Quinazolinone Derivative MR2938 Protects DSS-Induced Barrier Dysfunction in Mice Through Regulating Gut Microbiota
Abstract
:1. Introduction
2. Results
2.1. Alternation of the Gut Microbiome with MR2938 Treatment
2.2. The Effect of MR2938 on Pathological Symptoms Was Weakened in Colitis Mice with Microbiota Disruption
2.3. Gut Microbiota Contributed to the Barrier Function Restoration Under MR2938 Treatment
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Animals
4.3. Induction of Colitis
4.4. Histology Analysis
4.5. 16S rRNA Gene Sequencing
4.6. Analysis of Inflammatory Cytokines Activity
4.7. RNA Extraction and RT-qPCR
4.8. Immunofluorescence Staining
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Le Berre, C.; Honap, S.; Peyrin-Biroulet, L. Ulcerative colitis. Lancet 2023, 402, 571–584. [Google Scholar] [CrossRef]
- Lloyd-Price, J.; Arze, C.; Ananthakrishnan, A.N.; Schirmer, M.; Avila-Pacheco, J.; Poon, T.W.; Andrews, E.; Ajami, N.J.; Bonham, K.S.; Brislawn, C.J.; et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 2019, 569, 655–662. [Google Scholar] [CrossRef] [PubMed]
- Sepehri, S.; Khafipour, E.; Bernstein, C.N.; Coombes, B.K.; Pilar, A.V.; Karmali, M.; Ziebell, K.; Krause, D.O. Characterization of Escherichia coli isolated from gut biopsies of newly diagnosed patients with inflammatory bowel disease. Inflamm. Bowel Dis. 2011, 17, 1451–1463. [Google Scholar] [CrossRef] [PubMed]
- Garrett, W.S.; Gallini, C.A.; Yatsunenko, T.; Michaud, M.; DuBois, A.; Delaney, M.L.; Punit, S.; Karlsson, M.; Bry, L.; Glickman, J.N.; et al. Enterobacteriaceae act in concert with the gut microbiota to induce spontaneous and maternally transmitted colitis. Cell Host Microbe 2010, 8, 292–300. [Google Scholar] [CrossRef]
- Liu, S.; Zhao, W.; Lan, P.; Mou, X. The microbiome in inflammatory bowel diseases: From pathogenesis to therapy. Protein Cell 2021, 12, 331–345. [Google Scholar] [CrossRef] [PubMed]
- Martin-Gallausiaux, C.; Marinelli, L.; Blottière, H.M.; Larraufie, P.; Lapaque, N. SCFA: Mechanisms and functional importance in the gut. Proc. Nutr. Soc. 2021, 80, 37–49. [Google Scholar] [CrossRef]
- Furusawa, Y.; Obata, Y.; Fukuda, S.; Endo, T.A.; Nakato, G.; Takahashi, D.; Nakanishi, Y.; Uetake, C.; Kato, K.; Kato, T.; et al. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature 2013, 504, 446–450. [Google Scholar] [CrossRef]
- Chen, L.; Sun, M.; Wu, W.; Yang, W.; Huang, X.; Xiao, Y.; Ma, C.; Xu, L.; Yao, S.; Liu, Z.; et al. Microbiota metabolite butyrate differentially regulates Th1 and Th17 cells’ differentiation and function in induction of colitis. Inflamm. Bowel Dis. 2019, 25, 1450–1461. [Google Scholar] [CrossRef] [PubMed]
- Dupraz, L.; Magniez, A.; Rolhion, N.; Richard, M.L.; Da Costa, G.; Touch, S.; Mayeur, C.; Planchais, J.; Agus, A.; Danne, C.; et al. Gut microbiota-derived short-chain fatty acids regulate IL-17 production by mouse and human intestinal γδ T cells. Cell Rep. 2021, 36, 109332. [Google Scholar] [CrossRef] [PubMed]
- Besednova, N.N.; Zaporozhets, T.S.; Kuznetsova, T.A.; Makarenkova, I.D.; Kryzhanovsky, S.P.; Fedyanina, L.N.; Ermakova, S.P. Extracts and Marine Algae Polysaccharides in Therapy and Prevention of Inflammatory Diseases of the Intestine. Mar. Drugs 2020, 18, 289. [Google Scholar] [CrossRef]
- Peng, X.-Y.; Wu, J.-T.; Shao, C.-L.; Li, Z.-Y.; Chen, M.; Wang, C.-Y. Co-culture: Stimulate the metabolic potential and explore the molecular diversity of natural products from microorganisms. Mar. Life Sci. Technol. 2021, 3, 363–374. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; He, N.; Liu, Q.; Li, R.; Yang, L.; Kang, W.; Zhang, X.; Xu, X.; Yao, G.; Wang, P.; et al. Structural Optimization of Marine Natural Product Pretrichodermamide B for the Treatment of Colon Cancer by Targeting the JAK/STAT3 Signaling Pathway. J. Med. Chem. 2024, 67, 10783–10794. [Google Scholar] [CrossRef]
- Liyanage, N.M.; Nagahawatta, D.P.; Jayawardena, T.U.; Jeon, Y.-J. The Role of Seaweed Polysaccharides in Gastrointestinal Health: Protective Effect against Inflammatory Bowel Disease. Life 2023, 13, 1026. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Zhou, Y.; Zhang, X.; Yang, L.; Liu, J.; Wightman, S.M.; Lv, L.; Liu, Z.; Wang, C.-Y.; Zhao, C. Identification of marine natural product Pretrichodermamide B as a STAT3 inhibitor for efficient anticancer therapy. Mar. Life Sci. Technol. 2023, 5, 94–101. [Google Scholar] [CrossRef] [PubMed]
- D’Incalci, M.; Badri, N.; Galmarini, C.M.; Allavena, P. Trabectedin, a drug acting on both cancer cells and the tumour microenvironment. Br. J. Cancer 2014, 111, 646–650. [Google Scholar] [CrossRef] [PubMed]
- Lv, L.; Maimaitiming, M.; Huang, Y.; Yang, J.; Chen, S.; Sun, Y.; Zhang, X.; Li, X.; Xue, C.; Wang, P.; et al. Discovery of quinazolin-4(3H)-one derivatives as novel AChE inhibitors with anti-inflammatory activities. Eur. J. Med. Chem. 2023, 254, 115346. [Google Scholar] [CrossRef] [PubMed]
- Li, C.-S.; An, C.-Y.; Li, X.-M.; Gao, S.-S.; Cui, C.-M.; Sun, H.-F.; Wang, B.-G. Triazole and dihydroimidazole alkaloids from the marine sediment-derived fungus Penicillium paneum SD-44. J. Nat. Prod. 2011, 74, 1331–1334. [Google Scholar] [CrossRef]
- Wang, C.-J.; Guo, X.; Zhai, R.-Q.; Sun, C.; Xiao, G.; Chen, J.; Wei, M.-Y.; Shao, C.-L.; Gu, Y. Discovery of penipanoid C-inspired 2-(3,4,5-trimethoxybenzoyl)quinazolin-4(3H)-one derivatives as potential anticancer agents by inhibiting cell proliferation and inducing apoptosis in hepatocellular carcinoma cells. Eur. J. Med. Chem. 2021, 224, 113671. [Google Scholar] [CrossRef]
- Lv, L.; Maimaitiming, M.; Xia, S.; Yang, J.; Li, X.; Zhang, T.; Wang, Y.; Pinchuk, I.; Wang, P.; Wang, C.-Y.; et al. MR2938 relives DSS-induced colitis in mice through inhibiting NF-κB signaling and improving epithelial barrier. Mar. Life Sci. Technol. 2024, accepted. [Google Scholar]
- Tong, X.; Xu, J.; Lian, F.; Yu, X.; Zhao, Y.; Xu, L.; Zhang, M.; Zhao, X.; Shen, J.; Wu, S.; et al. Structural Alteration of Gut Microbiota During the Amelioration of Human Type 2 Diabetes with Hyperlipidemia by Metformin and a Traditional Chinese Herbal Formula: A Multicenter, Randomized, Open Label Clinical Trial. mBio 2018, 9, e02392-17. [Google Scholar] [CrossRef]
- Yang, L.; Xiang, Z.; Zou, J.; Zhang, Y.; Ni, Y.; Yang, J. Comprehensive Analysis of the Relationships Between the Gut Microbiota and Fecal Metabolome in Individuals with Primary Sjogren’s Syndrome by 16S rRNA Sequencing and LC-MS-Based Metabolomics. Front. Immunol. 2022, 13, 874021. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.; Sichler, A.; Ecker, J.; Laschinger, M.; Liebisch, G.; Höring, M.; Basic, M.; Bleich, A.; Zhang, X.-J.; Kübelsbeck, L.; et al. Gut microbiota promote liver regeneration through hepatic membrane phospholipid biosynthesis. J. Hepatol. 2023, 78, 820–835. [Google Scholar] [CrossRef]
- Gustafsson, J.K.; Johansson, M.E.V. The role of goblet cells and mucus in intestinal homeostasis. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 785–803. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Xiao, J.; Wei, S.; Su, Y.; Yang, X.; Su, S.; Lan, L.; Chen, X.; Huang, T.; Shan, Q. Protective effect of zinc gluconate on intestinal mucosal barrier injury in antibiotics and LPS-induced mice. Front. Microbiol. 2024, 15, 1407091. [Google Scholar] [CrossRef] [PubMed]
- Kuo, W.-T.; Zuo, L.; Odenwald, M.A.; Madha, S.; Singh, G.; Gurniak, C.B.; Abraham, C.; Turner, J.R. The Tight Junction Protein ZO-1 Is Dispensable for Barrier Function but Critical for Effective Mucosal Repair. Gastroenterology 2021, 161, 1924–1939. [Google Scholar] [CrossRef] [PubMed]
- Qiu, P.; Ishimoto, T.; Fu, L.; Zhang, J.; Zhang, Z.; Liu, Y. The Gut Microbiota in Inflammatory Bowel Disease. Front. Cell. Infect. Microbiol. 2022, 12, 733992. [Google Scholar] [CrossRef] [PubMed]
- Chassaing, B.; Van de Wiele, T.; De Bodt, J.; Marzorati, M.; Gewirtz, A.T. Dietary emulsifiers directly alter human microbiota composition and gene expression ex vivo potentiating intestinal inflammation. Gut 2017, 66, 1414–1427. [Google Scholar] [CrossRef]
- Tang, X.; Wang, W.; Hong, G.; Duan, C.; Zhu, S.; Tian, Y.; Han, C.; Qian, W.; Lin, R.; Hou, X. Gut microbiota-mediated lysophosphatidylcholine generation promotes colitis in intestinal epithelium-specific Fut2 deficiency. J. Biomed. Sci. 2021, 28, 20. [Google Scholar] [CrossRef]
- Martel, J.; Chang, S.-H.; Ko, Y.-F.; Hwang, T.-L.; Young, J.D.; Ojcius, D.M. Gut barrier disruption and chronic disease. Trends Endocrinol. Metab. 2022, 33, 247–265. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.-Y.; Gu, F.; Zhu, C.; Yuan, L.; Zhu, C.; Zhu, M.; Yao, J.; Hu, P.; Zhang, Y.; Dicksved, J.; et al. Epithelial Heat Shock Proteins Mediate the Protective Effects of Limosilactobacillus reuteri in Dextran Sulfate Sodium-Induced Colitis. Front. Immunol. 2022, 13, 865982. [Google Scholar] [CrossRef] [PubMed]
- Jia, L.; Wu, R.; Han, N.; Fu, J.; Luo, Z.; Guo, L.; Su, Y.; Du, J.; Liu, Y. Porphyromonas gingivalis and Lactobacillus rhamnosus GG regulate the Th17/Treg balance in colitis via TLR4 and TLR2. Clin. Transl. Immunol. 2020, 9, e1213. [Google Scholar] [CrossRef] [PubMed]
- Hao, H.; Zhang, X.; Tong, L.; Liu, Q.; Liang, X.; Bu, Y.; Gong, P.; Liu, T.; Zhang, L.; Xia, Y.; et al. Effect of Extracellular Vesicles Derived from Lactobacillus plantarum Q7 on Gut Microbiota and Ulcerative Colitis in Mice. Front. Immunol. 2021, 12, 777147. [Google Scholar] [CrossRef]
- Steck, N.; Hoffmann, M.; Sava, I.G.; Kim, S.C.; Hahne, H.; Tonkonogy, S.L.; Mair, K.; Krueger, D.; Pruteanu, M.; Shanahan, F.; et al. Enterococcus faecalis metalloprotease compromises epithelial barrier and contributes to intestinal inflammation. Gastroenterology 2011, 141, 959–971. [Google Scholar] [CrossRef]
- Sonbol, F.I.; Abdel Aziz, A.A.; El-Banna, T.E.; Al-Fakhrany, O.M. Antimicrobial activity of bacteriocins produced by Enterococcus isolates recovered from Egyptian homemade dairy products against some foodborne pathogens. Int. Microbiol. 2020, 23, 533–547. [Google Scholar] [CrossRef] [PubMed]
- Farias, F.M.; Teixeira, L.M.; Vallim, D.C.; Bastos, M.d.C.d.F.; Miguel, M.A.L.; Bonelli, R.R. Characterization of Enterococcus faecium E86 bacteriocins and their inhibition properties against Listeria monocytogenes and vancomycin-resistant Enterococcus. Braz. J. Microbiol. 2021, 52, 1513–1522. [Google Scholar] [CrossRef]
- Serio, A.; Paparella, A.; Chaves-López, C.; Corsetti, A.; Suzzi, G. Enterococcus populations in Pecorino Abruzzese cheese: Biodiversity and safety aspects. J. Food Prot. 2007, 70, 1561–1568. [Google Scholar] [CrossRef]
- Hanchi, H.; Mottawea, W.; Sebei, K.; Hammami, R. The genus Enterococcus: Between probiotic potential and safety concerns-an update. Front. Microbiol. 2018, 9, 1791. [Google Scholar] [CrossRef] [PubMed]
- Schaefer, M.; Zimmermann, K.; Enck, P. Probiotic treatment (Enterococcus faecalis) improves symptoms of seasonal allergic rhinitis: A randomized controlled trial. Int. Forum Allergy Rhinol. 2023, 13, 1974–1977. [Google Scholar] [CrossRef]
- Choi, E.-J.; Lee, H.J.; Kim, W.-J.; Han, K.-I.; Iwasa, M.; Kobayashi, K.; Debnath, T.; Tang, Y.; Kwak, Y.-S.; Yoon, J.-H.; et al. Enterococcus faecalis EF-2001 protects DNBS-induced inflammatory bowel disease in mice model. PLoS ONE 2019, 14, e0210854. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Han, C.H.; Mao, T.; Wu, J.; Ke, L.Y.; Guo, Y.J.; Han, R.S.; Tian, Z.B. Commensal Enterococcus faecalis W5 ameliorates hyperuricemia and maintains the epithelial barrier in a hyperuricemia mouse model. J. Dig. Dis. 2024, 25, 44–60. [Google Scholar] [CrossRef]
- Li, Z.; Dong, J.; Wang, M.; Yan, J.; Hu, Y.; Liu, Y.; Pan, Y.; Li, H. Resveratrol ameliorates liver fibrosis induced by nonpathogenic Staphylococcus in BALB/c mice through inhibiting its growth. Mol. Med. 2022, 28, 52. [Google Scholar] [CrossRef] [PubMed]
- Cheung, G.Y.C.; Otto, M. Virulence mechanisms of Staphylococcal animal pathogens. Int. J. Mol. Sci. 2023, 24, 14587. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Sugihara, K.; Gillilland, M.G.; Jon, S.; Kamada, N.; Moon, J.J. Hyaluronic acid-bilirubin nanomedicine for targeted modulation of dysregulated intestinal barrier, microbiome and immune responses in colitis. Nat. Mater. 2020, 19, 118–126. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Xu, J.; Huang, C.; Zhang, Y.; Zhao, H.; Zhu, M.; Wang, J.; Nie, Y.; Xu, H.; Zhou, Y.; et al. Rapamycin extenuates experimental colitis by modulating the gut microbiota. J. Gastroenterol. Hepatol. 2023, 38, 2130–2141. [Google Scholar] [CrossRef] [PubMed]
- Bongers, K.S.; McDonald, R.A.; Winner, K.M.; Falkowski, N.R.; Brown, C.A.; Baker, J.M.; Hinkle, K.J.; Fergle, D.J.; Dickson, R.P. Antibiotics cause metabolic changes in mice primarily through microbiome modulation rather than behavioral changes. PLoS ONE 2022, 17, e0265023. [Google Scholar] [CrossRef]
- Ritter, K.; Vetter, D.; Wernersbach, I.; Schwanz, T.; Hummel, R.; Schafer, M.K.E. Pre-traumatic antibiotic-induced microbial depletion reduces neuroinflammation in acute murine traumatic brain injury. Neuropharmacology 2023, 237, 109648. [Google Scholar] [CrossRef] [PubMed]
- Vicentini, F.A.; Keenan, C.M.; Wallace, L.E.; Woods, C.; Cavin, J.-B.; Flockton, A.R.; Macklin, W.B.; Belkind-Gerson, J.; Hirota, S.A.; Sharkey, K.A. Intestinal microbiota shapes gut physiology and regulates enteric neurons and glia. Microbiome 2021, 9, 210. [Google Scholar] [CrossRef]
- Chambers, L.M.; Esakov Rhoades, E.L.; Bharti, R.; Braley, C.; Tewari, S.; Trestan, L.; Alali, Z.; Bayik, D.; Lathia, J.D.; Sangwan, N.; et al. Disruption of the Gut Microbiota Confers Cisplatin Resistance in Epithelial Ovarian Cancer. Cancer Res. 2022, 82, 4654–4669. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Lin, J.; Zhang, C.; Gao, H.; Lu, H.; Gao, X.; Zhu, R.; Li, Z.; Li, M.; Liu, Z. Microbiota metabolite butyrate constrains neutrophil functions and ameliorates mucosal inflammation in inflammatory bowel disease. Gut Microbes 2021, 13, 1968257. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef]
- Shah, A.; Talley, N.J.; Koloski, N.; Macdonald, G.A.; Kendall, B.J.; Shanahan, E.R.; Walker, M.M.; Keely, S.; Jones, M.P.; Morrison, M.; et al. Duodenal bacterial load as determined by quantitative polymerase chain reaction in asymptomatic controls, functional gastrointestinal disorders and inflammatory bowel disease. Aliment. Pharmacol. Ther. 2020, 52, 155–167. [Google Scholar] [CrossRef]
- Yu, W.; Li, B.; Chen, L.; Chen, Q.; Song, Q.; Jin, X.; Yin, Y.; Tong, H.; Xue, L. Gigantol ameliorates DSS-induced colitis via suppressing β2 integrin mediated adhesion and chemotaxis of macrophage. J. Ethnopharmacol. 2024, 328, 118123. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence | Reverse Primer Sequence |
---|---|---|
β-actin | GACGTTGACATCCGTAAAGAC | CCACCGATCCACACAGAGTA |
IL-6 | TGGAGTCACAGAAGGAGTGGCTAAG | TCTGACCACAGTGAGGAATGTCCAC |
IL-1β | AGACAACTGCACTACAGGCTC | GTGGGTGTGCCGTCTTTCAT |
TNF-α | ACCACGCTCTTCTGTCTACT | GGCTACAGGCTTGTCACTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, L.; Maimaitiming, M.; Yang, J.; Xia, S.; Li, X.; Wang, P.; Liu, Z.; Wang, C.-Y. Quinazolinone Derivative MR2938 Protects DSS-Induced Barrier Dysfunction in Mice Through Regulating Gut Microbiota. Pharmaceuticals 2025, 18, 123. https://doi.org/10.3390/ph18010123
Lv L, Maimaitiming M, Yang J, Xia S, Li X, Wang P, Liu Z, Wang C-Y. Quinazolinone Derivative MR2938 Protects DSS-Induced Barrier Dysfunction in Mice Through Regulating Gut Microbiota. Pharmaceuticals. 2025; 18(1):123. https://doi.org/10.3390/ph18010123
Chicago/Turabian StyleLv, Ling, Mireguli Maimaitiming, Jichen Yang, Shuli Xia, Xin Li, Pingyuan Wang, Zhiqing Liu, and Chang-Yun Wang. 2025. "Quinazolinone Derivative MR2938 Protects DSS-Induced Barrier Dysfunction in Mice Through Regulating Gut Microbiota" Pharmaceuticals 18, no. 1: 123. https://doi.org/10.3390/ph18010123
APA StyleLv, L., Maimaitiming, M., Yang, J., Xia, S., Li, X., Wang, P., Liu, Z., & Wang, C.-Y. (2025). Quinazolinone Derivative MR2938 Protects DSS-Induced Barrier Dysfunction in Mice Through Regulating Gut Microbiota. Pharmaceuticals, 18(1), 123. https://doi.org/10.3390/ph18010123