Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle
Abstract
:1. Introduction
2. Materials and Methods
2.1. Life Cycle and Morphology of Worms
2.2. Molecular Data
2.2.1. DNA Extraction, Amplification, and Sequencing
2.2.2. Analysis of Genetic Data
Species | Sources | Genbank Accession Number |
---|---|---|
Diplostomum cf. vanelli | this study | PP002326 |
Diplostomum alascense | [21] | MZ314153 |
Diplostomum phoxini | [18] | AY222173 |
Diplostomum alarioides | [21] | MZ314152 |
Diplostomum scudderi | [21] | MZ314170 |
Diplostomum marshalli | [21] | MZ314167 |
Diplostomum gavium | [21] | MZ314154-55 MZ314157 |
Diplostomum pseudospathaceum | [22] | KR269766 |
Diplostomum rauschi | [21] | MZ314169 |
Diplostomum indistinctum | [21] | MZ314161-65 |
Diplostomum spathaceum | [22] | KR269765 |
[21] | MZ314171 | |
Diplostomum huronense | [21] | MZ314160 |
Diplostomum baeri | [23] | OK631869 |
Diplostomum ardeae | [24] | MT259036 |
Postharmostomum commutatum * | [25] | MH915390 |
Species | Sources | Genbank Accession Number |
---|---|---|
Diplostomum cf. vanelli | this study | PP002346 |
Diplostomum huronense | [21] [26] [8] [27] | MZ323257-61 GQ292488-90 KR271069; KR271071-74 HM064667-68; HM064672 |
Diplostomum rauschi | [21] | MZ323270 |
Diplostomum indistinctum | [21] [26] [27] [28] | MZ323262-63; MZ323265 GQ292482 HM064673 KT831379 |
Diplostomum baeri | Unpublished [29] [8] [30] [23] | MF142161; MF142171-73; MF142176; MF142178; MF142184; MF142186-89; MF142191; MF142196; MF142198; MF142209; MF142211-12; MF142214; MF142216; MF142222-24 MH368850-53 KR271040; KR271042-47; KR271050-60; KR271062; KR271064-67 KM212030-KM212031 OK632471-74; OK632476-77 |
Diplostomum spathaceum | [21] [8] [22] | MZ323274; MZ323276; MZ323278-81 KR271414-16; KR271419-24; KR271427-28; KR271431-45; KR271449; KR271451; KR271454-62; KR271465; KR271467-69 KR269763 |
Diplostomum alascense | [21] | MZ323250 |
Diplostomum scudderi | [21] | MZ323273 |
Diplostomum alarioides | [21] | MZ323249 |
Diplostomum pseudospathaceum | [22] [8] | KR269764 KR271083-89; KR271091-92 |
Diplostomum gavium | [21] | MZ323251; MZ323255 |
Diplostomum marshalli | [21] | MZ323268 |
Diplostomum lunaschiae | [24] | MT324602; MT324607-08; MT324612-14; MT324617; MT324621-22; MT324595-96; MT324599 |
Diplostomum ardeae | [24] [8] | MT324592-93 KR271033 |
Diplostomum mergi | [8] Unpublished | KR271082 KY271543 |
Postharmostomum commutatum * | [31] | MN200359 |
3. Results
3.1. Morphology Data
3.2. Molecular Data
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Shigin, A.A. Trematode fauna of the USSR. Genus Diplostomum. In Metacercariae; Nauka: Moscow, Russia, 1986. (In Russian) [Google Scholar]
- Shigin, A.A. Trematodes of the fauna of Russia and neighbouring regions. In Genus Diplostomum; Nauka: Moscow, Russia, 1993. (In Russian) [Google Scholar]
- Chappell, L.H.; Hardie, L.J.; Secombes, C.J. Diplostomiasis: The disease and host-parasite interactions. In Parasitic Diseases of Fish; Tresaith: Dyfed, UK, 1994; pp. 59–86. [Google Scholar]
- Niewiadomska, K. Family Diplostomidae Poirier, 1886. In Keys to the Trematoda: Vol. I.; CAB International: Wallingford, UK, 2002. [Google Scholar]
- Georgieva, S.; Soldanova, M.; Perez-Del-Olmo, A.; Dangel, D.R.; Sitko, J.; Sures, B.; Kostadinova, A. Molecular prospecting for European Diplostomum (Digenea: Diplostomidae) reveals cryptic diversity. Int. J. Parasitol. 2013, 43, 57–72. [Google Scholar] [CrossRef] [PubMed]
- Perez-Del-Olmo, A.; Georgieva, S.; Pula, H.; Kostadinova, A. Molecular and morphological evidence for three species of Diplostomum (Digenea: Diplostomidae), parasites of fishes and fish-eating birds in Spain. Parasite Vectors 2014, 7, 502. [Google Scholar] [CrossRef]
- Selbach, C.; Soldanova, M.; Georgieva, S.; Kostadinova, A.; Sures, B. Integrative taxonomic approach to the cryptic diversity of Diplostomum spp. in lymnaeid snails from Europe with a focus on the ‘Diplostomum mergi’ species complex. Parasite Vectors 2015, 8, 300. [Google Scholar] [CrossRef] [PubMed]
- Locke, S.A.; Al-Nasiri, F.S.; Caffara, M.; Drago, F.; Kalbe, M.; Lapierre, A.R.; McLaughlin, J.D.; Nie, P.; Overstreet, R.M.; Souza, G.T.; et al. Diversity, specificity and speciation in larval Diplostomidae (Platyhelminthes: Digenea) in the eyes of freshwater fish, as revealed by DNA barcodes. Int. J. Parasitol. 2015, 45, 841–855. [Google Scholar] [CrossRef] [PubMed]
- Kudlai, O.; Oros, M.; Kostadinova, A.; Georgieva, S. Exploring the diversity of Diplostomum (Digenea: Diplostomidae) in fishes from the River Danube using mitochondrial DNA barcodes. Parasite Vectors 2017, 10, 592. [Google Scholar] [CrossRef] [PubMed]
- Hoogendoorn, C.; Smit, N.J.; Kudlai, O. Resolution of the identity of three species of Diplostomum (Digenea: Diplostomidae) parasitizing freshwater fishes in South Africa, combining molecular and morphological evidence. Int. J. Parasitol. Parasites Wildl. 2020, 11, 50–61. [Google Scholar] [CrossRef] [PubMed]
- Oshmarin, P.G. Parasitic Worms of Mammals and Birds in the Primorsky Region; Academy of Science of USSR: Moscow, Russia, 1963. (In Russian) [Google Scholar]
- Sonin, M.D. Key to Trematodes of Fish-Eating Birds of the Palaearctic: Opisthorchids, Renicolids, Strigeids; Nauka: Moscow, Russia, 1986. (In Russian) [Google Scholar]
- Besprozvannykh, V.V.; Ermolenko, A.V.; Nadtochy, E.V. Parasites of Animals and Man in Southern Far East; Dalnauka: Vladivostok, Russia, 2012. (In Russian) [Google Scholar]
- Truett, G.E.; Heeger, P.; Mynatt, R.L.; Truett, A.A.; Walker, J.A.; Warman, M.L. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). BioTechniques 2000, 29, 52–54. [Google Scholar] [CrossRef] [PubMed]
- Tkach, V.V.; Littlewood, D.T.J.; Olson, P.D.; Kinsella, J.M.; Swiderski, Z. Molecular phylogenetic analysis of the Microphalloidea Ward, 1901, (Trematoda, Digenea). Syst. Parasitol. 2003, 56, 1–15. [Google Scholar] [CrossRef]
- Moszczynska, A.; Locke, S.A.; McLaughlin, J.D.; Marcogliese, D.J.; Crease, T.J. Development of primers for the mitochondrial cytochrome c oxidase I gene in digenetic trematodes (Platyhelminthes) illustrates the challenge of barcoding parasitic helminths. Mol. Ecol. Resour. 2009, 9, 75–82. [Google Scholar] [CrossRef]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5, Molecular evolutionary genetic analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef]
- Olson, P.D.; Cribb, T.H.; Tkach, V.V.; Bray, R.A.; Littlewood, D.T.J. Phylogeny and classification of the Digenea (Platyhelminthes, Trematoda). Int. J. Parasitol. 2003, 33, 733–755. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3, Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [PubMed]
- Achatz, T.J.; Martens, J.R.; Kostadinova, A.; Pulis, E.E.; Orlofske, S.A.; Bell, J.A.; Fecchio, A.; Oyarzún-Ruiz, P.; Syrota, Y.Y.; Tkach, V.V. Molecular phylogeny of Diplostomum, Tylodelphys, Austrodiplostomum and Paralaria (Digenea: Diplostomidae) necessitates systematic changes and reveals a history of evolutionary host switching events. Int. J. Parasitol. 2022, 52, 47–63. [Google Scholar] [CrossRef]
- Brabec, J.; Kostadinova, A.; Scholz, T.; Littlewood, D.T. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): A molecular resource for taxonomy and molecular epidemiology of important fish pathogens. Parasites Vectors 2015, 8, 336. [Google Scholar] [CrossRef]
- Faltynkova, A.; Kudlai, O.; Pantoja, C.; Yakovleva, G.; Lebedeva, D. Another plea for ‘best practice’ in molecular approaches to trematode systematics: Diplostomum sp. clade Q identified as Diplostomum baeri Dubois, 1937 in Europe. Parasitology 2022, 149, 503–518. [Google Scholar] [CrossRef] [PubMed]
- Locke, S.A.; Drago, F.B.; Nunez, V.; Souza, G.T.R.E.; Takemoto, R.M. Phylogenetic position of Diplostomum spp. from New World herons based on complete mitogenomes, rDNA operons, and DNA barcodes, including a new species with partially elucidated life cycle. Parasitol. Res. 2020, 119, 2129–2137. [Google Scholar] [CrossRef] [PubMed]
- Valadao, M.C.; Silva, B.C.M.; Lopez-Hernandez, D.; Araujo, J.V.; Locke, S.A.; Pinto, H.A. A molecular phylogenetic study of the caecal fluke of poultry, Postharmostomum commutatum (=P. gallinum) (Trematoda: Brachylaimidae). Parasitol. Res. 2018, 117, 3927–3934. [Google Scholar] [CrossRef] [PubMed]
- Locke, S.A.; McLaughlin, J.D.; Dayanandan, S.; Marcogliese, D.J. Diversity and specificity in Diplostomum spp. metacercariae in freshwater fishes revealed by cytochrome c oxidase I and internal transcribed spacer sequences. Int. J. Parasitol. 2010, 40, 333–343. [Google Scholar] [CrossRef]
- Locke, S.A.; McLaughlin, D.J.; Marcogliese, D.J. DNA barcodes show cryptic diversity and a potential physiological basis for host specificity among Diplostomoidea (Platyhelminthes: Digenea) parasitizing freshwater fishes in the St. Lawrence River, Canada. Mol. Ecol. 2010, 19, 2813–2827. [Google Scholar] [CrossRef]
- Gordy, M.A.; Kish, L.; Tarrabain, M.; Hanington, P.C. A comprehensive survey of larval digenean trematodes and their snail hosts in central Alberta, Canada. Parasitol. Res. 2016, 115, 3867–3880. [Google Scholar] [CrossRef]
- Gordy, M.A.; Hanington, P.C. A fine-scale phylogenetic assessment of digenean trematodes in central Alberta reveals we have yet to uncover their total diversity. Ecol. Evol. 2019, 9, 3153–3238. [Google Scholar] [CrossRef]
- Kuhn, J.A.; Kristoffersen, R.; Knudsen, R.; Jakobsen, J.; Marcogliese, D.J.; Locke, S.A.; Primicerio, R.; Amundsen, P.A. Parasite communities of two three-spined stickleback populations in subarctic Norway—Effects of a small spatial-scale host introduction. Parasitol. Res. 2015, 114, 1327–1339. [Google Scholar] [CrossRef]
- Fu, Y.-T.; Jin, Y.-C.; Liu, G.-H. The Complete Mitochondrial Genome of the Caecal Fluke of Poultry, Postharmostomum commutatum, as the First Representative from the Superfamily Brachylaimoidea. Front. Genet. 2019, 10, 1037. [Google Scholar] [CrossRef]
- Skrjabin, K.I. Trematodes of Animal and Man, Principles of Trematodology; House of the USSR Academy of Science: Moscow, Russia, 1960. (In Russian) [Google Scholar]
- Tatonova, Y.V.; Shumenko, P.G.; Besprozvannykh, V.V. Description of Metagonimus pusillus sp. nov. (Trematoda: Heterophyidae): Phylogenetic relationships within the genus. J. Helminthol. 2018, 92, 703–712. [Google Scholar] [CrossRef]
DNA Region | Primer | Sequence 5′→3′ | Direction | Reference |
---|---|---|---|---|
28S | digl2 | AAGCATATCACTAAGCGG | forward, external | [15] |
1500R | GCTATCCTGAGGGAAACTTCG | reverse, external | [15] | |
900F | CCGTCTTGAAACACGGACCAAG | forward, internal | [15] | |
1200R | CTTGGTCCGTGTTTCAAGACGGG | reverse, internal | [15] | |
COX1 | MplatCOX1dF | TGTAAAACGACGGCCAGTTTWCITTRGATCATAAG | forward, external | [16] |
MplatCOX1dR | CAGGAAACAGCTATGACTGAAAYAAYAIIGGATCICCACC | reverse, external | [16] |
Diplostomum vanelli | |||
---|---|---|---|
Source | Present Study | Yamaguti 1935 cit. [32] | Dubois 1938 cit. [32] |
Body length | 785–1145 | 1210–1600 | 1200–1500 |
Prosoma length | 410–595 | 680–800 | 670–750 |
Prosoma width | 250–370 | 450–650 | 480–520 |
Opisthosoma length | 375–550 | 530–800 | 580–750 |
Opisthosoma width | 175–245 | 320–470 | 400–470 |
Oral sucker length | 50–80 | 48–75 | 55–62 |
Oral sucker width | 45–100 | 38–84 | 62–79 |
Lateral pseudosucker length | 55 | 90–102 diameter | 72–100 diameter |
Lateral pseudosucker width | 30–80 | ||
Pharynx length | 50–70 diameter | 54–66 | 53–65 |
Pharynx width | 42–54 | 45–50 | |
Ventral sucker length | 55–85 | 72–108 diameter | 74–82 |
Ventral sucker width | 70–105 | 86–90 | |
Holdfast organ length | 80–95 | 150–208 diameter | 220–280 diameter |
Holdfast organ width | 100–125 | ||
Anterior testis length | 100–220 | 110–180 | 140–160 |
Anterior testis width | 70–130 | 200–330 | 270–305 |
Posterior testis length | 175–220 | 140–200 | 150–205 |
Posterior testis width | 60–115 | 280–360 | 315–360 |
Ovary length | 50–60 | 50–110 | 105 |
Ovary width | 55–75 | 75–160 | 125–140 |
Eggs length | - | 93–108 | 96–104 |
Eggs width | - | 54–60 | 54–63 |
Prosoma/opisthosoma length ratio | 1.0 | - | 0.83–1.0 |
Oral/ventral sucker length ratio | 0.9 | - | - |
Species | Distances between Species | Distances within Species | ||||||
---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 4 | 5 | ||||
1 | Diplostomum spathaceum | 0.0000 | 0.0008 | 0.0044 | 0.0039 | 0.0000 | 0.0000 | |
2 | Diplostomum cf. vanelli | 0.0000 | 0.0008 | 0.0044 | 0.0039 | - | - | |
3 | Diplostomum huronense | 0.0009 | 0.0009 | 0.0042 | 0.0038 | - | - | |
4 | Diplostomum baeri | 0.0188 | 0.0188 | 0.0179 | 0.0049 | - | - | |
5 | Diplostomum ardea | 0.0224 | 0.0224 | 0.0215 | 0.0323 | - | - |
Species | Distances between Species | Distances within Species | ||||
---|---|---|---|---|---|---|
1 | 2 | 3 | ||||
1 | Diplostomum cf. vanelli | 0.0126 | 0.0132 | - | - | |
2 | Diplostomum spathaceum | 0.0963 | 0.0126 | 0.0094 | 0.0021 | |
3 | Diplostomum indistinctum | 0.0849 | 0.0910 | 0.0082 | 0.0035 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Izrailskaia, A.V.; Besprozvannykh, V.V.; Shchelkanov, M.Y. Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle. Diversity 2024, 16, 286. https://doi.org/10.3390/d16050286
Izrailskaia AV, Besprozvannykh VV, Shchelkanov MY. Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle. Diversity. 2024; 16(5):286. https://doi.org/10.3390/d16050286
Chicago/Turabian StyleIzrailskaia, Anna V., Vladimir V. Besprozvannykh, and Michael Yu. Shchelkanov. 2024. "Diplostomum cf. vanelli Yamaguti, 1935 (Trematoda: Diplostomidae Poirier, 1886): Morpho-Molecular Data and Life Cycle" Diversity 16, no. 5: 286. https://doi.org/10.3390/d16050286