The Influence of Betulin Derivatives EB5 and ECH147 on the Expression of Selected TGFβ Superfamily Genes, TGFβ1, GDF15 and BMP2, in Renal Proximal Tubule Epithelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. EB5 and ECH147
2.2. Cell Culture Conditions and Treatment
2.3. Assessment of mRNA Levels of TGFβ1, BMP2 and GDF15 Genes in Culture Media
2.4. Assessment of Protein Levels
2.5. Statistical Analyses
3. Results
3.1. mRNA Levels of TGFβ1
3.2. mRNA Levels of BMP2
3.3. mRNA Levels of GDF15
3.4. Protein Levels of TGFβ1
3.5. Protein Levels of BMP2
3.6. Protein Levels of GDF15
4. Discussion
4.1. Importance of Nephrotoxicity Studies and the Use of Selected Betulin Derivatives
4.2. Betulin Derivatives Affect the Level of TGFβ1
4.3. Betulin Derivatives Reduce BMP2 Levels
4.4. Raised Levels of GDF15 in Response to Betulin Derivatives
4.5. Limitations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Patočka, J. Biologically active pentacyclic triterpenes and their current medicine signification. J. Appl. Biomed. 2003, 1, 7–12. [Google Scholar] [CrossRef]
- Bai, Y.-H.; Feng, Y.-Q.; Mao, D.-B.; Xu, C.-P. Optimization for betulin production from mycelial culture of Inonotus obliquus by orthogonal design and evaluation of its antioxidant activity. J. Taiwan Inst. Chem. Eng. 2012, 43, 663–669. [Google Scholar] [CrossRef]
- Szlasa, W.; Ślusarczyk, S.; Nawrot-Hadzik, I.; Abel, R.; Zalesińska, A.; Szewczyk, A.; Sauer, N.; Preissner, R.; Saczko, J.; Drąg, M.; et al. Betulin and Its Derivatives Reduce Inflammation and COX-2 Activity in Macrophages. Inflammation 2023, 46, 573–583. [Google Scholar] [CrossRef] [PubMed]
- Sun, I.-C.; Wang, H.-K.; Kashiwada, Y.; Shen, J.-K.; Cosentino, L.M.; Chen, C.-H.; Yang, L.-M.; Lee, K.-H. Anti-AIDS Agents. 34. Synthesis and Structure−Activity Relationships of Betulin Derivatives as Anti-HIV Agents. J. Med. Chem. 1998, 41, 4648–4657. [Google Scholar] [CrossRef]
- Pavlova, N.; Savinova, O.; Nikolaeva, S.; Boreko, E.; Flekhter, O. Antiviral activity of betulin, betulinic and betulonic acids against some enveloped and non-enveloped viruses. Fitoterapia 2003, 74, 489–492. [Google Scholar] [CrossRef] [PubMed]
- Zdzisińska, B.; Szuster-Ciesielska, A.M.; Rzeski, W.; Kanderfer-Szerszen, M. Therapeutic properties of betulin and betulinic acid, components of birch bark extract [właściwości lecznicze betuliny i kwasu betulinowego, składników ekstraktu z kory brzozy]. Farm. Prz. Nauk. 2010, 7. Available online: https://bazawiedzy.umcs.pl/info/article/UMCS8dc83de6352d44e5aafcd8fb84717a5b/ (accessed on 17 October 2023).
- Krol, S.K.; Kiełbus, M.; Rivero-Müller, A.; Stepulak, A. Comprehensive Review on Betulin as a Potent Anticancer Agent. BioMed Res. Int. 2015, 2015, 584189. [Google Scholar] [CrossRef]
- Trumbull, E.; Bianchi, E.; Eckert, D.; Wiedhopf, R.; Cole, J. Tumor Inhibitory Agents from Vauquelinia corymbosa (Rosaceae). J. Pharm. Sci. 1976, 65, 1407–1408. [Google Scholar] [CrossRef]
- Jäger, S.; Laszczyk, M.N.; Scheffler, A. A preliminary pharmacokinetic study of betulin, the main pentacyclic triterpene from extract of outer bark of birch (Betulae alba cortex). Molecules 2008, 13, 3224–3235. [Google Scholar] [CrossRef]
- Amiri, S.; Dastghaib, S.; Ahmadi, M.; Mehrbod, P.; Khadem, F.; Behrouj, H.; Aghanoori, M.R.; Machaj, F.; Ghamsari, M.; Rosik, J.; et al. Betulin and its derivatives as novel compounds with different pharmacological effects. Biotechnol. Adv. 2020, 38, 107409. [Google Scholar] [CrossRef]
- Kaps, A.; Chodurek, E.; Orchel, A.; Jaworska-Kik, M.; Bębenek, E.; Boryczka, S.; Kasperczyk, J. Influence of 28-O-propynoylbetulin on proliferation and apoptosis of melanotic and amelanotic human melanoma cells. Adv. Hyg. Exp. Med. 2016, 70, 1404–1408. [Google Scholar]
- Chrobak, E.; Bębenek, E.; Kadela-Tomanek, M.; Latocha, M.; Jelsch, C.; Wenger, E.; Boryczka, S. Betulin Phosphonates; Synthesis, Structure, and Cytotoxic Activity. Molecules 2016, 21, 1123. [Google Scholar] [CrossRef] [PubMed]
- Chrobak, E.; Kadela-Tomanek, M.; Bębenek, E.; Marciniec, K.; Wietrzyk, J.; Trynda, J.; Pawełczak, B.; Kusz, J.; Kasperczyk, J.; Chodurek, E.; et al. New phosphate derivatives of betulin as anticancer agents: Synthesis, crystal structure, and molecular docking study. Bioorganic Chem. 2019, 87, 613–628. [Google Scholar] [CrossRef] [PubMed]
- Orchel, A.; Kulczycka, A.; Chodurek, E.; Bębenek, E.; Borkowska, P.; Boryczka, S.; Kowalski, J.; Dzierżewicz, Z. Influence of betulin and 28-O-propynoylbetulin on proliferation and apoptosis of human melanoma cells (G-361). Adv. Hyg. Exp. Med. 2014, 68, 191–197. [Google Scholar] [CrossRef]
- Kruszniewska-Rajs, C.; Strzałka-Mrozik, B.; Kimsa-Dudek, M.; Synowiec-Wojtarowicz, A.; Chrobak, E.; Bębenek, E.; Boryczka, S.; Głuszek, S.; Gola, J.M. The Influence of Betulin and Its Derivatives EB5 and ECH147 on the Antioxidant Status of Human Renal Proximal Tubule Epithelial Cells. Int. J. Mol. Sci. 2022, 23, 2524. [Google Scholar] [CrossRef] [PubMed]
- Christiansen, C.F.; Johansen, M.B.; Langeberg, W.J.; Fryzek, J.P.; Sørensen, H.T. Incidence of acute kidney injury in cancer patients: A Danish population-based cohort study. Eur. J. Intern. Med. 2011, 22, 399–406. [Google Scholar] [CrossRef]
- Porta, C.; Cosmai, L.; Gallieni, M.; Pedrazzoli, P.; Malberti, F. Renal effects of targeted anticancer therapies. Nat. Rev. Nephrol. 2015, 11, 354–370. [Google Scholar] [CrossRef] [PubMed]
- Schnaper, H.W.; Schnaper, H.W.; Jandeska, S.; Runyan, C.E.; Hubchak, S.C.; Basu, R.K.; Curley, J.F.; Smith, R.D.; Hayashida, T. TGF-beta signal transduction in chronic kidney disease. Front. Biosci. 2009, 14, 2448–2465. [Google Scholar] [CrossRef]
- Choi, M.E.; Ding, Y.; Kim, S.I. TGF-β signaling via TAK1 pathway: Role in kidney fibrosis. Semin. Nephrol. 2012, 32, 244–252. [Google Scholar] [CrossRef]
- Boor, P.; Floege, J. Chronic kidney disease growth factors in renal fibrosis. Clin. Exp. Pharmacol. Physiol. 2011, 38, 441–450. [Google Scholar] [CrossRef]
- Lan, H.Y.; Chung, A.C.-K. TGF-β/Smad Signaling in Kidney Disease. Semin. Nephrol. 2012, 32, 236–243. [Google Scholar] [CrossRef] [PubMed]
- Gewin, L.; Zent, R. How Does TGF-β Mediate Tubulointerstitial Fibrosis? Semin. Nephrol. 2012, 32, 228–235. [Google Scholar] [CrossRef] [PubMed]
- Bo, E.P.; Bitzer, M. TGF-ß Signaling in Renal Disease. J. Am. Soc. Nephrol. 2002, 13, 2600–2610. [Google Scholar] [CrossRef]
- Rodríguez-Barbero, A.; Obreo, J.; Yuste, L.; Montero, J.; Rodríguez-Peña, A.; Pandiella, A.; Bernabéu, C.; López-Novoa, J. Transforming growth factor-β1 induces collagen synthesis and accumulation via p38 mitogen-activated protein kinase (MAPK) pathway in cultured L6E9 myoblasts. FEBS Lett. 2002, 513, 282–288. [Google Scholar] [CrossRef]
- Lim, A.K.H.; Nikolic-Paterson, D.J.; Ma, F.Y.; Ozols, E.; Thomas, M.C.; Flavell, R.A.; Davis, R.J.; Tesch, G.H. Role of MKK3–p38 MAPK signalling in the development of type 2 diabetes and renal injury in obese db/db mice. Diabetologia 2009, 52, 347–358. [Google Scholar] [CrossRef]
- Adhikary, L.; Chow, F.; Nikolic-Paterson, D.J.; Stambe, C.; Dowling, J.; Atkins, R.C.; Tesch, G.H. Abnormal p38 mitogen-activated protein kinase signalling in human and experimental diabetic nephropathy. Diabetologia 2004, 47, 1210–1222. [Google Scholar] [CrossRef]
- Koesters, R.; Kaissling, B.; LeHir, M.; Picard, N.; Theilig, F.; Gebhardt, R.; Glick, A.B.; Hähnel, B.; Hosser, H.; Gröne, H.-J.; et al. Tubular overexpression of transforming growth factor-β1 induces autophagy and fibrosis but not mesenchymal transition of renal epithelial cells. Am. J. Pathol. 2010, 177, 632–643. [Google Scholar] [CrossRef]
- Shull, M.M.; Ormsby, I.; Kier, A.B.; Pawlowski, S.; Diebold, R.J.; Yin, M.Y.; Allen, R.; Sidman, C.; Proetzel, G.; Calvin, D.; et al. Targeted disruption of the mouse transforming growth factor-β1 gene results in multifocal inflammatory disease. Nature 1992, 359, 693–699. [Google Scholar] [CrossRef] [PubMed]
- Vincenzi, B.; Armento, G.; Ceruso, M.S.; Catania, G.; Leakos, M.; Santini, D.; Minotti, G.; Tonini, G. Drug-induced hepatotoxicity in cancer patients—Implication for treatment. Expert Opin. Drug Saf. 2016, 15, 1219–1238. [Google Scholar] [CrossRef] [PubMed]
- Koutsoukis, A.; Ntalianis, A.; Repasos, E.; Kastritis, E.; Dimopoulos, M.-A.; Paraskevaidis, I. Cardio-oncology: A Focus on Cardiotoxicity. Eur. Cardiol. Rev. 2018, 13, 64–69. [Google Scholar] [CrossRef] [PubMed]
- Gola, J.; Strzałka-Mrozik, B.; Wieczorek, E.; Kruszniewska-Rajs, C.; Adamska, J.; Gagoś, M.; Czernel, G.; Mazurek, U. Amphotericin B–copper (II) complex alters transcriptional activity of genes encoding transforming growth factor-beta family members and related proteins in renal cells. Pharmacol. Rep. 2017, 69, 1308–1314. [Google Scholar] [CrossRef] [PubMed]
- Bartram, U.; Speer, C.P. The role of transforming growth factor β in lung development and disease. Chest 2004, 125, 754–765. [Google Scholar] [CrossRef]
- Kim, K.K.; Sheppard, D.; Chapman, H.A. TGF-β1 Signaling and Tissue Fibrosis. Cold Spring Harb. Perspect. Biol. 2018, 10, a022293. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.-L.; Liu, Y.-S.; Chuang, L.-Y.; Guh, J.-Y.; Lee, T.-C.; Liao, T.-N.; Hung, M.-Y.; Chiang, T.-A. Bone morphogenetic protein-2 antagonizes renal interstitial fibrosis by promoting catabolism of type I transforming growth factor-β receptors. Endocrinology 2009, 150, 727–740. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.-L.; Ju, H.-Z.; Liu, S.-F.; Lee, T.-C.; Shih, Y.-W.; Chuang, L.-Y.; Guh, J.-Y.; Yang, Y.-Y.; Liao, T.-N.; Hung, T.-J.; et al. BMP-2 suppresses renal interstitial fibrosis by regulating epithelial-mesenchymal transition. J. Cell. Biochem. 2011, 112, 2558–2565. [Google Scholar] [CrossRef]
- Zeisberg, E.M.; Tarnavski, O.; Zeisberg, M.; Dorfman, A.L.; McMullen, J.R.; Gustafsson, E.; Chandraker, A.; Yuan, X.; Pu, W.T.; Roberts, A.B.; et al. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat. Med. 2007, 13, 952–961. [Google Scholar] [CrossRef]
- Breit, S.N.; Carrero, J.J.; Tsai, V.W.-W.; Yagoutifam, N.; Luo, W.; Kuffner, T.; Bauskin, A.R.; Wu, L.; Jiang, L.; Bárány, P.; et al. Macrophage inhibitory cytokine-1 (MIC-1/GDF15) and mortality in end-stage renal disease. Nephrol. Dial. Transplant. 2011, 27, 70–75. [Google Scholar] [CrossRef]
- Yanaba, K.; Asano, Y.; Tada, Y.; Sugaya, M.; Kadono, T.; Sato, S. Clinical significance of serum growth differentiation factor-15 levels in systemic sclerosis: Association with disease severity. Mod. Rheumatol. 2012, 22, 668–675. [Google Scholar] [CrossRef]
- Zhang, Y.; Jiang, M.; Nouraie, M.; Roth, M.G.; Tabib, T.; Winters, S.; Chen, X.; Sembrat, J.; Chu, Y.; Cardenes, N.; et al. GDF15 is an epithelial-derived biomarker of idiopathic pulmonary fibrosis. Am. J. Physiol. Cell. Mol. Physiol. 2019, 317, L510–L521. [Google Scholar] [CrossRef]
- Boryczka, S.; Bębenek, E.; Wietrzyk, J.; Kempińska, K.; Jastrzębska, M.; Kusz, J.; Nowak, M. Synthesis, structure and cytotoxic activity of new acetylenic derivatives of betulin. Molecules 2013, 18, 4526–4543. [Google Scholar] [CrossRef]
- Strzalka-Mrozik, B.; Stanik-Walentek, A.; Kapral, M.; Kowalczyk, M.; Adamska, J.; Gola, J.; Mazurek, U. Differential expression of transforming growth factor-β isoforms in bullous keratopathy corneas. Mol. Vis. 2010, 16, 161–166. [Google Scholar]
- Chawla, L.S.; Bellomo, R.; Bihorac, A.; Goldstein, S.L.; Siew, E.D.; Bagshaw, S.M.; Bittleman, D.; Cruz, D.; Endre, Z.; Fitzgerald, R.L.; et al. Acute kidney disease and renal recovery: Consensus report of the Acute Disease Quality Initiative (ADQI) 16 Workgroup. Nat. Rev. Nephrol. 2017, 13, 241–257. [Google Scholar] [CrossRef]
- Campbell, G.A.; Hu, D.; Okusa, M.D. Acute Kidney Injury in the Cancer Patient. Adv. Chronic Kidney Dis. 2014, 21, 64–71. [Google Scholar] [CrossRef]
- Xu, T.; Pang, Q.; Wang, Y.; Yan, X. Betulinic acid induces apoptosis by regulating PI3K/Akt signaling and mitochondrial pathways in human cervical cancer cells. Int. J. Mol. Med. 2017, 40, 1669–1678. [Google Scholar] [CrossRef]
- Rzeski, W.; Stepulak, A.; Szymański, M.; Juszczak, M.; Grabarska, A.; Sifringer, M.; Kaczor, J.; Kandefer-Szerszeń, M. Betulin elicits anti-cancer effects in tumour primary cultures and cell lines in vitro. Basic Clin. Pharmacol. Toxicol. 2009, 105, 425–432. [Google Scholar] [CrossRef]
- Rzeski, W.; Stepulak, A.; Szymański, M.; Sifringer, M.; Kaczor, J.; Wejksza, K.; Zdzisińska, B.; Kandefer-Szerszeń, M. Betulinic acid decreases expression of bcl-2 and cyclin D1, inhibits proliferation, migration and induces apoptosis in cancer cells. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2006, 374, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Li, R.; Pawlak, A.; Henklewska, M.; Sysak, A.; Wen, L.; Yi, J.-E.; Obmińska-Mrukowicz, B. Antitumor Activity of Betulinic Acid and Betulin in Canine Cancer Cell Lines. Vivo 2018, 32, 1081–1088. [Google Scholar] [CrossRef] [PubMed]
- Zuco, V.; Supino, R.; Righetti, S.C.; Cleris, L.; Marchesi, E.; Gambacorti-Passerini, C.; Formelli, F. Selective cytotoxicity of betulinic acid on tumor cell lines, but not on normal cells. Cancer Lett. 2002, 175, 17–25. [Google Scholar] [CrossRef] [PubMed]
- Zehra, B.; Ahmed, A.; Sarwar, R.; Khan, A.; Farooq, U.; Ali, S.A.; Al-Harrasi, A. Apoptotic and antimetastatic activities of betulin isolated from Quercus incana against non-small cell lung cancer cells. Cancer Manag. Res. 2019, 11, 1667–1683. [Google Scholar] [CrossRef] [PubMed]
- Małaczewska, J.; Kaczorek-Łukowska, E.; Kazuń, B. High cytotoxicity of betulin towards fish and murine fibroblasts: Is betulin safe for nonneoplastic cells? BMC Veter- Res. 2021, 17, 198. [Google Scholar] [CrossRef] [PubMed]
- Su, H.; Wan, C.; Song, A.; Qiu, Y.; Xiong, W.; Zhang, C. Oxidative Stress and Renal Fibrosis: Mechanisms and Therapies. Adv. Exp. Med. Biol. 2019, 1165, 585–604. [Google Scholar] [CrossRef] [PubMed]
- Richter, K.; Konzack, A.; Pihlajaniemi, T.; Heljasvaara, R.; Kietzmann, T. Redox-fibrosis: Impact of TGFβ1 on ROS generators, mediators and functional consequences. Redox Biol. 2015, 6, 344–352. [Google Scholar] [CrossRef]
- Cheng, Z.; Teo, G.; Krueger, S.; Rock, T.M.; Koh, H.W.; Choi, H.; Vogel, C. Differential dynamics of the mammalian mRNA and protein expression response to misfolding stress. Mol. Syst. Biol. 2016, 12, 855. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.; Hu, Y. TGF-β1: Gentlemanly orchestrator in idiopathic pulmonary fibrosis (Review). Int. J. Mol. Med. 2021, 48, 132. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Sharma, S.; Zhu, L.X.; Keane, M.P.; Luo, J.; Zhang, L.; Burdick, M.D.; Lin, Y.Q.; Dohadwala, M.; Gardner, B.; et al. IL-7 inhibits fibroblast TGF-β production and signaling in pulmonary fibrosis. J. Clin. Investig. 2002, 109, 931–937. [Google Scholar] [CrossRef] [PubMed]
- Strutz, F.; Okada, H.; Lo, C.W.; Danoff, T.; Carone, R.L.; Tomaszewski, J.E.; Neilson, E.G. Identification and characterization of a fibroblast marker: FSP1. J. Cell Biol. 1995, 130, 393–405. [Google Scholar] [CrossRef]
- Bucala, R.; Spiegel, L.A.; Chesney, J.; Hogan, M.; Cerami, A. Circulating fibrocytes define a new leukocyte subpopulation that mediates tissue repair. Mol. Med. 1994, 1, 71–81. [Google Scholar] [CrossRef]
- Rønnov-Jessen, L.; Petersen, O.W.; Koteliansky, V.E.; Bissell, M.J. The origin of the myofibroblasts in breast cancer. Recapitulation of tumor environment in culture unravels diversity and implicates converted fibroblasts and recruited smooth muscle cells. J. Clin. Investig. 1995, 95, 859–873. [Google Scholar] [CrossRef]
- Lin, S.-L.; Kisseleva, T.; Brenner, D.A.; Duffield, J.S. Pericytes and perivascular fibroblasts are the primary source of collagen-producing cells in obstructive fibrosis of the kidney. Am. J. Pathol. 2008, 173, 1617–1627. [Google Scholar] [CrossRef]
- Robertson, I.B.; Rifkin, D.B. Regulation of the Bioavailability of TGF-β and TGF-β-Related Proteins. Cold Spring Harb. Perspect. Biol. 2016, 8, a021907. [Google Scholar] [CrossRef]
- Jobling, M.F.; Mott, J.D.; Finnegan, M.T.; Jurukovski, V.; Erickson, A.C.; Walian, P.J.; Taylor, S.E.; Ledbetter, S.; Lawrence, C.M.; Rifkin, D.B.; et al. Isoform-specific activation of latent transforming growth factor β (LTGF-β) by reactive oxygen species. Radiat. Res. 2006, 166, 839–848. [Google Scholar] [CrossRef]
- Liu, R.-M.; Desai, L.P. Reciprocal regulation of TGF-β and reactive oxygen species: A perverse cycle for fibrosis. Redox Biol. 2015, 6, 565–577. [Google Scholar] [CrossRef] [PubMed]
- Barnes, J.L.; Gorin, Y. Myofibroblast differentiation during fibrosis: Role of NAD(P)H oxidases. Kidney Int. 2011, 79, 944–956. [Google Scholar] [CrossRef] [PubMed]
- Chung, Y.-H.; Huang, Y.-H.; Chu, T.-H.; Chen, C.-L.; Lin, P.-R.; Huang, S.-C.; Wu, D.-C.; Huang, C.-C.; Hu, T.-H.; Kao, Y.-H.; et al. BMP-2 restoration aids in recovery from liver fibrosis by attenuating TGF-β1 signaling. Lab. Investig. 2018, 98, 999–1013. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Cao, Y.; Yang, W.; Duan, C.; Aronson, J.F.; Rastellini, C.; Chao, C.; Hellmich, M.R.; Ko, T.C.; Han, S.; et al. BMP2 inhibits TGF-β-induced pancreatic stellate cell activation and extracellular matrix formation. Am. J. Physiol. Liver Physiol. 2013, 304, G804–G813. [Google Scholar] [CrossRef] [PubMed]
- Nair, V.; Robinson-Cohen, C.; Smith, M.R.; Bellovich, K.A.; Bhat, Z.Y.; Bobadilla, M.; Brosius, F.; de Boer, I.H.; Essioux, L.; Formentini, I.; et al. Growth Differentiation Factor–15 and Risk of CKD Progression. J. Am. Soc. Nephrol. 2017, 28, 2233–2240. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, S.; Yamazaki, H.; Imamura, T.; Fujioka, H.; Kakeshita, K.; Koike, T.; Kinugawa, K. Implication of serum growth differentiation factor-15 level in patients with renal diseases. Int. Urol. Nephrol. 2023, 55, 2935–2941. [Google Scholar] [CrossRef]
- Oller-Rodríguez, J.E.; Bernabeu, E.V.; Gonzalez-Mazarío, R.; García, E.G.; Sanjuan, F.M.O.; Ivorra, J.A.R. Utility of cytokines CXCL4, CXCL8 and GDF15 as biomarkers in systemic sclerosis. Med. Clínica 2022, 159, 359–365. [Google Scholar] [CrossRef] [PubMed]
- Valiño-Rivas, L.; Cuarental, L.; Ceballos, M.I.; Pintor-Chocano, A.; Perez-Gomez, M.V.; Sanz, A.B.; Ortiz, A.; Sanchez-Niño, M.D. Growth differentiation factor-15 preserves Klotho expression in acute kidney injury and kidney fibrosis. Kidney Int. 2022, 101, 1200–1215. [Google Scholar] [CrossRef]
- Kuro-O, M. The Klotho proteins in health and disease. Nat. Rev. Nephrol. 2019, 15, 27–44. [Google Scholar] [CrossRef]
- Moreno, J.A.; Izquierdo, M.C.; Sanchez-Niño, M.D.; Suárez-Alvarez, B.; Lopez-Larrea, C.; Jakubowski, A.; Blanco, J.; Ramirez, R.; Selgas, R.; Ruiz-Ortega, M.; et al. The inflammatory cytokines TWEAK and TNFα reduce renal klotho expression through NFκB. J. Am. Soc. Nephrol. 2011, 22, 1315–1325. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Bi, X.; Xiong, J.; Han, W.; Xiao, T.; Xu, X.; Yang, K.; Liu, C.; Jiang, W.; He, T.; et al. MicroRNA-34a Promotes Renal Fibrosis by Downregulation of Klotho in Tubular Epithelial Cells. Mol. Ther. 2019, 27, 1051–1065. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.-I.; Shin, H.-W.; Chun, Y.-S.; Park, J.-W. CST3 and GDF15 ameliorate renal fibrosis by inhibiting fibroblast growth and activation. Biochem. Biophys. Res. Commun. 2018, 500, 288–295. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequences | Length of the PCR Product (bp) |
---|---|---|
TGFβ1 | F: 5′TGAACCGGCCTTTCCTGCTTCTCATG3′ R: 5′GCGGAAGTCAATGTACAGCTGCCGC3′ | 152 |
BMP2 | F: 5′GTTCGGCCTGAAACAGAGAC3′ R: 5′GAATCTCCGGGTTGTTTTCC′ | 217 |
GDF15 | F: 5′CGGTGAATGGCTCTCAGATG3′ R: 5′CAGGTCCTCGTAGCGTTTCC3′ | 167 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kubica, S.; Szota-Czyż, J.; Strzałka-Mrozik, B.; Adamska, J.; Bębenek, E.; Chrobak, E.; Gola, J.M. The Influence of Betulin Derivatives EB5 and ECH147 on the Expression of Selected TGFβ Superfamily Genes, TGFβ1, GDF15 and BMP2, in Renal Proximal Tubule Epithelial Cells. Curr. Issues Mol. Biol. 2023, 45, 9961-9975. https://doi.org/10.3390/cimb45120622
Kubica S, Szota-Czyż J, Strzałka-Mrozik B, Adamska J, Bębenek E, Chrobak E, Gola JM. The Influence of Betulin Derivatives EB5 and ECH147 on the Expression of Selected TGFβ Superfamily Genes, TGFβ1, GDF15 and BMP2, in Renal Proximal Tubule Epithelial Cells. Current Issues in Molecular Biology. 2023; 45(12):9961-9975. https://doi.org/10.3390/cimb45120622
Chicago/Turabian StyleKubica, Sebastian, Justyna Szota-Czyż, Barbara Strzałka-Mrozik, Jolanta Adamska, Ewa Bębenek, Elwira Chrobak, and Joanna Magdalena Gola. 2023. "The Influence of Betulin Derivatives EB5 and ECH147 on the Expression of Selected TGFβ Superfamily Genes, TGFβ1, GDF15 and BMP2, in Renal Proximal Tubule Epithelial Cells" Current Issues in Molecular Biology 45, no. 12: 9961-9975. https://doi.org/10.3390/cimb45120622