Pro-Angiogenetic Effects of Purified Extracts from Helix aspersa during Zebrafish Development
Abstract
:1. Introduction
2. Materials and Methods
2.1. Purified Snail Extracts
2.2. Analytical Procedures
2.3. Zebrafish Maintenance and Collection of Eggs
2.4. Treatment with Purified Snail Extracts
2.5. VEGF Inhibitor Treatment
2.6. Confocal Microscope Imaging
2.7. Image Analysis of ISVs and CVPs
2.8. Whole-Mount In Situ Hybridization (WISH)
2.9. AP Staining
2.10. RNA Extraction, Reverse Transcription, and RT-qPCR
2.11. Statistical Analysis
3. Results and Discussion
3.1. Analytical Profile of Purified Extracts from Helix aspersa
3.2. Purified Extracts from Helix aspersa Induced Pro-Angiogenetic Effects during Zebrafish Development
3.2.1. ISV Formation
3.2.2. SIVP Formation
3.3. Pro-Angiogenic Effects of Snail Derivatives
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lazzari, P.; Sanna, A.; Mastinu, A.; Cabasino, S.; Manca, I.; Pani, L. Weight loss induced by rimonabant is associated with an altered leptin expression and hypothalamic leptin signaling in diet-induced obese mice. Behav. Brain Res. 2011, 217, 432–438. [Google Scholar] [CrossRef]
- Manca, I.; Mastinu, A.; Olimpieri, F.; Falzoi, M.; Sani, M.; Ruiu, S.; Loriga, G.; Volonterio, A.; Tambaro, S.; Bottazzi, M.E.H.; et al. Novel pyrazole derivatives as neutral CB1 antagonists with significant activity towards food intake. Eur. J. Med. Chem. 2013, 62, 256–269. [Google Scholar] [CrossRef]
- Lazzari, P.; Pau, A.; Tambaro, S.; Asproni, B.; Ruiu, S.; Pinna, G.; Mastinu, A.M.; Curzu, M.; Reali, R.; Emilio Heiner Bottazzi, M.; et al. Synthesis and Pharmacological Evaluation of Novel 4-Alkyl-5-thien-2′-yl Pyrazole Carboxamides. Cent. Nerv. Syst. Agents Med. Chem. 2012, 12, 254–276. [Google Scholar] [CrossRef] [PubMed]
- Sanna, D.; Sanna, A.; Mara, L.; Pilichi, S.; Mastinu, A.; Chessa, F.; Pani, L.; Dattena, M. Oct4 expression in in-vitro-produced sheep blastocysts and embryonic-stem-like cells. Cell Biol. Int. 2010, 34, 53–60. [Google Scholar] [CrossRef]
- Cilia, G.; Fratini, F. Antimicrobial properties of terrestrial snail and slug mucus. J. Complement. Integr. Med. 2018, 15, 20170168. [Google Scholar] [CrossRef] [PubMed]
- Adikwu, M.U.; Enebeke, T.C. Evaluation Of Snail Mucin Dispersed In Brachystegia Gum Gel As A Wound Healing Agent. Anim. Res. Int. 2008, 4. [Google Scholar] [CrossRef] [Green Version]
- Brieva, A.; Philips, N.; Tejedor, R.; Guerrero, A.; Pivel, J.P.; Alonso-Lebrero, J.L.; Gonzalez, S. Molecular basis for the regenerative properties of a secretion of the mollusk Cryptomphalus aspersa. Skin Pharmacol. Phys. 2008, 21, 15–22. [Google Scholar] [CrossRef]
- Dwek, M.V.; Ross, H.A.; Streets, A.J.; Brooks, S.A.; Adam, E.; Titcomb, A.; Woodside, J.V.; Schumacher, U.; Leathem, A.J. Helix pomatia agglutinin lectin-binding oligosaccharides of aggressive breast cancer. Int. J. Cancer 2001, 95, 79–85. [Google Scholar] [CrossRef]
- Noothuan, N.; Apitanyasai, K.; Panha, S.; Tassanakajon, A. Snail mucus from the mantle and foot of two land snails, Lissachatina fulica and Hemiplecta distincta, exhibits different protein profile and biological activity. BMC Res. Notes 2021, 14, 138. [Google Scholar] [CrossRef] [PubMed]
- Ulagesan, S.; Kim, H. Antibacterial and Antifungal Activities of Proteins Extracted from Seven Different Snails. Appl. Sci. 2018, 8, 1362. [Google Scholar] [CrossRef] [Green Version]
- Gugliandolo, E.; Cordaro, M.; Fusco, R.; Peritore, A.F.; Siracusa, R.; Genovese, T.; D’Amico, R.; Impellizzeri, D.; Di Paola, R.; Cuzzocrea, S.; et al. Protective effect of snail secretion filtrate against ethanol-induced gastric ulcer in mice. Sci. Rep. 2021, 11, 3638. [Google Scholar] [CrossRef]
- Ellijimi, C.; Ben Hammouda, M.; Othman, H.; Moslah, W.; Jebali, J.; Ben Mabrouk, H.; Morjen, M.; Haoues, M.; Luis, J.; Marrakchi, N.; et al. Helix aspersa maxima mucus exhibits antimelanogenic and antitumoral effects against melanoma cells. Biomed. Pharmacother. 2018, 101, 871–880. [Google Scholar] [CrossRef]
- El Mubarak, M.A.S.; Lamari, F.N.; Kontoyannis, C. Simultaneous determination of allantoin and glycolic acid in snail mucus and cosmetic creams with high performance liquid chromatography and ultraviolet detection. J. Chromatogr. A 2013, 1322, 49–53. [Google Scholar] [CrossRef]
- Trapella, C.; Rizzo, R.; Gallo, S.; Alogna, A.; Bortolotti, D.; Casciano, F.; Zauli, G.; Secchiero, P.; Voltan, R. HelixComplex snail mucus exhibits pro-survival, proliferative and pro-migration effects on mammalian fibroblasts. Sci. Rep. 2018, 8, 17665. [Google Scholar] [CrossRef] [PubMed]
- Folkman, J.; Shing, Y. Angiogenesis. J. Biol. Chem. 1992, 267, 10931–10934. [Google Scholar] [CrossRef]
- Carmeliet, P. Mechanisms of angiogenesis and arteriogenesis. Nat. Med. 2000, 6, 389–395. [Google Scholar] [CrossRef]
- Kazerounian, S.; Lawler, J. Integration of pro- and anti-angiogenic signals by endothelial cells. J. Cell Commun. Signal. 2018, 12, 171–179. [Google Scholar] [CrossRef] [Green Version]
- Buschmann, I.R.; Persson, A.B. Vascular Growth in Health and Disease. Front. Mol. Neurosci. 2011, 4. [Google Scholar] [CrossRef] [Green Version]
- Moriya, J.; Minamino, T. Angiogenesis, Cancer, and Vascular Aging. Front. Cardiovasc. Med. 2017, 4, 65. [Google Scholar] [CrossRef]
- Gore, A.V.; Monzo, K.; Cha, Y.R.; Pan, W.; Weinstein, B.M. Vascular development in the zebrafish. Cold Spring Harb. Perspect. Med. 2012, 2, a006684. [Google Scholar] [CrossRef] [Green Version]
- Martyn, U.; Schulte-Merker, S. Zebrafish neuropilins are differentially expressed and interact with vascular endothelial growth factor during embryonic vascular development. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2004, 231, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Choe, C.P.; Choi, S.-Y.; Kee, Y.; Kim, M.J.; Kim, S.-H.; Lee, Y.; Park, H.-C.; Ro, H. Transgenic fluorescent zebrafish lines that have revolutionized biomedical research. Lab. Anim. Res. 2021, 37, 26. [Google Scholar] [CrossRef]
- Isogai, S.; Horiguchi, M.; Weinstein, B.M. The vascular anatomy of the developing zebrafish: An atlas of embryonic and early larval development. Dev. Biol. 2001, 230, 278–301. [Google Scholar] [CrossRef] [Green Version]
- Goi, M.; Childs, S.J. Patterning mechanisms of the sub-intestinal venous plexus in zebrafish. Dev. Biol. 2016, 409, 114–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fouquet, B.; Weinstein, B.M.; Serluca, F.C.; Fishman, M.C. Vessel patterning in the embryo of the zebrafish: Guidance by notochord. Dev. Biol. 1997, 183, 37–48. [Google Scholar] [CrossRef] [Green Version]
- Abate, G.; Zhang, L.L.; Pucci, M.; Morbini, G.; Mac Sweeney, E.; Maccarinelli, G.; Ribaudo, G.; Gianoncelli, A.; Uberti, D.; Memo, M.; et al. Phytochemical Analysis and Anti-Inflammatory Activity of Different Ethanolic Phyto-Extracts of Artemisia annua L. Biomolecules 2021, 11, 975. [Google Scholar] [CrossRef] [PubMed]
- Jinn, S.W.; Beisl, D.; Mitchell, T.; Chen, J.N.; Stainier, D.Y.R. Cellular and molecular analyses of vascular tube and lumen formation in zebrafish. Development 2005, 132, 5199–5209. [Google Scholar] [CrossRef] [Green Version]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of Embryonic-Development of the Zebrafish. Dev. Dynam. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Lammer, E.; Carr, G.J.; Wendler, K.; Rawlings, J.M.; Belanger, S.E.; Braunbeck, T. Is the fish embryo toxicity test (FET) with the zebrafish (Danio rerio) a potential alternative for the fish acute toxicity test? Comp. Biochem. Physiology. Toxicol. Pharmacol. CBP 2009, 149, 196–209. [Google Scholar] [CrossRef] [PubMed]
- Hans, C.; McCollum, C.W.; Bondesson, M.B.; Gustafsson, J.A.; Shah, S.K.; Merchant, F.A. Automated Analysis of Zebrafish Images for Screening Toxicants. IEEE Eng. Med. Biol. 2013, 3004–3007. [Google Scholar]
- Ben Shoham, A.; Malkinson, G.; Krief, S.; Shwartz, Y.; Ely, Y.; Ferrara, N.; Yaniv, K.; Zelzer, E. S1P1 inhibits sprouting angiogenesis during vascular development. Development 2012, 139, 3859–3869. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wiley, D.M.; Kim, J.D.; Hao, J.; Hong, C.C.; Bautch, V.L.; Jin, S.W. Distinct signalling pathways regulate sprouting angiogenesis from the dorsal aorta and the axial vein. Nat. Cell Biol. 2011, 13, 686–692. [Google Scholar] [CrossRef] [Green Version]
- Khatri, D.; Zizioli, D.; Tiso, N.; Facchinello, N.; Vezzoli, S.; Gianoncelli, A.; Memo, M.; Monti, E.; Borsani, G.; Finazzi, D. Down-regulation of coasy, the gene associated with NBIA-VI, reduces Bmp signaling, perturbs dorso-ventral patterning and alters neuronal development in zebrafish. Sci. Rep. 2016, 6, 37660. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serbedzija, G.N.; Flynn, E.; Willett, C.E. Zebrafish angiogenesis: A new model for drug screening. Angiogenesis 1999, 3, 353–359. [Google Scholar] [CrossRef]
- Vogrin, A.J.; Bower, N.I.; Gunzburg, M.J.; Roufail, S.; Okuda, K.S.; Paterson, S.; Headey, S.J.; Stacker, S.A.; Hogan, B.M.; Achen, M.G. Evolutionary Differences in the Vegf/Vegfr Code Reveal Organotypic Roles for the Endothelial Cell Receptor Kdr in Developmental Lymphangiogenesis. Cell Rep. 2019, 28, 2023–2036. [Google Scholar] [CrossRef] [Green Version]
- Basnet, R.M.; Zizioli, D.; Muscò, A.; Finazzi, D.; Sigala, S.; Rossini, E.; Tobia, C.; Guerra, J.; Presta, M.; Memo, M. Caffeine Inhibits Direct and Indirect Angiogenesis in Zebrafish Embryos. Int. J. Mol. Sci. 2021, 22, 4856. [Google Scholar] [CrossRef]
- Nicoli, S.; Ribatti, D.; Cotelli, F.; Presta, M. Mammalian Tumor Xenografts Induce Neovascularization in Zebrafish Embryos. Cancer Res. 2007, 67, 2927–2931. [Google Scholar] [CrossRef] [Green Version]
- Chan, Y.-K.; Kwok, H.-H.; Chan, L.-S.; Leung, K.S.-Y.; Shi, J.; Mak, N.-K.; Wong, R.N.-S.; Yue, P.Y.-K. An indirubin derivative, E804, exhibits potent angiosuppressive activity. Biochem. Pharmacol. 2012, 83, 598–607. [Google Scholar] [CrossRef] [Green Version]
- Hasan, S.S.; Tsaryk, R.; Lange, M.; Wisniewski, L.; Moore, J.C.; Lawson, N.D.; Wojciechowska, K.; Schnittler, H.; Siekmann, A.F. Endothelial Notch signalling limits angiogenesis via control of artery formation. Nat. Cell Biol. 2017, 19, 928–940. [Google Scholar] [CrossRef] [Green Version]
- Cross, M.J.; Dixelius, J.; Matsumoto, T.; Claesson-Welsh, L. VEGF-receptor signal transduction. Trends Biochem. Sci. 2003, 28, 488–494. [Google Scholar] [CrossRef]
- Nasevicius, A.; Larson, J.; Ekker, S.C. Distinct requirements for zebrafish angiogenesis revealed by a VEGF-A morphant. Yeast 2000, 17, 294–301. [Google Scholar] [CrossRef] [Green Version]
- Olsson, A.K.; Dimberg, A.; Kreuger, J.; Claesson-Welsh, L. VEGF receptor signalling—In control of vascular function. Nat. Reviews. Mol. Cell Biol. 2006, 7, 359–371. [Google Scholar] [CrossRef]
- Lawson, N.D.; Weinstein, B.M. In Vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 2002, 248, 307–318. [Google Scholar] [CrossRef] [Green Version]
- Modi, S.J.; Kulkarni, V.M. Vascular Endothelial Growth Factor Receptor (VEGFR-2)/KDR Inhibitors: Medicinal Chemistry Perspective. Med. Drug Discov. 2019, 2, 100009. [Google Scholar] [CrossRef]
- Li, Y.; Luo, H.; Liu, T.; Zacksenhaus, E.; Ben-David, Y. The ets transcription factor Fli-1 in development, cancer and disease. Oncogene 2015, 34, 2022–2031. [Google Scholar] [CrossRef] [Green Version]
- Grunewald, M.; Kumar, S.; Sharife, H.; Volinsky, E.; Gileles-Hillel, A.; Licht, T.; Permyakova, A.; Hinden, L.; Azar, S.; Friedmann, Y.; et al. Counteracting age-related VEGF signaling insufficiency promotes healthy aging and extends life span. Science 2021, 373, eabc8479. [Google Scholar] [CrossRef] [PubMed]
- Lazarus, A.; Keshet, E. Vascular Endothelial Growth Factor and Vascular Homeostasis. Proc. Am. Thorac. Soc. 2011, 8, 508–511. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
vegfa | CTCCATCTGTCTGCTGTAAAGG | GGGATACTCCTGGATGATGTCTA |
Dre rpl13a | TCTGGAGGACTGTAAGAGGTATGC | AGACGCACAATCTTGAGAGCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zizioli, D.; Mastinu, A.; Muscò, A.; Bonini, S.A.; Finazzi, D.; Avisani, R.; Kron Morelli, G.B.; Pecorelli, S.; Memo, M. Pro-Angiogenetic Effects of Purified Extracts from Helix aspersa during Zebrafish Development. Curr. Issues Mol. Biol. 2022, 44, 3364-3377. https://doi.org/10.3390/cimb44080232
Zizioli D, Mastinu A, Muscò A, Bonini SA, Finazzi D, Avisani R, Kron Morelli GB, Pecorelli S, Memo M. Pro-Angiogenetic Effects of Purified Extracts from Helix aspersa during Zebrafish Development. Current Issues in Molecular Biology. 2022; 44(8):3364-3377. https://doi.org/10.3390/cimb44080232
Chicago/Turabian StyleZizioli, Daniela, Andrea Mastinu, Alessia Muscò, Sara Anna Bonini, Dario Finazzi, Rosaria Avisani, Giovanni Battista Kron Morelli, Sergio Pecorelli, and Maurizio Memo. 2022. "Pro-Angiogenetic Effects of Purified Extracts from Helix aspersa during Zebrafish Development" Current Issues in Molecular Biology 44, no. 8: 3364-3377. https://doi.org/10.3390/cimb44080232