Strategy to Develop and Evaluate a Multiplex RT-ddPCR in Response to SARS-CoV-2 Genomic Evolution
Abstract
:1. Introduction
2. Materials and Methods
2.1. Selection and Evaluation of Key Target for PCR Detection of SARS-CoV-2 Using WGS Data
2.2. Development of RT-ddPCR Method for the Detection of SARS-CoV-2
2.3. Validation of the Specificity of the RT-ddPCR Assay for SARS-CoV-2
2.4. Validation of Sensitivity of the RT-ddPCR Assay for SARS-CoV-2
2.5. Applicability Assessment
3. Results
3.1. In Silico Inclusivity Evaluation for the ORF1a and RdRp_IP4 Assays Using SCREENED
3.2. Specificity Assessment
3.3. Sensitivity Assessment
3.4. Applicability Assessment
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Menni, C.; Valdes, A.M.; Freidin, M.B.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Ganesh, S.; Varsavsky, T.; Cardoso, M.J.; El-Sayed Moustafa, J.S.; et al. Real-Time Tracking of Self-Reported Symptoms to Predict Potential COVID-19. Nat. Med. 2020, 26, 1037–1040. [Google Scholar] [CrossRef] [PubMed]
- Wurtzer, S.; Marechal, V.; Mouchel, J.; Maday, Y.; Teyssou, R.; Richard, E.; Almayrac, J.; Moulin, L. Evaluation of Lockdown Effect on SARS-CoV-2 Dynamics through Viral Genome Quantification in Waste Water, Greater Paris, France, 5 March to 23 April 2020. Eurosurveillance 2020, 25, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Emami, A.; Javanmardi, F.; Pirbonyeh, N.; Akbari, A. Prevalence of Underlying Diseases in Hospitalized Patients with COVID-19: A Systematic Review and Meta-Analysis. Arch. Acad. Emerg. Med. 2020, 8, e35. [Google Scholar]
- Machado, B.A.S.; Hodel, K.V.S.; Barbosa-Júnior, V.G.; Soares, M.B.P.; Badaró, R. The Main Molecular and Serological Methods for Diagnosing COVID-19: An Overview Based on the Literature. Viruses 2020, 13, 40. [Google Scholar] [CrossRef] [PubMed]
- Cheng, M.P.; Papenburg, J.; Desjardins, M.; Kanjilal, S.; Quach, C.; Libman, M.; Dittrich, S.; Yansouni, C.P. Diagnostic Testing for Severe Acute Respiratory Syndrome–Related Coronavirus 2. Ann. Intern. Med. 2020, 172, 726–734. [Google Scholar] [CrossRef] [Green Version]
- Lu, N.; Cheng, K.W.; Qamar, N.; Huang, K.C.; Johnson, J.A. Weathering COVID-19 Storm: Successful Control Measures of Five Asian Countries. Am. J. Infect. Control 2020, 48, 851–852. [Google Scholar] [CrossRef] [PubMed]
- Cha, V. Asia’s COVID-19 Lessons for the West: Public Goods, Privacy, and Social Tagging. Wash. Q. 2020, 43, 33–50. [Google Scholar] [CrossRef]
- Ahmed, W.; Angel, N.; Edson, J.; Bibby, K.; Bivins, A.; O’Brien, J.W.; Choi, P.M.; Kitajima, M.; Simpson, S.L.; Li, J.; et al. First Confirmed Detection of SARS-CoV-2 in Untreated Wastewater in Australia: A Proof of Concept for the Wastewater Surveillance of COVID-19 in the Community. Sci. Total Environ. 2020, 728, 138764. [Google Scholar] [CrossRef] [PubMed]
- Medema, G.; Heijnen, L.; Elsinga, G.; Italiaander, R.; Brouwer, A. Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands. Environ. Sci. Technol. Lett. 2020, 7, 511–516. [Google Scholar] [CrossRef]
- Wu, F.; Zhang, J.; Xiao, A.; Gu, X.; Lee, W.L.; Armas, F.; Kauffman, K.; Hanage, W.; Matus, M.; Ghaeli, N.; et al. SARS-CoV-2 Titers in Wastewater Are Higher than Expected from Clinically Confirmed Cases. mSystems 2020, 5, e00614-20. [Google Scholar] [CrossRef] [PubMed]
- Duchene, S.; Featherstone, L.; Haritopoulou-Sinanidou, M.; Rambaut, A.; Lemey, P.; Baele, G. Temporal Signal and the Phylodynamic Threshold of SARS-CoV-2. Virus Evol. 2020, 6, 1–8. [Google Scholar] [CrossRef] [PubMed]
- SAGE-EMG, S.-B. Transmission Group Mitigations to Reduce Transmission of the New Variant SARS-CoV-2 Virus. Available online: https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/948607/s0995-mitigations-to-reduce-transmission-of-the-new-variant.pdf (accessed on 2 July 2021).
- Davies, N.G.; Abbott, S.; Barnard, R.C.; Jarvis, C.I.; Kucharski, A.J.; Munday, J.; Pearson, C.A.B.; Russell, T.W.; Tully, D.C.; Washburne, A.D.; et al. Estimated Transmissibility and Impact of SARS-CoV-2 Lineage B.1.1.7 in England. Science 2021, 372, eabg3055. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, M.; Arora, P.; Groß, R.; Seidel, A.; Hörnich, B.F.; Hahn, A.S.; Krüger, N.; Graichen, L.; Hofmann-Winkler, H.; Kempf, A.; et al. SARS-CoV-2 Variants B.1.351 and P.1 Escape from Neutralizing Antibodies. Cell 2021, 184, 2384–2393.e12. [Google Scholar] [CrossRef] [PubMed]
- Greaney, A.J.; Starr, T.N.; Gilchuk, P.; Zost, S.J.; Binshtein, E.; Loes, A.N.; Hilton, S.K.; Huddleston, J.; Eguia, R.; Crawford, K.H.D.; et al. Complete Mapping of Mutations to the SARS-CoV-2 Spike Receptor-Binding Domain That Escape Antibody Recognition. Cell Host Microbe 2021, 29, 44–57.e9. [Google Scholar] [CrossRef]
- Gand, M.; Vanneste, K.; Thomas, I.; Van Gucht, S.; Capron, A.; Herman, P.; Roosens, N.H.C.; De Keersmaecker, S.C.J. Use of Whole Genome Sequencing Data for a First in Silico Specificity Evaluation of the RT-QPCR Assays Used for SARS-CoV-2 Detection. Int. J. Mol. Sci. 2020, 21, 5585. [Google Scholar] [CrossRef] [PubMed]
- Han, M.S.; Byun, J.-H.; Cho, Y.; Rim, J.H. RT-PCR for SARS-CoV-2: Quantitative versus Qualitative. Lancet Infect. Dis. 2021, 21, 165. [Google Scholar] [CrossRef]
- Girones, R.; Ferrús, M.A.; Alonso, J.L.; Rodriguez-Manzano, J.; Calgua, B.; de Abreu Corrêa, A.; Hundesa, A.; Carratala, A.; Bofill-Mas, S. Molecular Detection of Pathogens in Water—The Pros and Cons of Molecular Techniques. Water Res. 2010, 44, 4325–4339. [Google Scholar] [CrossRef]
- Whale, A.S.; von der Heide, E.K.; Kohlenberg, M.; Brinckmann, A.; Baedker, S.; Karalay, O.; Fernandez-Gonzalez, A.; Busby, E.J.; Bustin, S.A.; Hauser, H.; et al. Digital PCR Can Augment the Interpretation of RT-QPCR Cq Values for SARS-CoV-2 Diagnostics. Methods 2021. [Google Scholar] [CrossRef]
- Liu, X.; Feng, J.; Zhang, Q.; Guo, D.; Zhang, L.; Suo, T.; Hu, W.; Guo, M.; Wang, X.; Huang, Z.; et al. Analytical Comparisons of SARS-COV-2 Detection by QRT-PCR and DdPCR with Multiple Primer/Probe Sets. Emerg. Microbes Infect. 2020, 9, 1175–1179. [Google Scholar] [CrossRef]
- Suo, T.; Liu, X.; Feng, J.; Guo, M.; Hu, W.; Guo, D.; Ullah, H.; Yang, Y.; Zhang, Q.; Wang, X.; et al. DdPCR: A More Accurate Tool for SARS-CoV-2 Detection in Low Viral Load Specimens. Emerg. Microbes Infect. 2020, 9, 1259–1268. [Google Scholar] [CrossRef]
- Vogelstein, B.; Kinzler, K.W. Digital PCR. Proc. Natl. Acad. Sci. USA 1999, 96, 9236–9241. [Google Scholar] [CrossRef] [Green Version]
- Sanders, R.; Huggett, J.F.; Bushell, C.A.; Cowen, S.; Scott, D.J.; Foy, C.A. Evaluation of Digital PCR for Absolute DNA Quantification. Anal. Chem. 2011, 83, 6474–6484. [Google Scholar] [CrossRef]
- Whale, A.S.; Huggett, J.F.; Cowen, S.; Speirs, V.; Shaw, J.; Ellison, S.; Foy, C.A.; Scott, D.J. Comparison of Microfluidic Digital PCR and Conventional Quantitative PCR for Measuring Copy Number Variation. Nucleic Acids Res. 2012, 40, e82. [Google Scholar] [CrossRef] [PubMed]
- Sanders, R.; Mason, D.J.; Foy, C.A.; Huggett, J.F. Evaluation of Digital PCR for Absolute RNA Quantification. PLoS ONE 2013, 8, e75296. [Google Scholar] [CrossRef]
- Hindson, C.M.; Chevillet, J.R.; Briggs, H.A.; Gallichotte, E.N.; Ruf, I.K.; Hindson, B.J.; Vessella, R.L.; Tewari, M. Absolute Quantification by Droplet Digital PCR versus Analog Real-Time PCR. Nat. Methods 2013, 10, 1003–1005. [Google Scholar] [CrossRef] [PubMed]
- Taylor, S.C.; Carbonneau, J.; Shelton, D.N.; Boivin, G. Optimization of Droplet Digital PCR from RNA and DNA Extracts with Direct Comparison to RT-QPCR: Clinical Implications for Quantification of Oseltamivir-Resistant Subpopulations. J. Virol. Methods 2015, 224, 58–66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McDermott, G.P.; Do, D.; Litterst, C.M.; Maar, D.; Hindson, C.M.; Steenblock, E.R.; Legler, T.C.; Jouvenot, Y.; Marrs, S.H.; Bemis, A.; et al. Multiplexed Target Detection Using DNA-Binding Dye Chemistry in Droplet Digital PCR. Anal. Chem. 2013, 85, 11619–11627. [Google Scholar] [CrossRef] [PubMed]
- de Kock, R.; Baselmans, M.; Scharnhorst, V.; Deiman, B. Sensitive Detection and Quantification of SARS-CoV-2 by Multiplex Droplet Digital RT-PCR. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 807–813. [Google Scholar] [CrossRef] [PubMed]
- Alteri, C.; Cento, V.; Antonello, M.; Colagrossi, L.; Merli, M.; Ughi, N.; Renica, S.; Matarazzo, E.; Di Ruscio, F.; Tartaglione, L.; et al. Detection and Quantification of SARS-CoV-2 by Droplet Digital PCR in Real-Time PCR Negative Nasopharyngeal Swabs from Suspected COVID-19 Patients. PLoS ONE 2020, 15, e0236311. [Google Scholar] [CrossRef] [PubMed]
- Deiana, M.; Mori, A.; Piubelli, C.; Scarso, S.; Favarato, M.; Pomari, E. Assessment of the Direct Quantitation of SARS-CoV-2 by Droplet Digital PCR. Sci. Rep. 2020, 10, 18764. [Google Scholar] [CrossRef] [PubMed]
- Heijnen, L.; Elsinga, G.; de Graaf, M.; Molenkamp, R.; Koopmans, M.P.G.; Medema, G. Droplet Digital RT-PCR to Detect SARS-CoV-2 Variants of Concern in Wastewater. medRxiv 2021. [Google Scholar] [CrossRef]
- Gonzalez, R.; Larson, A.; Thompson, H.; Carter, E.; Cassi, X.F. Redesigning SARS-CoV-2 Clinical RT-QPCR Assays for Wastewater RT-DdPCR. medRxiv 2021. [Google Scholar] [CrossRef]
- D’Aoust, P.M.; Mercier, E.; Montpetit, D.; Jia, J.-J.; Alexandrov, I.; Neault, N.; Baig, A.T.; Mayne, J.; Zhang, X.; Alain, T.; et al. Quantitative Analysis of SARS-CoV-2 RNA from Wastewater Solids in Communities with Low COVID-19 Incidence and Prevalence. Water Res. 2021, 188, 116560. [Google Scholar] [CrossRef]
- Kinloch, N.N.; Ritchie, G.; Dong, W.; Cobarrubias, K.D.; Sudderuddin, H.; Lawson, T.; Matic, N.; Montaner, J.S.G.; Leung, V.; Romney, M.G.; et al. SARS-CoV-2 RNA Quantification Using Droplet Digital RT-PCR. J. Mol. Diagn. 2021, 23, 907–919. [Google Scholar] [CrossRef]
- Rački, N.; Morisset, D.; Gutierrez-Aguirre, I.; Ravnikar, M. One-Step RT-Droplet Digital PCR: A Breakthrough in the Quantification of Waterborne RNA Viruses. Anal. Bioanal. Chem. 2014, 406, 661–667. [Google Scholar] [CrossRef] [Green Version]
- World Health Organization (WHO). Molecular Assays to Diagnose COVID-19: Summary Table of Available Protocols; World Health Organization (WHO): Geneva, Switzerland, 2021. [Google Scholar]
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic Characterisation and Epidemiology of 2019 Novel Coronavirus: Implications for Virus Origins and Receptor Binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef] [Green Version]
- Chan, J.F.-W.; Yip, C.C.-Y.; To, K.K.-W.; Tang, T.H.-C.; Wong, S.C.-Y.; Leung, K.-H.; Fung, A.Y.-F.; Ng, A.C.-K.; Zou, Z.; Tsoi, H.-W.; et al. Improved Molecular Diagnosis of COVID-19 by the Novel, Highly Sensitive and Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-PCR Assay Validated In Vitro and with Clinical Specimens. J. Clin. Microbiol. 2020, 58, e00310-20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gand, M.; Vanneste, K.; Thomas, I.; Van Gucht, S.; Capron, A.; Herman, P.; Roosens, N.H.C.; De Keersmaecker, S.C.J. Deepening of In Silico Evaluation of SARS-CoV-2 Detection RT-QPCR Assays in the Context of New Variants. Genes 2021, 12, 565. [Google Scholar] [CrossRef] [PubMed]
- Vanneste, K.; Garlant, L.; Broeders, S.; Van Gucht, S.; Roosens, N.H. Application of Whole Genome Data for in Silico Evaluation of Primers and Probes Routinely Employed for the Detection of Viral Species by RT-QPCR Using Dengue Virus as a Case Study. BMC Bioinform. 2018, 19, 1–18. [Google Scholar] [CrossRef]
- Shu, Y.; McCauley, J. GISAID: Global Initiative on Sharing All Influenza Data—From Vision to Reality. Eurosurveillance 2017, 22, 30494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lefever, S.; Pattyn, F.; Hellemans, J.; Vandesompele, J. Single-Nucleotide Polymorphisms and Other Mismatches Reduce Performance of Quantitative PCR Assays. Clin. Chem. 2013, 59, 1470–1480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Whiley, D.M.; Sloots, T.P. Sequence Variation in Primer Targets Affects the Accuracy of Viral Quantitative PCR. J. Clin. Virol. 2005, 34, 104–107. [Google Scholar] [CrossRef] [PubMed]
- Fraiture, M.-A.; Deckers, M.; Papazova, N.; Roosens, N.H.C. Detection Strategy Targeting a Chloramphenicol Resistance Gene from Genetically Modified Bacteria in Food and Feed Products. Food Control 2020, 108, 106873. [Google Scholar] [CrossRef]
- Uhlig, S.; Frost, K.; Colson, B.; Simon, K.; Mäde, D.; Reiting, R.; Gowik, P.; Grohmann, L. Validation of Qualitative PCR Methods on the Basis of Mathematical–Statistical Modelling of the Probability of Detection. Accredit. Qual. Assur. 2015, 20, 75–83. [Google Scholar] [CrossRef]
- Federaal Agentschap voor Geneesmiddelen en Gezondheidsproducten Compendium Biobanken. Available online: https://www.fagg-afmps.be/nl/MENSELIJK_gebruik/gezondheidsproducten/menselijk_lichaamsmateriaal/menselijk_lichaamsmateriaal_0 (accessed on 3 June 2021).
- Phan, T. Genetic Diversity and Evolution of SARS-CoV-2. Infect. Genet. Evol. 2020, 81, 104260. [Google Scholar] [CrossRef]
- Shen, Z.; Xiao, Y.; Kang, L.; Ma, W.; Shi, L.; Zhang, L.; Zhou, Z.; Yang, J.; Zhong, J.; Yang, D.; et al. Genomic Diversity of Severe Acute Respiratory Syndrome–Coronavirus 2 in Patients With Coronavirus Disease 2019. Clin. Infect. Dis. 2020, 71, 713–720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peñarrubia, L.; Ruiz, M.; Porco, R.; Rao, S.N.; Juanola-Falgarona, M.; Manissero, D.; López-Fontanals, M.; Pareja, J. Multiple Assays in a Real-Time RT-PCR SARS-CoV-2 Panel Can Mitigate the Risk of Loss of Sensitivity by New Genomic Variants during the COVID-19 Outbreak. Int. J. Infect. Dis. 2020, 97, 225–229. [Google Scholar] [CrossRef] [PubMed]
- Telwatte, S.; Kumar, N.; Vallejo-Gracia, A.; Kumar, G.R.; Lu, C.M.; Ott, M.; Wong, J.K.; Yukl, S.A. Novel RT-DdPCR Assays for Simultaneous Quantification of Multiple Noncoding and Coding Regions of SARS-CoV-2 RNA. J. Virol. Methods 2021, 292, 114115. [Google Scholar] [CrossRef]
- Telwatte, S.; Martin, H.A.; Marczak, R.; Fozouni, P.; Vallejo-Gracia, A.; Kumar, G.R.; Murray, V.; Lee, S.; Ott, M.; Wong, J.K.; et al. Novel RT-DdPCR Assays for Measuring the Levels of Subgenomic and Genomic SARS-CoV-2 Transcripts. Methods 2021, in press. [Google Scholar] [CrossRef]
- Pezzi, L.; Charrel, R.N.; Ninove, L.; Nougairede, A.; Molle, G.; Coutard, B.; Durand, G.; Leparc-Goffart, I.; de Lamballerie, X.; Thirion, L. Development and Evaluation of a Duo SARS-CoV-2 RT-QPCR Assay Combining Two Assays Approved by the World Health Organization Targeting the Envelope and the RNA-Dependant RNA Polymerase (RdRp) Coding Regions. Viruses 2020, 12, 686. [Google Scholar] [CrossRef]
Primer/Probe | 5′→ 3′ Sequence | Target | Nucleotide Position | Concentration | Ref. |
---|---|---|---|---|---|
ORF1a-F | AGAAGATTGGTTAGATGATGATAGT | ORF1a | 3193–3217 | 0.9 µM | [37] |
ORF1a-R | TTCCATCTCTAATTGAGGTTGAACC | 3286–3310 | 0.9 µM | ||
ORF1a-P | 5′6-FAM/TCCTCACTG-ZEN-CCGTCTTGTTGACCA-3′IABkFQ | 3229–3252 | 0.25 µM | ||
RdRp_IP4-F | GGTAACTGGTATGATTTCG | RdRp gene | 14,080–14,098 | 0.9 µM | [38] |
RdRp_IP4-R | CTGGTCAAGGTTAATATAGG | 14,167–14,186 | 0.9 µM | ||
RdRp_IP4-P | 5′HEX-TCATACAAA-ZEN-CCACGCCAGG-3′IABkFQ | 14,105–14,123 | 0.25 µM |
Month | Number of Genomes | Assay | FN | Inclusivity |
---|---|---|---|---|
November | 13 678 | RdRp_IP4 | 20 | 99.85% |
ORF1a | 17 | 99.88% | ||
December | 41 128 | RdRp_IP4 | 21 | 99.95% |
ORF1a | 95 | 99.77% | ||
January | 58 484 | RdRp_IP4 | 52 | 99.91% |
ORF1a | 67 | 99.89% | ||
February | 41 199 | RdRp_IP4 | 31 | 99.92% |
ORF1a | 28 | 99.93% |
Kingdom | Genus | Species | Strain Number | RT-ddPCR |
Animalia | Homo | sapiens | / | - |
Plantae | Zea | mays | / | - |
Bacteria | Bacillus | subtilis | SI0005 | - |
Escherichia | coli | MB1068 | - | |
Fungi | Aspergillus | acidus | 26,285 | - |
Candida | cylindracea | 041387 | - | |
Family | Species | RT-ddPCR | ||
Viruses | Picornaviridae | Rhinovirus B | - | |
Reoviridae | Rotavirus | - | ||
Orthomyxoviridae | Influenza A (H1N1) | - | ||
Orthomyxoviridae | Influenza A (H3) | - | ||
Orthomyxoviridae | Influenza B | - | ||
Adenoviridae | Adenovirus | - | ||
Picornaviridae | Enterovirus D68 | - | ||
Caliciviridae | Norovirus | - | ||
Pneumoviridae | RSV A | - | ||
Coronaviridae | SARS-CoV | - | ||
Coronaviridae | MERS-CoV | - | ||
Coronaviridae | Corona OC43 | - | ||
Coronaviridae | Coronavirus control | - | ||
Coronaviridae | SARS-CoV-2 | + |
Estimated Target Copy Number | Sensitivity Assessment (ORF1a) | Sensitivity Assessment (RdRp_IP4) |
---|---|---|
200 copies/µL | + 12/12 117.59 ± 7.68 copies/µL | + 12/12 138.46 ± 8.44 copies/µL |
50 copies/µL | + 12/12 25.53 ± 8.02 copies/µL | + 12/12 27.98 ± 7.82 copies/µL |
25 copies/µL | + 12/12 10.95 ± 2.37 copies/µL | + 12/12 12.54 ± 1.95 copies/µL |
10 copies/µL | + 12/12 4.45 ± 0.82 copies/µL | + 12/12 4.70 ± 1.06 copies/µL |
5 copies/µL | + 12/12 1.82 ± 0.66 copies/µL | + 12/12 2.20 ± 0.90 copies/µL |
1 copies/µL | + 4/12 0.11 ± 0.16 copies/µL | + 9/12 0.37 ± 0.29 copies/µL |
0.5 copies/µL | + 4/12 0.19 ± 0.31 copies/µL | + 9/12 0.48 ± 0.44 copies/µL |
0 copies/µL | - 0/12 | - 0/12 |
Sample | SARS-CoV-2 (ORF1a) | SARS-CoV-2 (RdRp_IP4) | RT-qPCR |
---|---|---|---|
Wastewater sample 1 | + 2.48 copies/µL | + 1.93 copies/µL | + |
Wastewater sample 2 | + 6.33 copies/µL | + 2.20 copies/µL | + |
Wastewater sample 3 | + 29.43 copies/µL | + 36.29 copies/µL | + |
Clinical sample 1 | + 2.75 copies/µL | + 2.75 copies/µL | + |
Clinical sample 2 | + 26.13 copies/µL | + 32.18 copies/µL | + |
Clinical sample 3 | + 88,440 copies/µL | + 91,080 copies/µL | + |
Clinical sample 4 | - | - | - |
Clinical sample 5 | - | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Van Poelvoorde, L.A.E.; Gand, M.; Fraiture, M.-A.; De Keersmaecker, S.C.J.; Verhaegen, B.; Van Hoorde, K.; Cay, A.B.; Balmelle, N.; Herman, P.; Roosens, N. Strategy to Develop and Evaluate a Multiplex RT-ddPCR in Response to SARS-CoV-2 Genomic Evolution. Curr. Issues Mol. Biol. 2021, 43, 1937-1949. https://doi.org/10.3390/cimb43030134
Van Poelvoorde LAE, Gand M, Fraiture M-A, De Keersmaecker SCJ, Verhaegen B, Van Hoorde K, Cay AB, Balmelle N, Herman P, Roosens N. Strategy to Develop and Evaluate a Multiplex RT-ddPCR in Response to SARS-CoV-2 Genomic Evolution. Current Issues in Molecular Biology. 2021; 43(3):1937-1949. https://doi.org/10.3390/cimb43030134
Chicago/Turabian StyleVan Poelvoorde, Laura A. E., Mathieu Gand, Marie-Alice Fraiture, Sigrid C. J. De Keersmaecker, Bavo Verhaegen, Koenraad Van Hoorde, Ann Brigitte Cay, Nadège Balmelle, Philippe Herman, and Nancy Roosens. 2021. "Strategy to Develop and Evaluate a Multiplex RT-ddPCR in Response to SARS-CoV-2 Genomic Evolution" Current Issues in Molecular Biology 43, no. 3: 1937-1949. https://doi.org/10.3390/cimb43030134
APA StyleVan Poelvoorde, L. A. E., Gand, M., Fraiture, M.-A., De Keersmaecker, S. C. J., Verhaegen, B., Van Hoorde, K., Cay, A. B., Balmelle, N., Herman, P., & Roosens, N. (2021). Strategy to Develop and Evaluate a Multiplex RT-ddPCR in Response to SARS-CoV-2 Genomic Evolution. Current Issues in Molecular Biology, 43(3), 1937-1949. https://doi.org/10.3390/cimb43030134