM 1TLC469749LC469751LC469747LC469752[13]
M. brasilienseARSEF 2948TKJ398809KJ398620[5]
M. brittlebankisoidesHn 1AB778556AB778555AB778554[19]
M. brittlebankisoidesG 97025AJ309332[39]
M. brunneumARSEF 2107TEU248855EU248907EU248935KC178691EU248855[18]
M. brunneumCBS 316.51MT078875MT078860MT078852MT078888MT078927[11]
M. campsosterniBUM 10MH143832MH143815MH143849MH143864MH143879MH143798[2]
M. candelabrumBCC 29224TMN781952MN781853MN781708MN781755MN781804MN781881[11]
M. cercopidarumBCC 31660TMN781953MN781709MN781756MN781805MN781880[11]
M. chaiyaphumenseBCC 28241MN781932MN781831MN781684MN781740MN781784MN781884[11]
M. chaiyaphumenseBCC 78198TKX369596KX369593KX369592KX369594KX369595MT078881[8]
M. cicadaeBCC 48696MN781948MN781848MN781703MN781800MN781885[11]
M. cicadaeBCC 48881TMN781949MN781849MN781704MN781752[11]
M. clavatumBCC 84543TMN781834MN781689MN781741MN781789MN781886MT078929[11]
M. clavatumBCC 84558MN781835MN781690MN781742[11]
M. culicidarumBCC 2673MN781950MN781851MN781706MN781753MN781802MN781887[11]
M. culicidarumBCC 7600TMN781951MN781852MN781707MN781754MN781803MN781889[11]
M. culicidarumBCC 7625MN781850MN781705MN781801MN781888[11]
M. cylindrosporumCBS 256.90TMH873892KJ398783KJ398594KJ398691MH862209[5]
M. cylindrosporumRCEF 3632JF415964JF415987JF416022JN049872[4]
M. cylindrosporumTNS-F 16371JF415963JF415986JF416027JN049902[4]
M. dianzhongenseKUNCC 10809PP256151PP328484PP294693PP314011PP256143-This study
M. dianzhongenseKUNCC 10810PP256152PP328485PP294694PP314012PP256144-This study
M. dianzhongenseKUNCC 10811PP256150PP328483PP294692PP314010PP256142-This study
M. eburneumBCC 79252TMN781829MN781682MN781736MN781914[11]
M. eburneumBCC 79267MN781826MN781735MN781915[11]
M. ellipsoideumBCC 12847MN781959MN781860MN781715MN781761MN781810MN781925[11]
M. ellipsoideumBCC 49285TMN781957MN781858MN781713MN781759MN781808MT078876[11]
M. ellipsoideumBCC 53509MN781958MN781859MN781714MN781760MN781809MT078877[11]
M. flavovirideCBS 700.74MT078870MT078855MT078847MT078863MT078920MT078925[11]
M. flavovirideARSEF 2133NR131992DQ463988[17]
M. flavovirideCBS 125.65MT078869MT078854MT078846MT078862MT078919MT078885MT078926[11]
M. flavovirideCBS 218.56TKJ398787KJ398598[5]
M. flavumBCC 90870TMN781965MN781874MN781731MN781776MN781822[11]
M. flavumBCC 90874MN781966MN781875MN781732MN781777MN781823[11]
M. frigidumARSEF 4124TDQ464002DQ468361DQ468376NR132012[17]
M. fusoideumBCC 28246TMN781944MN781844MN781699MN781749MN781796MN781893[11]
M. fusoideumBCC 41242MN781942MN781825MN781679MN781780[11]
M. fusoideumBCC 53130MN781943MN781843MN781698MN781795MN781894[11]
M. gaoligongenseBUM 3.5KY087810KY087814KY087818KY087822KY087806[22]
M. gaoligongenseCCTCC M 2016588TKY087812KY087816KY087820KY087824KY087826KY087808[22]
M. globosumARSEF 2596TEU248846EU248898EU248926NR132020[18]
M. granulomatisUAMH 11028THM635076HM195304KJ398781NR132013[40]
M. granulomatisUAMH 11176HM635078KJ398782KJ398593HM195306[40]
M. gryllidicolaBCC 37915MN781896[12]
M. gryllidicolaBCC 37918MN781935MN781836MN781691MN781743MN781790MN781897[12]
M. gryllidicolaBCC 82988MK632117MK632091MK632062MK632166MK632143MT078891[12]
M. guizhouenseARSEF 6238EU248857EU248909EU248937EU248857[18]
M. guizhouenseCBS 258.90TEU248862EU248914EU248942HQ331448EU248862[18]
M. guniujiangenseRCEF 6740MW718230MW718256MW723108MW723140MW723161[14]
M. guniujiangenseRCEF 880TMW718229MW718255MW723106MW723139MW723160[14]
M. huainamdangenseBCC 32190MN781954MN781855MN781710MN781757MN781899[11]
M. huainamdangenseBCC 44270TMN781956MN781857MN781712MN781807MN781898[11]
M. huainamdangenseBCC 7672MN781955MN781856MN781711MN781758MN781806MN781901[11]
M. humberiIP 46TMH837574MH837556MH837565JQ061205[10]
M. indigoticumTNS-F 18553JF415953JF415968JF416010JN049886JF415992JN049874[4]
M. indigoticumTNS-F 18554JF415952JF415969JF416011JN049887JF415993JN049875[4]
M. kalasinenseBCC 53582TKC011175KC011183KC011189KC011179KX823945[8]
M. koreanumARSEF 2038TKJ398805KJ398615KJ398713HM055431[5]
M. koreanumBCC 27998MN781945MN781845MN781700MN781797MN781903[11]
M. koreanumBCC 30455MN781946MN781846MN781701MN781750MN781798MN781904[11]
M. lepidiotaeARSEF 7488TEU248865EU248917EU248945HQ331456EU248865[18]
M. macrosemiaeRCEF 6696TMW718233MW718259MW723113MW723144MW723164MW718317[14]
M. majusARSEF 1015EU248866EU248918EU248946HQ331444EU248866[18]
M. majusARSEF 1914TEU248868EU248920EU248948HQ331445EU248868[18]
M. megapomponiaeBCC 25100TMN781947MN781847MN781702MN781751MN781799MN781906[11]
M. minusARSEF 1099KJ398799KJ398608KJ398706[5]
M. minusARSEF 2037TAF339580AF339531DQ522353DQ522400DQ522454AF138271[3]
M. niveumBCC 52400TMN781933MN781832MN781685MN781785MN781907[11]
M. nornnoiBCC 19364MN781940MN781841MN781696MN781747MN781891[11]
M. nornnoiBCC 25948TMN781941MN781842MN781697MN781748MN781892[11]
M. novozealandicumARSEF 4661KJ398811KJ398622[5]
M. novozealandicumARSEF 4674KJ398812KJ398623[5]
M. ovoidosporumBCC 29223MN781960MN781861MN781716MN781762MN781909[11]
M. ovoidosporumBCC 32600TMN781961MN781862MN781717MN781763MN781910[11]
M. ovoidosporumBCC 7634MN781962MN781863MN781718MN781764MN781811MN781908[11]
M. owarienseNBRC 33258HQ165669HQ165730JF416017KJ398596JF415996JN049883[4]
M. pemphigiARSEF 6569KJ398813KJ398624DQ468378[5]
M. pemphigiARSEF 7491KJ398819KJ398629DQ468379[5]
M. pemphigiBUM 1MH143795[22]
M. pemphigiBUM 39.4KY087809[22]
M. phasmatodeaeBCC 2841MN781931MN781828MN781681MN781738MN781782MN781911[12]
M. phasmatodeaeBCC 49272MK632119MK632093MK632064MK632145MK632035MT078893[12]
M. phuwiangenseBCC 78206MN781719MN781765MN781812MT078879[11]
M. phuwiangenseBCC 85068MN781864MN781720MN781766MN781813MN781912[11]
M. phuwiangenseBCC 85069TMN781865MN781721MN781767MN781814MN781913[11]
M. pingshaenseCBS 257.90TEU248850EU248902EU248930HQ331450EU248850[18]
M. prachinenseBCC 47950KC011172KC011180KC011186KC011184KC011176[8]
M. prachinenseBCC 47979TKC011173KC011181KC011187KC011185KC011177[8]
M. pseudoatrovirensTNS-F 16380JF415977KJ398785JN049893JF415997JN049870[4]
M. purpureogenumARSEF 12570LC126079LC125911LC125922[8]
M. purpureogenumARSEF 12571TAB700552LC126078LC125913LC125920[8]
M. purpureonigrumBCC 89247TMN781725MN781771MN781817[11]
M. purpureonigrumBCC 89248MN781964MN781870MN781728MN781819[11]
M. purpureonigrumBCC 89249MN781963MN781869MN781726MN781772MN781818[11]
M. purpureumBCC 82173MN781866MN781722MN781768MN781815MN781919[11]
M. purpureumBCC 82642TMN781867MN781723MN781769MN781816MN781918[11]
M. purpureumBCC 83548MN781868MN781724MN781770MN781920[11]
M. reniformeARSEF 429HQ165671HQ165733HQ165690HQ165650DQ069284[8]
M. reniformeARSEF 577HQ165672HQ165734HQ165691HQ165651DQ069283[8]
M. reniformeIndGH 96HQ165670HQ165732HQ165649[8]
M. rileyiAF 368501AF368501[16]
M. rileyiCBS 806.71AY526491MH872111EF468787EF468893EF468937AY624205[3]
M. rileyiNBRC 8560HQ165667HQ165729HQ165688[8]
M. robertsiiARSEF 4739EU248848EU248900EU248928EU248848[18]
M. samlanenseBCC 17091THQ165665HQ165727HQ165686HQ165646HQ165707[8]
M. samlanenseBCC 39752MN781939MN781840MN781695MN781794MT078880[8]
M. sulphureumBCC 36585MN781686MN781786MT078931[11]
M. sulphureumBCC 36592TMN781687MN781787[11]
M. sulphureumBCC 39045MK632120MK632095MK632066MK632147MK632037MT078930[11]
M. takenseBCC 30934HQ165658HQ165720HQ165679HQ165740HQ165639HQ165698[8]
M. takenseBCC 30939THQ165659HQ165721HQ165741HQ165640HQ165699[8]
M. virideCBS 659.71HQ165673HQ165735HQ165692HQ165652HQ165714[14]
M. viridulumARSEF 6927KJ398815KJ398681[5]
M. viridulumBCC 36261MN781930MN781827MN781680MN781737MN781781MT078878[11]
Pochonia boninensisJCM 18597TAB758255AB709831AB758463AB758666AB758693AB709858[41]
P. chlamydosporiaCBS 101244DQ522544DQ518758DQ522327DQ522372DQ522424JN049821[41]
Note. The accession numbers in bold font refer to newly generated sequences in this study.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wei, C.-Y.; Tang, M.; Xie, L.-Y.; Fan, Q.; Shen, S.-K.; Yang, Z.-L.; Deng, G.; Wang, Y.-B. Metarhizium dianzhongense sp. nov. and New Record of M. bibionidarum (Clavicipitaceae, Hyocreales) Attacking Insects from China. Diversity 2024, 16, 201. https://doi.org/10.3390/d16040201

AMA Style

Wei C-Y, Tang M, Xie L-Y, Fan Q, Shen S-K, Yang Z-L, Deng G, Wang Y-B. Metarhizium dianzhongense sp. nov. and New Record of M. bibionidarum (Clavicipitaceae, Hyocreales) Attacking Insects from China. Diversity. 2024; 16(4):201. https://doi.org/10.3390/d16040201

Chicago/Turabian Style

Wei, Cui-Yuan, Mei Tang, Liu-Yi Xie, Qi Fan, Shi-Kang Shen, Zhu-Liang Yang, Gang Deng, and Yuan-Bing Wang. 2024. "Metarhizium dianzhongense sp. nov. and New Record of M. bibionidarum (Clavicipitaceae, Hyocreales) Attacking Insects from China" Diversity 16, no. 4: 201. https://doi.org/10.3390/d16040201

APA Style

Wei, C.-Y., Tang, M., Xie, L.-Y., Fan, Q., Shen, S.-K., Yang, Z.-L., Deng, G., & Wang, Y.-B. (2024). Metarhizium dianzhongense sp. nov. and New Record of M. bibionidarum (Clavicipitaceae, Hyocreales) Attacking Insects from China. Diversity, 16(4), 201. https://doi.org/10.3390/d16040201

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop