Next Article in Journal / Special Issue
Structure and Phylogenetic Relationships of Scolopacidae Mitogenomes (Charadriiformes: Scolopacidae)
Previous Article in Journal
Molecular Biomarkers of Canine Reproductive Functions
Previous Article in Special Issue
Complete Mitogenome of “Pumpo” (Bos taurus), a Top Bull from a Peruvian Genetic Nucleus, and Its Phylogenetic Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 46
Issue 6
10.3390/cimb46060368
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Approaches Detect Early Signals of Programmed Cell Death in Hippolyte inermis Leach

by
Francesca Glaviano
1,
Roberta Esposito
2,
Emanuele Somma
1,3,
Amir Sagi
4,
Eliahu D. Aflalo
4,5,
Maria Costantini
2,*,† and
Valerio Zupo
1,*,†
1
Department of Integrative Marine Ecology, Ischia Marine Centre, Stazione Zoologica Anton Dohrn, 80077 Ischia, Italy
2
Department of Ecosustainable Marine Biotechnology, Stazione Zoologica Anton Dohrn, Via Ammiraglio Ferdinando Acton n. 55, 80133 Naples, Italy
3
Department of Life Science, University of Trieste, Via L. Giorgieri, 10, 34127 Trieste, Italy
4
Department of Life Sciences, Ben-Gurion University of the Negev, P.O. Box 653, Beer-Sheva 8410501, Israel
5
Department of Life Sciences, Achva Academic College, Arugot 7980400, Israel
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Curr. Issues Mol. Biol. 2024, 46(6), 6169-6185; https://doi.org/10.3390/cimb46060368
Submission received: 20 May 2024 / Revised: 11 June 2024 / Accepted: 14 June 2024 / Published: 18 June 2024
(This article belongs to the Special Issue Mitochondrial Genome 2024)
Browse Figures
Versions Notes

Abstract

:
The protandric shrimp Hippolyte inermis is the only known marine invertebrate whose sex determination is strongly influenced by the composition of its food. In H. inermis, a sex reversal is triggered by the ingestion of diatoms of the genus Cocconeis associated with leaves of the seagrass Posidonia oceanica. These diatoms contain compounds that promote programmed cell death (PCD) in H. inermis and also in human cancer cells. Transcriptomic analyses suggested that ferroptosis is the primary trigger of the shrimp’s sex reversal, leading to the rapid destruction of the androgen gland (AG) followed by a chain of apoptotic events transforming the testes into ovaries. Here, we propose a molecular approach to detect the effects of compounds stimulating the PCD. An RNA extraction method, suitable for young shrimp post-larvae (five days after metamorphosis; PL5 stage), was established. In addition, six genes involved in apoptosis, four involved in ferroptosis, and seven involved in the AG switch were mined from the transcriptome, and their expression levels were followed using real-time qPCR in PL5 fed on Cocconeis spp., compared to PL5 fed on a basic control feed. Our molecular approach, which detected early signals of sex reversal, represents a powerful instrument for investigating physiological progression and patterns of PCD in marine invertebrates. It exemplifies the physiological changes that may start a few days after the settlement of post-larvae and determine the life destiny of an individual.

Graphical Abstract

1. Introduction

Model organisms permit us to investigate biological processes [1] in several research areas, including ecotoxicology, molecular biology, and evolutionary developmental biology, and may be leveraged to provide data for biotechnological applications [2,3]. As a result, specific tools and detailed protocols have become widely available in the literature [4]. In this context, crustaceans are often employed as models in the study of sexual differentiation and development by virtue of the functions of their androgenic gland (AG), a unique crustacean endocrine organ that secretes an insulin-like androgenic hormone (IAG) [5,6], which acts as a ‘switch’ for sexual development [7,8,9,10,11,12]. In fact, the simple presence of an AG triggers the development of males, while the absence of this gland (or its destruction in protandric species) triggers the development of females. Importantly, despite the need for laborious maintenance in the laboratory, some species are used as models because they are the only known targets for specific compounds, or because they may be used to investigate peculiar physiological pathways [13,14]. One such species is Hippolyte inermis Leach, a protandric shrimp living mainly on the leaves of the Mediterranean seagrass Posidonia oceanica [15]. We note that although the sex differentiation of crustaceans has been investigated in many species [16,17,18], H. inermis represents a peculiar case [19,20] because it undergoes a process of sex reversal triggered by the ingestion of diatoms [21]. A bioactive compound produced by diatoms upon wounding [22] triggers early development of H. inermis towards femaleness, as a result of coevolutionary processes within the leaf stratum of P. oceanica and other seagrasses [21,23]. H. inermis is characterized by two reproductive bursts [22], one taking place in the spring, and the other in the fall. In the spring, both males and females are born, while the fall season produces only males, which undergo sex reversal after about one year [23]. The presence of young females in spring is due to an early sex reversal triggered by the ingestion of diatoms of the genus Cocconeis [21], which are particularly abundant in that season [23]. This change is a consequence of a programmed cell-death (PCD) trigger directed selectively towards AG cells [24,25]. The chemical structure of the bioactive compound is still under investigation, but it is known to be a small lipophilic compound [26], probably similar to dihomo-γ-linolenic acid (DGLA) [27].
Bioassays using H. inermis require complex culture practices [28], because the sex ratio of animals fed on diatom fractions is evaluated 50–60 days after hatching, when it is possible to detect the activity of cell-death compounds. This procedure requires the sacrifice of mature shrimps and their analysis under a stereomicroscope to check for the presence of an appendix masculina on the second pleopod [18,22,29]. Molecular tools for H. inermis are, at present, very scarce, but Levy et al. [30] have obtained transcriptomic libraries of representative development stages (immature, male, young female and mature female). However, previous studies [27] revealed a set of genes influenced by the ingestion of diatoms, demonstrating the remarkable role of ferroptosis as a form of PCD specifically acting on still undifferentiated gland tissues. This mechanism appears to be a smart physiologic strategy to produce massive changes in the physiology of an invertebrate by targeting a few young cells, and it has been demonstrated to be evolutionarily conserved, from Caenorabditis elegans to humans [27] and, of course, is present in the model shrimp H. inermis. In this crustacean, several genes are activated by the ingestion of diatoms, and they are involved in ferroptosis of the AG, the apoptosis of the testes, and the activation of the IAG. Remarkably, diatom ingestion triggers most physiological changes in young post-larvae just 5 days post-metamorphosis (PL5). In particular, it was demonstrated [27] that the whole process of sex reversal in this protandric species is completed within the first 2 weeks of post-larval development and that 5 days after the metamorphosis was the optimal stage at which to detect genic changes involved in the destruction of the AG and the consequent start of the ovary development, upon the feeding on diatoms. In the present experimental work, aimed at investigating the effects of natural compounds triggering PCD in selected shrimp tissues, an RNA extraction method was developed for the PL5 stage. Furthermore, several genes involved in apoptosis, ferroptosis, and insulin-like secretion, previously demonstrated to be involved in the sex reversal of H. inermis, were isolated from the transcriptome. Their expression levels were followed by real-time qPCR in PL5 fed on Cocconeis spp., as compared to PL5 fed on a basic feed (without diatoms). These data were compared with those obtained from the transcriptome [27] to investigate the physiological responses ruled by PCD and their functional relationships by means of interactomic analyses.

2. Materials and Methods

2.1. Sample Collection and Culture Practices

Ovigerous females of H. inermis were collected at Lacco Ameno, Ischia (Bay of Naples, Italy; 40°44′56″ N, 13°53′13″ E) in a P. oceanica meadow. Samples were screened under a Leica MZ6 stereomicroscope (Leica Microsystems, Milan, Italy) to confirm the taxonomical identification of shrimps, based on their morphological characters [23]. H. inermis ovigerous females were individually reared in a thermostatic chamber (18 °C) in aerated 2 L conical flasks filled with filtered (0.45 µm) seawater, until the release of larvae. Larvae were collected with Pasteur pipettes, pooled in groups of 80 individuals, and transferred to 1 L conical flasks containing 800 mL of filtered (0.45 µm) seawater (1 larva per 10 mL of seawater). Larval cultures were maintained in the same thermostatic chamber (18 °C) for 25 days (Figure 1). During this period, the seawater in each conical flask was changed every other day. Larvae were fed on Artemia salina (4 nauplii per mL) and Brachionus plicatilis (4 individuals per mL) up to their settlement, and larval foods were replaced every other day. After the settlement, the post larvae were transferred to 500 mL crystallization dishes in groups of 25 individuals and shifted onto the experimental diets. Following the method proposed by Zupo et al. [27], this phase lasted for 5 days. Post-larvae used as negative controls (designated Diatom –) were fed on a basic feed composed of dried A. salina, SHG Hi-Red, dried Spirulina, and SHG Microperle in equal amounts (Figure 1). Post-larvae used for the treatment (designated Diatom +) were fed on the basic feed enriched with 30% (by weight) lyophilized Cocconeis scutellum var. parva [25]. Five days after settlement (PL5 stage), 75 post-larvae deriving from 3 treatment and 3 control replicates (Table 1) were sacrificed and individually fixed in RNAlater (RNA Stabilization Reagent, Qiagen, Hilden, Germany).
In parallel, other settled post-larvae deriving from the larval cultures were transferred in pools of 25 individuals into three replicates in 500 mL crystallization dishes for the control diet (Diatom −) and 3 replicates for the treatment diet (Diatom +). In this case, however, the post-larvae were cultured for 45 days, up to complete sex maturation (Table 1). At the end of the experiment, adult shrimps (having a total length greater than 7.0 mm) were fixed in 70% ethanol and further examined to determine their sex. Sex analysis was performed under a Leica MZ6 stereomicroscope (Leica Microsystems, Milan, Italy) by ablating the second pleopod, which was examined on a freshly prepared slide, under a Leica DMLB optical microscope (Leica Microsystems, Milan, Italy). The presence of an appendix masculina [31] indicates a male animal [23]. To validate the transcriptomic results, further analyses performed on the PL5 consisted of monitoring the expression of genes in males, deriving them from negative controls (Diatom −), and in females, deriving them from treatments with feed containing diatoms (Diatom +). The data collected on the sex ratios in each replicate were expressed as the number of females compared to the total number of mature individuals (F/mat%; [9]), for both control and treated individuals.

2.2. RNA Extraction and cDNA Synthesis

Two methods of RNA extraction were compared, and they were both tested on a variable number of individuals (viz, 1, 2, 3, and 4 PL5, respectively). The first method employed the RNeasy Mini Kit. In this case, post-larvae were lysed using a variable quantity of RLT/2-ME buffer (10 μL β-mercaptoethanol for each mL of RLT buffer), according to the number of PL5: 350 μL for 1 PL, 400 μL for 2 PL, 450 μL for 3 PL, and 600 μL for 5 PL. Samples were homogenized with TissueLyser (Qiagen, Austin, TX, USA), using 3 mm sterile aluminium beads at 20.1 Hz for 3 min. RNA was extracted following the manufacturer protocol (Qiagen, Austin, TX, USA) and eluted with 30 μL RNase-free water, then stored at −80 °C. The second method employed a PureLink™ RNA Mini Kit. Post-larvae were lysed in lysis buffer (containing β–mercaptoethanol, according to the number of PL5: 350 μL for 1 PL, 400 μL for 2 PL, 450 μL for 3 PL, and 600 μL for 5 PL) in TissueLyser (Qiagen, USA) using 3 mm sterile aluminium beads at 20 Hz for 3 min. RNA was extracted according to the manufacturer’s protocol (Thermo Fisher Scientific, Waltham, MA, USA). RNA was eluted with 30 μL of RNase-free water provided by the kit. The samples obtained were then stored at −80 °C.
The quality of total RNA extracted using both methods was estimated by Nanodrop (ND-1000 UV Vis, NanoDrop Technologies, Wilmington, DE, USA), measuring the absorbance at 260 nm and 260/230 and 260/280 nm ratios, to exclude the presence of proteins, phenols, and other contaminants. The integrity of the RNA was finally assessed by running 100–200 ng of RNA samples on 0.8% agarose gel. For each sample, 600 ng of total RNA extracted was retrotranscribed with an iScript cDNA synthesis kit (Bio-Rad, Milan, Italy), according to the manufacturer’s instructions. In terms of the amount of total RNA extracted, we found that the RNeasy kit was the most efficient method, with respect to the PureLink™ RNA Mini Kit, and it was used to analyze both the Diatom + and Diatom − groups.

2.3. Identification of Genes

The sequences of 17 genes belonging to 3 specific molecular pathways, i.e., ferroptosis, apoptosis, and insulin-like secretion, were previously detected in the transcriptome of H. inermis [29,30] (see Table 2 and Table S1 for their functions). They were selected according to Zupo et al. [27] along with the sequences of two housekeeping genes, cytochrome oxidase subunit (COI) and 18S ribosomal RNA. For each gene, specific primers were designed on the basis of nucleotide sequences and used to amplify the selected fragments with a Taq High-Fidelity PCR System (Roche, Monza, Italy). The amplification reactions were performed in 30 μL final volume with 3 μL of 10× PCR reaction buffer, 3 μL of 10× 2 mM dNTP, 1 μL of 5 U/μL Taq, and 100 ng/μL of each primer, template cDNA, and nuclease-free water. The PCR program consisted of a cDNA denaturation step at 95 °C for 5 min, 35 cycles at 95 °C for 45 s, 54–60 °C for 1 min, and 72 °C for 30 s, and then a final extension step at 72 °C for 10 min. The fragments were further purified from agarose gel using the QIAquick Gel Extraction kit (Qiagen, Milan, Italy), and their specificity was checked by DNA sequencing. PCR products were finally aligned with gene sequences by means of MultAlin (available at http://multalin.toulouse.inra.fr/multalin/).

2.4. Gene Expression by Real-Time qPCR

The specificity of the amplification reactions for each pair of primers was verified by melting curve analysis. The theoretical efficiency (E) of each primer pair was calculated according to a standard function, as follows:
E = 10−1/slope
where slope = the slope of the standard curve, plotted with the y axis as Ct and the x axis as log(quantity).
Five serial dilutions were prepared to generate standard curves, and Ct values were determined for each dilution by plotting Ct values against the logarithm of the corresponding dilution factor. PCR efficiencies were then calculated separately for both the control and target genes. PCR efficiencies were found to be high, indicating successful amplification of the desired gene fragments. Diluted cDNA was used as a template in a reaction containing a final concentration of 0.3 mM for each primer and 1× FastStart SYBR Green master mix (total volume 10 μL; Applied Biosystems, Monza, Italy). The following thermal profile was used: one cycle of 95 °C (10 min) for the cDNA denaturation; forty cycles of 95 °C (15 s) and 60 °C (1 min) for the amplification; one cycle of 72 °C (5 min) for the final elongation; and one cycle from 60 to 95 °C for melting curve analysis to verify the presence of a single product. Each RT-qPCR reaction was performed in three duplicates. Fluorescence was determined using ViiATM7 software V1.3. The relative expression ratios were calculated from quantification cycles. Undiluted cDNA (1:1) was then chosen as a template to compare the expression of the genes of interest in samples obtained from individuals in the treatment and control groups. Three RNA replicates were used to synthesize cDNA for both the treatment and control groups, according to the protocol reported in Section 2.2. The relative expression ratios were calculated by the relative expression method, using REST software v2, a mathematical model based on the correction for exact PCR efficiencies and the mean crossing point deviation between sample groups and control groups. Differences higher than 2 were considered significant. The results were further compared with the findings obtained in the previous transcriptomic samples used by Levy et al. [30], aiming at ensuring the consistency and reliability of the gene expression data obtained in this investigation.

2.5. Interactomic Analysis

Network analysis was performed by Ingenuity Pathway Analysis Version 7.1 (IPA, Ingenuity Systems, Inc., Redwood City, CA, USA), based on associated functions and data mining from experimental studies previously reported [32] to identify the relationships between the genes analyzed in this study. The graphical representations display nodes (genes) and edges (the biological relationships between nodes). Since H. inermis genes are not annotated in the IPA database, we used the orthologous human genes to search for the genes of interest (Table 3).

2.6. Statistical Treatment of the Data

The quantitative differences between samples of total RNA obtained by the two RNA extraction methods were evaluated using a paired Student’s t-test; p values lower than 0.05 were considered significant. The qualitative differences between samples of total RNA obtained by the different RNA extraction methods were evaluated by comparing the A260/230 ratios, also using a paired Student’s t-test. The differences in the sex ratio between adult shrimps in three control replicates (Diatom −) vs. three replicates of the treatment (Diatom +) fixed at 45 days were determined by comparing the F/mat% (percentages of females out of the total of mature individuals) by means of a Z-test on proportions. Statistical analyses were performed using GraphPad PRISM (GraphPad Prism version 7.0.0 for Windows, GraphPad Software, San Diego, CA, USA, www.graphpad.com; 15 December 2023).

3. Results

3.1. Analysis of Sex Ratios

The percentage of females out of the total number of mature individuals in the experimental groups fed for 45 days on basic feed (Diatom −) was 48.36% (±1.06), while that for the treated groups (Diatom +; Figure 2) was 86.06% (±0.32). The differences between the two experimental groups were significant (z-test on proportions, p < 0.001), and this result demonstrated that the feeding on diatoms triggered the treated shrimps’ development into females.

3.2. Evaluation of RNA Quantity and Quality

Different results were achieved using the two extraction kits. The number of PL5 pooled and extracted also influenced the quality of extracted RNA. A significantly higher quantity of total RNA was extracted (paired t test; p = 0.038) using the RNeasy kit, and this result was consistent in all analyzed samples (Table 4). A significant difference was also found in the RNA purity, according to the A260/230 ratio (paired t test; p = 0.014), although the difference for the A260/280 ratio was not significant. Taking into account that the minimum amount of total RNA required for cDNA synthesis is ~30 ng/μL according to the iScript™ cDNA Synthesis kit (Bio-Rad), the RNeasy kit was the most efficient method for the production of RNA for our analyses.

3.3. Gene Expression

Expression levels of the genes of interest in PL5 of H. inermis fed on lyophilized C. scutellum var. parva (Diatom +) were compared with those for the PL5 fed on the basic feed (Diatom −), as was previously performed for the transcriptomic analyses reported by Levy et al. [30]. The expression levels of each gene were analyzed and internally normalized against the negative control (Diatom −) and then further compared with the transcriptome data (Figure 3).
All genes involved in the apoptosis pathway were significantly upregulated in Diatom+ treatments, in accordance with the levels of gene expression detected by the transcriptome (Figure 3). The genes involved in the insulin-like secretion pathway were all downregulated in the treated individuals (Diatom +), as compared to controls (Diatom −), except for Vamp 3, which was upregulated. Another key process that showed an alteration in gene expression triggered by the ingestion of Cocconeis diatoms was cell death by ferroptosis. Consequently, the results obtained for the ferroptosis pathway in the samples here processed were consistent with the conclusions based on the transcriptome (Figure 3). The differences between the samples processed here (Figure 3, right) and the transcriptome (Figure 3, left) were not significant, according to the Student’s t test (p < 0.01).

3.4. Network Analysis

Interactomic analysis indicated that all the genes analyzed in this study exhibited a large degree of interaction, and that they have connections with many other genes. For the genes involved in the apoptosis pathway, the following interactions were revealed (Figure 4): ATFC interacts with Nuclear factor-erythroid 2 P45-related factor 3 (NFE2L3), Paternally-expressed gene 3 protein (PEG3), Terminal differentiation-induced NcRNA (TINCR), and Transcription factor 15 (TCF15); CTSB interacts with ABL proto-oncogene 1 (ABL1), Proto-oncogene C-myc (MYC), and TNF receptor superfamily member 12A (TNFRSF12A); Cyt-c interacts with CASP9 and ABL1; CASP9 interacts with Cytochrome C, ABL1, Cell adhesion associated, Oncogene regulated (CDON), Caspase 12 (CASP12), and Phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip); HTRA2 interacts with MYC, inhibitor of apoptosis (IAP), and Discoidin domain receptor tyrosine kinase 2 (DDR2); and TSPO interacts with Adenine nucleotide translocase (Ant) and MYC.
Genes involved in ferroptosis are functionally intercorrelated as follows (Figure 5): GSX1 interacts with VAMP3, malignant T-cell amplified sequence 1 (MCTS1), S100 calcium binding protein A13 (S100A13), Lysophospholipase 1 (LYPLA1), and TP53-induced glycolysis regulatory phosphatase (TIGAR); GPX4 interacts with Pyruvate kinase L/R (PKLR), OTU deubiquitinase 5 (OTUD5), ribulose-5-phosphate-3-epimerase (RPE), glutathione peroxidase, and Tumor protein P53 (TP53); STEAP3 interacts with Solute carrier family 6 member 15 (SLC6A15), VAMP3, Solute carrier family 16 member 2 (SLC16A2), FLVCR heme transporter 1 (FLVCR1), dipeptidase 1 (DPEP1), and TP53; and SAT interacts with fumarate hydratase (FH), guanylate binding protein 2 (GBP2), DPEP1, and TP53.
The close functional association between genes involved in insulin-like secretion (Figure 6) may be summarized as follows: CCKAR interacts with G protein-coupled receptor (Gpcr); CHRM3 interacts with G protein subunit alpha Q (GNAQ) and Gpcr; PLCL1, SNAP25, and VAMP3 are tightly linked, one to the other, and also interact with Huntington Disease Protein (HTT); PCLO also interacts with HTT.

4. Discussion

The balance between cell division and cell death is of utmost importance for the development and maintenance of multicellular organisms, and several model organisms have been employed in the past few decades to investigate the phases and the mechanisms of apoptosis and other PCD pathways [13,33]. The shrimp H. inermis has garnered increasing interest [21] as an effective model to detect early processes of PCD promoted by bioactive molecules. In fact, the mechanism of disruption of the AG in H. inermis, triggered by the lipophilic compounds contained in benthic diatoms (on which these organisms feed), may be considered a consequence of coevolutionary processes [34] that are influenced by various environmental factors [35]. However, the bioassays routinely performed with this organism to investigate the role/s of algal compounds in PCD have only partially revealed the complexity of mechanisms involved in this peculiar process of sex reversal [23,36,37]. The results of this study confirm that the ingestion of diatoms triggers an early process of sex reversal in young post-larvae [27] and that a larger proportion of females in diatom-fed individuals corresponds to the activation of a complex gene network. Previous investigations [23] demonstrated that the proportion of females deriving from spring reproductive bursts is quite skewed, and laboratory experiments [21] indicated that the ingestion of diatoms leads to lower percentages of males (with variable sex ratios according to the culture conditions, always reaching about 20–45% of males on the total number of adults). In contrast, the fall reproductive burst (when Cocconeis spp. are almost absent) leads to proportions of females generally lower than 30–40%, leading to an opposite trend in the sex ratios [23]. Consequently, the distribution of sexes is always skewed, because variable percentages of shrimps (lower in fall, when Cocconeis spp. are less abundant, higher in spring, when those diatoms are abundant) are prematurely subjected to sex reversal.
However, culturing a large number of sensitive larvae and post-larvae may occasionally influence their health and stress status [38], leading to unclear results [39,40]. In contrast, the molecular mechanisms activated by the ingestion of diatoms in young post-larvae correspond to those previously identified [27] and include: (i) the activation of a ferroptotic PCD involving the whole androgenic gland, (ii) the consequent apoptotic death of the testes tissues, and (iii) the interruption of the production of insulin-like hormone (IAG switch) leading to the development of female sex. This demonstrates that molecular approaches may represent a valuable alternative to traditional bioassays, providing insights into the understanding of the cellular machineries underlying sex reversal [41]. Such molecular approaches revealed important cellular strategies of PCD, whose impairment may have pathologic consequences and/or may lead to compromised embryogenesis [42,43], neurodegenerative diseases, or even the development of cancer. While it has long been known that canonical regulatory pathways involving members of the Bcl-2 and caspase families were established to regulate developmental apoptosis in C. elegans and flies [33,44,45,46], new animal models now offer the opportunity to discover multiple mechanisms involved not only in regulating cell death during mammalian development but also in tissue homeostasis and pathological forms of tissue decay promoted by PCD [46]. The need to investigate alternative PCD mechanisms is forcing us to seek newer models [47], often involving complex breeding procedures and sensitive bioassay techniques [48].
Taking into account that several crustaceans are employed for evolutionary developmental studies because of their unique physiologic properties [49,50,51,52], the results obtained are suitable for application in investigations on other protandric species. For example, Parhyale hawaiensis is a well-known amphipod for which an extensive toolbox for genetic manipulation is available [53,54,55,56] and several pandalid and hippolytid decapods exhibit interesting patterns of sex reversal, in addition to the other families of crustaceans containing hermaphroditic species. However, despite the availability of several model organisms, genetic variations of key cellular processes and their functional consequences have received less attention [16]. Many studies have been conducted on various caspase-dependent PCDs (involving apoptosis), but, to date, far fewer studies have been devoted to caspase-independent, non-apoptotic types of PCD [33,57,58] that play fundamental roles in the physiology of plants and animals [59]. Consequently, our study has contributed to revealing conserved molecules and phenomena that are less prominent in other classical model organisms. In particular, we may now explain how a peculiar ecological pathway—the sex reversal of a benthic shrimp used to stabilize its natural populations [23]—is triggered by a conserved mechanism of cell death [27]. In the case studied here, a clear example of environmental sex determination (ESD) is explained by the expression of a few genes, sequentially activated by the ingestion of a diatom. Since sex ratios are crucial for the shrimp population viability, it is evident that the spring blooms of Cocconeis spp. in their environment influence the sex ratio and interact with the genotypic sex determination (GSD), by anticipating the sex reversal (due to the early destruction of the AG) which in the fall generation takes place in shrimps aged about 1 year.
The genes under consideration were isolated for the first time from the transcriptome of H. inermis; they were chosen because they showed significant variations in expression following the ingestion of diatoms by this model organism and were, consequently, believed to play key roles in three major pathways involved in the H. inermis early sex reversal [6,46]. Functional analyses performed on these fundamental cellular processes revealed that these genes are functionally intercorrelated and also interact with other important gene networks [60]. A closer look at the above three pathways reveals that an apoptogenic mechanism is responsible for the premature destruction of the AG of H. inermis [23] as a selective mechanism of PCD. It is also known that an insulin-like secretion pathway constitutes a fundamental step in the regulation of the IAG switch produced by the AG [61] to control the sexual differentiation of decapod crustaceans [62]. Finally, it is worth noting that ferroptosis was previously shown to take place in C. elegans [63] and is considered crucial to promote additional cell death events in vertebrates [27,39]. In this investigation, it was confirmed, in agreement with a recent study [27], that ferroptosis is a mechanism evolutionarily conserved from C. elegans to humans.
In conclusion, the results of this investigation confirmed the patterns of expression indicated by previous transcriptomic analyses [27] and provide a combination of tools for the study of PCD in crustaceans and other invertebrates. In addition to genes involved in ferroptosis (four upregulated genes were found in treated post-larvae, namely GSHI, GPX4, STEA3, and SAT), six genes in the apoptosis pathway (ATFC, CATB, Cyt-c, Dronc, HTRA2, and TSPO) and seven genes in the insulin-like secretion pathway (AC, CCKAR, M3R, PLC, PCLO, SNP25, and VAMP3) [64] were differentially expressed. The downregulation of genes involved in the insulin-like secretion pathway indicates that a PCD cascade effect primed the destruction of the AG and that this led to the inhibition of the production of the insulin-like hormone [6,35,65,66,67]. In fact, this androgenic hormone is normally secreted by the AG in males [68]. Importantly, this study shows that interactomic analyses permit us to track the activity of a cell-death compound in 5-day-old post-larvae; this will lead to a deeper understanding of its mechanism of action, enabling the knowledge to be applied for medical and ecological biotechnologies. Indeed, previous investigations demonstrated that crude extracts of these diatoms specifically activate, in vitro, a dose-dependent PCD in human cancer cells (BT20 breast carcinoma) but not in human normal lymphocytes [60] and this finding opens new opportunities to apply natural products from diatoms for devising new cancer therapies [69]. Further studies will take advantage of the tools described here, permitting us to test the effect of cell-death compounds on sensible targets (such as the AG tissues of the shrimp) in very early stages of development, with lower effort and a clearer comprehension of the mechanisms of action. The possibility to test the effect of candidate compounds able to selectively destroy specific tissues will be important for cancer research. In addition, the elucidation of the molecular mechanisms underlying the sex reversal of crustaceans will also be useful to produce new aquaculture biotechnologies for monosex cultures of decapods, because cell-death compounds will be applied to induce the chemical destruction of the AG in cultured crustaceans and simplify the production of all-female or all-male populations, respectively. On the whole, the determination of the genic networks involved in the complex and peculiar process of sex reversal in H. inermis will contribute to a better understanding of the plant-animal relationships driving important chemical ecology processes in benthic environments.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cimb46060368/s1, Table S1: Name, acronym, and function of the genes analyzed in the present work.

Author Contributions

The experimental work and statistical analyses were conducted by F.G., who also generated the initial draft of the manuscript. R.E. assisted with molecular experiments and provided support in the creation and revision of the first draft, as well as conducting molecular investigations. Planning of the research and oversight of the manuscript’s production were carried out by A.S. and E.D.A., while E.S. contributed to the experimental work. V.Z. planned and supervised the research, reviewed the manuscript, and supervised the experimental work. M.C. was involved in research planning, conducting molecular tests, and supervising the overall work, and contributed to the creation and final revision of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Italian Ministry for Foreign Affairs, Grant Excites (V.Z.), and the Israel Ministry of Science and Technology, Grant Excites (A.S.). This work was also performed in the framework of the project CRIMAC (Centro ricerche ed infrastrutture marine avanzate in Calabria) Blue Economy of Calabrian coasts: biocoenotic characterization, analyses and exploitation of innovative aquaculture productions (BluCaProd).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Most source data are provided with this paper, in the main text, and in the electronic supplementary material. The transcriptome sequences are stored in a large database, physically located at the Informatics facilities of Ben-Gurion University of the Negev, Israel, and are available on request from the authors.

Acknowledgments

We thank Vincenzo Rando for his assistance in the collection of shrimps on board the vessel Phoenicia owned by the Stazione Zoologica Anton Dohrn. Francesca Glaviano was supported by a PhD grant (PhD in Biology, University of Naples SF II) fellowship at the Stazione Zoologica Anton Dohrn. Shrimp feeds were kindly provided by SHG group (Ovada, Italy). We thank the staff of the Bioinformatics Core Facility, Ben-Gurion University, for their help with the bioinformatics analyses, with special thanks to Menachem Sklarz. We thank the Marine Protected Area of the Kingdom of Neptune off the Ischia Island (Italy) for allowing the collections of shrimps at Lacco Ameno. Many thanks to Adrianna Ianora for the first revision of the English text. The final correction of the English text was kindly performed by Inez Mureinik.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Murthy, M.; Ram, J.L. Invertebrates as model organisms for research on aging biology. Invertebr. Reprod. Dev. 2015, 59, 1–4. [Google Scholar] [CrossRef] [PubMed]
  2. Brenner, S. Nobel Lecture “Nature’s gift to Science”. Biosci. Rep. 2003, 23, 225–237. [Google Scholar] [CrossRef] [PubMed]
  3. Bauer, R.T. Remarkable Shrimps: Adaptations and Natural History of the Carideans, 3rd ed.; University of Oklahoma Press: Norman, OK, USA, 2004. [Google Scholar]
  4. Ankeny, R.; Leonelli, S. Model Organisms, 3rd ed.; Cambridge University Press: Cambridge, UK, 2020. [Google Scholar]
  5. Ye, Z.; Bishop, T.; Wang, Y.; Shahriari, R.; Lynch, M. Evolution of sex determination in crustaceans. Mar. Life Sci. Technol. 2023, 5, 1–11. [Google Scholar] [CrossRef] [PubMed]
  6. Short, S.; Yang, G.; Guler, Y.; Green Etxabe, A.; Kille, P.; Ford, A.T. Crustacean intersexuality is feminization without demasculinization: Implications for environmental toxicology. Environ. Sci. Technol. 2014, 48, 13520–13529. [Google Scholar] [CrossRef] [PubMed]
  7. Grilo, T.F.; Rosa, R. Intersexuality in aquatic invertebrates: Prevalence and causes. Sci. Total. Environ. 2017, 592, 714–728. [Google Scholar] [CrossRef] [PubMed]
  8. Charniaux-Cotton, H. Androgenic gland of crustaceans. Gen. Comp. Endocrinol. 1962, 1, 241–247. [Google Scholar] [CrossRef] [PubMed]
  9. Jiang, Q.; Lu, B.; Lin, D.; Huang, H.; Chen, X.; Ye, H. Role of crustacean female sex hormone (CFSH) in sex differentiation in early juvenile mud crabs, Scylla paramamosain. Gen. Comp. Endocrinol. 2020, 289, 113–383. [Google Scholar] [CrossRef] [PubMed]
  10. Dandan, Z.; Tianyi, F.; Nan, M.; Rui, H.; Wentao, L.; Shucheng, S.; Zhaoxia, C. New insights for the regulatory feedback loop between type 1 crustacean female sex hormone (CFSH-1) and insulin-like androgenic gland hormone (IAG) in the Chinese mitten crab (Eriocheir sinensis). Front. Physiol. 2022, 13, 1054773. [Google Scholar] [CrossRef]
  11. Farhadi, A.; Cui, W.; Zheng, H.; Li, S.; Zhang, Y.; Ikhwanuddin, M.; Ma, H. The regulatory mechanism of sexual development in decapod crustaceans. Front. Mar. Sci. 2021, 8, 679687. [Google Scholar] [CrossRef]
  12. Harlioglu, M.M.; Farhadim, A. Androgenic hormones in crustacean aquaculture: A review. Turk. J. Zool. 2022, 46, 237–248. [Google Scholar] [CrossRef]
  13. Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef] [PubMed]
  14. Calado, R.; Carvalho, L.; Rodrigues, A.C.; Abe, F.; Silva, A.L.P.; Soares, A.M.; Gravato, C. The physiological consequences of delaying metamorphosis in the marine ornamental shrimp Lysmata seticaudata and its implications for aquaculture. Aquaculture 2022, 546, 737391. [Google Scholar] [CrossRef]
  15. Manjon-Cabeza, M.E.; Cobos, V.; Munoz, J.E.G.; Raso, J.E.G. Structure and absolute growth of a population of Hippolyte inermis Leach 1815 (Decapoda: Caridea) from Zostera marina (L.) meadows (Malaga, southern Spain). Sci. Mar. 2009, 73, 377–386. [Google Scholar] [CrossRef]
  16. Gasch, A.P.; Payseur, B.A.; Pool, J.E. The power of natural variation for model organism biology. Trends Genet. 2016, 32, 147–154. [Google Scholar] [CrossRef]
  17. Anastasiadou, C.; Liasko, R.; Leonardos, I. Morphotype induced changes in the life history and population dynamics of an hippolytid shrimp. Sci. Rep. 2023, 13, 20581. [Google Scholar] [CrossRef] [PubMed]
  18. Espinoza-Fuenzalida, N.L.; Thiel, M.; Dupre, E.; Baeza, J.A. Is Hippolyte williamsi gonochoric or hermaphroditic? A multi-approach study and a review of sexual systems in Hippolyte shrimps. Mar. Biol. 2008, 155, 623–635. [Google Scholar] [CrossRef]
  19. Reverberi, G. La situazione sessuale di Hyppolyte viridis e le condizioni che la reggono. Bolletino Zool. 1950, 17, 91–94. [Google Scholar] [CrossRef]
  20. d’Udekem d’Acoz, C. The East Atlantic Ocean and the Mediterranean Sea, with a Checklist of All Species in the Genus, 3rd ed.; Nationaal Natuurhistorisch Museum: Rotterdam, The Netherlands, 1996. [Google Scholar]
  21. Zupo, V. Effect of microalgal food on the sex reversal of Hippolyte inermis (Crustacea: Decapoda). Mar. Ecol. Prog. Ser. 2000, 201, 251–259. [Google Scholar] [CrossRef]
  22. Xu, H.J.; Chen, Y.L.; Wang, Y.M.; Luo, J.Y.; Li, J.W.; Shen, S.Q.; Yang, J.S.; Ma, W.M. Full functional sex reversal achieved through silencing of MroDmrt11E gene in Macrobrachium rosenbergii: Production of all-male monosex freshwater prawn. Front. Endocrinol. 2022, 12, 772498. [Google Scholar] [CrossRef]
  23. Zupo, V. Strategies of sexual inversion in Hippolyte inermis Leach (Crustacea, Decapoda) from a Mediterranean seagrass meadow. J. Exp. Mar. Bio. Ecol. 1994, 178, 131–145. [Google Scholar] [CrossRef]
  24. Jüttner, F. Evidence that polyunsaturated aldehydes of diatoms are repellents for pelagic crustacean grazers. Aquat. Ecol. 2005, 39, 271–282. [Google Scholar] [CrossRef]
  25. Lauritano, C.; Borra, M.; Carotenuto, Y.; Biffali, E.; Miralto, A.; Procaccini, G.; Ianora, A. Molecular evidence of the toxic effects of diatom diets on gene expression patterns in copepods. PLoS ONE 2011, 6, e26850. [Google Scholar] [CrossRef] [PubMed]
  26. Jin, P.; Wang, T.; Liu, N.; Dupont, S.; Beardall, J.; Boyd, P.W.; Riebesell, U.; Gao, K. Ocean acidification increases the accumulation of toxic phenolic compounds across trophic levels. Nat. Commun. 2015, 6, 8714. [Google Scholar] [CrossRef] [PubMed]
  27. Zupo, V.; Costantini, M.; Aflalo, E.D.; Levy, T.; Chalifa-Caspi, V.; Obayomi, O.; Mutalipassi, M.; Ruocco, N.; Glaviano, F.; Somma, E. Ferroptosis precedes apoptosis to facilitate specific death signalling by fatty acids. Proc. R. Soc. B 2023, 290, 20231327. [Google Scholar] [CrossRef] [PubMed]
  28. Zupo, V. Influence of diet on sex differentiation of Hippolyte inermis Leach (Decapoda: Natantia) in the field. Hydrobiologia 2001, 449, 131–140. [Google Scholar] [CrossRef]
  29. Raymond, T.B. Same sexual system but variable sociobiology: Evolution of protandric simultaneous hermaphroditism in Lysmata shrimps. Integr. Comp. Biol. 2006, 46, 430–438. [Google Scholar] [CrossRef] [PubMed]
  30. Levy, T.; Zupo, V.; Mutalipassi, M.; Somma, E.; Ruocco, N.; Costantini, M.; Abehsera, S.; Manor, R.; Chalifa-Caspi, V.; Sagi, A.; et al. Protandric transcriptomes to uncover parts of the crustacean sex-differentiation puzzle. Front. Mar. Sci. 2021, 8, 745540. [Google Scholar] [CrossRef]
  31. Guerrero-Tortolero, D.A.; Campos-Ramos, R. Sex reversal and determination and sex control in shrimp and prawn. In Sex Control Aquaculture, 2nd ed.; Wang, H.P., Piferrer, F., Chen, S.L., Shen, Z.G., Eds.; John Wiley and Sons: Hoboken, NJ, USA, 2018; Volume 36, pp. 705–722. [Google Scholar]
  32. Pepi, M.; Heipieper, H.J.; Balestra, C.; Borra, M.; Biffali, E.; Casotti, R. Toxicity of diatom polyunsaturated aldehydes to marine bacterial isolates reveals their mode of action. Chemosphere 2017, 177, 258–265. [Google Scholar] [CrossRef] [PubMed]
  33. Golstein, P.; Aubry, L.; Levraud, J.P. Cell-death alternative model organisms: Why and which? Nat. Rev. Mol. Cell Biol. 2003, 4, 798–807. [Google Scholar] [CrossRef] [PubMed]
  34. Zupo, V.; Glaviano, F.; Caramiello, D.; Mutalipassi, M. Effect of five benthic diatoms on the survival and development of Paracentrotus lividus post-larvae in the laboratory. Aquaculture 2018, 495, 13–20. [Google Scholar] [CrossRef]
  35. D’Abramo, L.R.; New, M.B. Nutrition, feeds and feeding. In Freshwater Prawn Culture, 2nd ed.; New, M.B., Cotroni, W.V., Eds.; Blackwell Science: Oxford, UK, 2000; pp. 203–216. [Google Scholar]
  36. Mutalipassi, M.; Mazzella, V.; Zupo, V. Ocean acidification influences plant-animal interactions: The effect of Cocconeis scutellum parva on the sex reversal of Hippolyte inermis. PLoS ONE 2019, 14, e0218238. [Google Scholar] [CrossRef]
  37. Bertile, F.; Matallana-Surget, S.; Tholey, A.; Cristobal, S.; Armengaud, J. Diversifying the concept of model organisms in the age of -omics. Commun. Biol. 2023, 6, 1062. [Google Scholar] [CrossRef] [PubMed]
  38. Calado, R.; Vercesi, K.; Freitas, E.; Ricardo, F.; Santos, S.A.; Domingues, M.R.; Hayd, L. Larval nutritional stress affects trophic compensation of juvenile caridean shrimp Palaemon varians. Aquac. Rep. 2022, 24, 101140. [Google Scholar] [CrossRef]
  39. Harper, C.; Wolf, J.C. Morphologic effects of the stress response in fish. ILAR J. 2009, 50, 387–396. [Google Scholar] [CrossRef] [PubMed]
  40. Lorenzon, S.; Francese, M.; Ferrero, E.A. Heavy metal toxicity and differential effects on the hyperglycemic stress response in the shrimp Palaemon elegans. Arch. Environ. Contam. Toxicol. 2000, 39, 167–176. [Google Scholar] [CrossRef] [PubMed]
  41. Baeza, J.A. Sexual systems in shrimps (infraorder Caridea Dana, 1852), with special reference to the historical origin and adaptive value of protandric simultaneous hermaphroditism. In Transitions between Sexual Systems: Understanding The Mechanisms of, and Pathways between, Dioecy, Hermaphroditism and Other Sexual Systems, 2nd ed.; Leonard, J., Ed.; Springer: Cham, Switzerland; New York, NY, USA, 2018; pp. 269–310. [Google Scholar]
  42. Eckelbarger, K.J.; Hodgson, A.N. Invertebrates oogenesis-a review and synthesis: Comparative ovarian morphology, accessory cell function and the origins of yolk precursors. Invertebr. Reprod. Dev. 2021, 65, 71–140. [Google Scholar] [CrossRef]
  43. Bedoui, S.; Herold, M.J.; Strasser, A. Emerging connectivity of programmed cell death pathways and its physiological implications. Nat. Rev. Mol. Cell Biol. 2020, 21, 678–695. [Google Scholar] [CrossRef] [PubMed]
  44. Qian, S.; Wei, Z.; Yang, W.; HUang, J.; Yang, Y.; Wang, J. The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Front. Oncol. 2022, 12, 985363. [Google Scholar] [CrossRef]
  45. Zhang, Y.; Hua, J.; Wang, Y. Application effect of aquaculture IOT system. Appl. Mech. Mater. 2013, 303, 1395–1401. [Google Scholar] [CrossRef]
  46. Yuan, J.; Kroemer, G. Alternative cell death mechanisms in development and beyond. Genes Dev. 2024, 24, 2592–2602. [Google Scholar] [CrossRef]
  47. Irikura, R.; Nishizawa, H.; Nakajima, K.; Yamanaka, M.; Chen, G.; Tanaka, K.; Onodera, M.; Matsumoto, M.; Igarashi, K. Ferroptosis model system by the re-expression of BACH1. J. Biochem. 2023, 174, 239–252. [Google Scholar] [CrossRef] [PubMed]
  48. Broker, L.E.; Kruyt, F.A.E.; Giaccone, G. Cell death independent of caspases: A review. Clin. Cancer Res. 2005, 11, 3155–3162. [Google Scholar] [CrossRef] [PubMed]
  49. Gherardi, F.; Calloni, C. Protandrous hermaphroditism in the tropical shrimp Athanas indicus (Decapoda: Caridea), a symbiont of sea urchins. J. Crustac. Biol. 1993, 13, 675–689. [Google Scholar] [CrossRef]
  50. Bauer, R.T.; Holt, G.J. Simultaneous hermaphroditism in the marine shrimp Lysmata wurdemanni (Caridea: Hippolytidae): An undescribed sexual system in the decapos Crustacea. Mar. Biol. 1998, 132, 223–235. [Google Scholar] [CrossRef]
  51. Wolff, C.; Gerberding, M. Crustacea: Comparative aspects of early development. In Evolutionary Developmental Biology of Invertebrates, 2nd ed.; Wanninger, A., Ed.; Springer: Vienna, AT, Austria, 2015; pp. 39–61. [Google Scholar]
  52. Tomoyasu, Y. What crustaceans can tell us about the evolution of insect wings and other morphologically novel structures. Curr. Opin. Genet. Dev. 2021, 69, 48–55. [Google Scholar] [CrossRef] [PubMed]
  53. Govind, P. Model organisms used in molecular biology or medical research. Int. Res. J. Pharm. 2011, 2, 62–65. [Google Scholar]
  54. Kao, D.; Lai, A.G.; Stamataki, E.; Rosic, S.; Konstantinides, N.; Jarvis, E.; Di Donfrancesco, A.; Pouchkina-Stancheva, N.; Sémon, M.; Grillo, M.; et al. The genome of the crustacean Parhyale hawaiensis, a model for animal development, regeneration, immunity and lignocellulose digestion. eLife 2016, 5, e20062. [Google Scholar] [CrossRef] [PubMed]
  55. Sun, D.A.; Patel, N.H. The amphipod crustacean Parhyale hawaiensis: An emerging comparative model of arthropod development, evolution, and regeneration. Wires Dev. Biol. 2019, 8, e355. [Google Scholar] [CrossRef] [PubMed]
  56. Calvo, L.; Birgaoanu, M.; Pettini, T.; Ronshaugen, M.; Griffiths-Jones, S. The embryonic transcriptome of Parhyale hawaiensis reveals different dynamics of microRNAs and mRNAs during the maternal-zygotic transition. Sci. Rep. 2022, 12, 174. [Google Scholar] [CrossRef]
  57. Ebeed, H.T.; El-Helely, A.A. Programmed cell death in plants: Insights into developmental and stress-induced cell death. Curr. Protein Pept. Sci. 2021, 22, 873–889. [Google Scholar] [CrossRef]
  58. Peng, F.; Liao, M.; Qin, R.; Zhu, S.; Peng, C.; Fu, L.; Chen, Y.; Han, B. Regulated cell death (RCD) in cancer: Key pathways and targeted therapies. Signal Transduct. Target Ther. 2022, 7, 286. [Google Scholar] [CrossRef] [PubMed]
  59. Daneva, A.; Gao, Z.; Van Durme, M.; Nowack, M.K. Functions and regulation of programmed cell death in plant developmental. Annu. Rev. Cell. Dev. Biol. 2016, 32, 441–468. [Google Scholar] [CrossRef]
  60. Zupo, V.; Jüttner, F.; Maibam, C.; Butera, E.; Blom, J.F. Apoptogenic metabolites in fractions of the benthic diatom Cocconeis scutellum parva. Mar. Drugs 2014, 12, 547–567. [Google Scholar] [CrossRef] [PubMed]
  61. Katayama, H.; Kubota, N.; Hojo, H.; Okada, A.; Kotaka, S.; Tsutsui, N.; Ohira, T. Direct evidence for the function of crustacean insulin-like androgenic gland factor (IAG): Total chemical synthesis of IAG. Bioorganic Med. Chem. 2014, 22, 5783–5789. [Google Scholar] [CrossRef] [PubMed]
  62. Tan, K.; Zhou, M.; Jiang, H.; Li, Y.; Wang, W. siRNA-mediated MrIAG silencing induces sex reversal in Macrobrachium rosenbergii. Mar. Biotechnol. 2020, 22, 456–466. [Google Scholar] [CrossRef] [PubMed]
  63. Deline, M.; Keller, J.; Rothe, M.; Schunck, W.H.; Menzel, R.; Watts, J.L. Epoxides derived from dietary dihomo-gamma-linolenic acid induce germ cell death in C. elegans. Sci. Rep. 2015, 5, 15417. [Google Scholar] [CrossRef] [PubMed]
  64. Su, M.; Zhang, X.; Yuan, J.; Zhang, X.; Li, F. The role of insulin-like peptide in maintaining hemolymph glucose homeostasis in the pacific white shrimp Litopenaeus vannamei. Int. J. Mol. Sci. 2022, 23, 3268. [Google Scholar] [CrossRef] [PubMed]
  65. Antonova, Y.; Arik, A.J.; Moore, W.; Riehle, M.A.; Brown, M.R. Insulin-like peptides: Structure, signaling, and function. In Insect Endocrinology, 2nd ed.; Gilbert, L.I., Ed.; Academic Press: New York, NY, USA, 2012; pp. 63–69. [Google Scholar]
  66. Petersen, M.C.; Shulman, G.I. Mechanisms of insulin action and insulin resistance. Physiol. Rev. 2018, 98, 2133–2223. [Google Scholar] [CrossRef]
  67. Haeusler, R.; McGraw, T.; Accili, D. Biochemical and cellular properties of insulin receptor signalling. Nat. Rev. Mol. Cell Biol. 2018, 19, 31–44. [Google Scholar] [CrossRef]
  68. Katayama, H.; Nagasawa, H. Chemical synthesis of N-glycosylated insulin-like androgenic gland factor from the freshwater prawn Macrobrachium rosenbergii. J. Pept. Sci. 2019, 25, e3215. [Google Scholar] [CrossRef]
  69. Huang, M.; Lu, J.J.; Ding, J. Natural products in cancer therapy: Past, present and future. Nat. Prod. Bioprospect. 2021, 11, 5–13. [Google Scholar] [CrossRef] [PubMed]
Cimb 46 00368 g001
Figure 1. Culture of shrimps for molecular analyses. Three replicates of negative controls (designated Diatom −) were fed for 5 days on a basic feed (not containing diatoms). Three replicate treatments (designated Diatom +) were fed for 5 days on the same basic feed with the addition of diatoms. Post-larvae were collected after 5 days and fixed in RNA stabilization reagent for molecular analyses.
Figure 1. Culture of shrimps for molecular analyses. Three replicates of negative controls (designated Diatom −) were fed for 5 days on a basic feed (not containing diatoms). Three replicate treatments (designated Diatom +) were fed for 5 days on the same basic feed with the addition of diatoms. Post-larvae were collected after 5 days and fixed in RNA stabilization reagent for molecular analyses.
Cimb 46 00368 g001
Cimb 46 00368 g002
Figure 2. Percentage of females out of the total number of mature individuals (F/mat%) obtained in groups raised on feed without diatoms (Diatom −) vs. feed containing diatoms (Diatom +).
Figure 2. Percentage of females out of the total number of mature individuals (F/mat%) obtained in groups raised on feed without diatoms (Diatom −) vs. feed containing diatoms (Diatom +).
Cimb 46 00368 g002
Cimb 46 00368 g003
Figure 3. Heatmap showing the expression profiles of downregulated and upregulated genes analyzed by real-time qPCR, derived from the transcriptome (left) and from the newly tested samples (right). Genes of 5-day-old (PL5) H. inermis fed on basic feed plus lyophilized Cocconeis spp. diatoms (Diatom + treatment) were compared with those of PL5 fed only on basic feed (Diatom − treatment) and their upregulation (darker color) or downregulation (lighter color) are shown according to the scale bar.
Figure 3. Heatmap showing the expression profiles of downregulated and upregulated genes analyzed by real-time qPCR, derived from the transcriptome (left) and from the newly tested samples (right). Genes of 5-day-old (PL5) H. inermis fed on basic feed plus lyophilized Cocconeis spp. diatoms (Diatom + treatment) were compared with those of PL5 fed only on basic feed (Diatom − treatment) and their upregulation (darker color) or downregulation (lighter color) are shown according to the scale bar.
Cimb 46 00368 g003
Cimb 46 00368 g004
Figure 4. Interactomic analysis by the Ingenuity Pathway Analysis (IPA) software (version 7.1), showing the network of genes involved in apoptosis. The genes that were analyzed are shown in blue. The biological relationships between the significant genes are indicated by arrows (indicating that one molecule modulates the expression of another). The connections indicated by edges (and not by arrows) indicate direct relationships between molecules due to real chemical modifications and, hence, to the formation of direct physical contacts. For further details of IPA analysis, see Section 2 (paragraph 2.5).
Figure 4. Interactomic analysis by the Ingenuity Pathway Analysis (IPA) software (version 7.1), showing the network of genes involved in apoptosis. The genes that were analyzed are shown in blue. The biological relationships between the significant genes are indicated by arrows (indicating that one molecule modulates the expression of another). The connections indicated by edges (and not by arrows) indicate direct relationships between molecules due to real chemical modifications and, hence, to the formation of direct physical contacts. For further details of IPA analysis, see Section 2 (paragraph 2.5).
Cimb 46 00368 g004
Cimb 46 00368 g005
Figure 5. Interactomic analysis by Ingenuity Pathway Analysis (IPA) software, showing the network of genes involved in ferroptosis. For further details, see legend to Figure 4.
Figure 5. Interactomic analysis by Ingenuity Pathway Analysis (IPA) software, showing the network of genes involved in ferroptosis. For further details, see legend to Figure 4.
Cimb 46 00368 g005
Cimb 46 00368 g006
Figure 6. Interactomic analysis by Ingenuity Pathway Analysis (IPA) software, showing the network of genes involved in insulin-like secretion. For further details, see the legend to Figure 4.
Figure 6. Interactomic analysis by Ingenuity Pathway Analysis (IPA) software, showing the network of genes involved in insulin-like secretion. For further details, see the legend to Figure 4.
Cimb 46 00368 g006
Table 1. Summary of experimental design. The preliminary larval growth phase is reported in the first row, while two experimental trials are reported in the second and third rows, with all the technical details. In the last column, the purpose of each experiment is indicated, i.e., the production of post-larvae, the long-term (45 days) maturation of sex, and the (5-day) production of PL5 for molecular investigations.
Table 1. Summary of experimental design. The preliminary larval growth phase is reported in the first row, while two experimental trials are reported in the second and third rows, with all the technical details. In the last column, the purpose of each experiment is indicated, i.e., the production of post-larvae, the long-term (45 days) maturation of sex, and the (5-day) production of PL5 for molecular investigations.
Duration (Days)Experimental PhaseDensityFeedNo. of ReplicatesContainerNo. of Individuals/
Replicate		Purpose
25 Larval rearing1 larva/
10 mL		Artemia + Brachionus10Conical flasks80Production of post-larvae
45 Post-larval rearing1 post-larva/
20 mL		Diatom + vs. Diatom −3Dishes25Identification of sex
5 Post-larval rearing1 post-larva/
20 mL		Diatom + vs. Diatom −3Dishes25Molecular analyses
Table 2. Nineteen genes isolated from the transcriptome of Hippolyte inermis and classified according to the pathways in which they are involved (with acronym, gene name, primer name and sequences, and lengths of amplified fragments).
Table 2. Nineteen genes isolated from the transcriptome of Hippolyte inermis and classified according to the pathways in which they are involved (with acronym, gene name, primer name and sequences, and lengths of amplified fragments).
Gene TypeAcronymGenePrimerSequence 5′>3′Fragment Length (bp)
HousekeepingCOICytochrome oxidase subunitCoi_Hi_F1CTGAAGAGGTATAGTAGGAAC204
Coi_Hi_R1CTCGGTGCCCCTGACATAGC
18S RNA18S ribosomal RNA18S_Hi_F1CATGCATGTGTCAGTACAGGC204
18S_Hi_R1CTTATCATATGAGAATCCAACC
ApoptosisATFCActivating transcription factorATFC_Hi_F1GGCTGGAGTTCTGACAGAGG189
ATFC_Hi_R1CAGCCCAGCTCTTCCAGATTG
CATBCathepsin BCATB_Hi_F2GGATCTTGTGGATCATGCTGG198
CATB_HI_R2GTTCCAGCCATCCGCCATTAC
Cyt-cCytochrome CCYT_Hi_F1GTGCAGAGATGTGCTCAGTGC167
CYT_Hi_R1ACATCCAGAGTGTCATCTGC
DroncDeath receptor-associated nemesis-likeDRONC_Hi_F1GGCATCATTATGACAGATATGC201
DRONC_Hi_F1GTGTGATGATATCATGTAGAGC
HTRA2High-temperature requirement A2 serine peptidaseHTRA2_Hi_F2GACACAATGAAGCCAGAGCC190
HTRA2_Hi_R2CGCCATCAGTTCTCTGCTAG
TSPOTranslocator proteinTSPO_Hi_F1GCAGGTGGCAAATGAAATGGAG132
TSPO_Hi_R1CTGGCGTCCTCCTAACTGGATG
FerroptosisGSHIGamma glutamylcysteine synthetaseGSH1_Hi_F1GCCGTGTGAAGTCCAGCTGA242
GSH1_Hi_R1CATTCACGGACATCTGACTAG
GPX4Glutathione peroxidase 4GPX4_Hi_F1GCTGAGAGTCTGAGAGACTG195
GPX4_Hi_R1CTAGTCACTAAACGTCGTCGG
STEA3Sterile alpha-motif domain-containing protein 3 metalloreductaseSTEA3_Hi_F1GAGCATATGCAGATAACGTG185
STEA3_Hi_R1GGCTATTCCTGATGAGCATC
SATSpermidine/spermine N1-acetyltransferaseSAT_Hi_F1CTGTGGATGTGACTCAGAAG173
SAT_Hi_R1GCAGATTCTTGCTGATGCGG
Insulin-like secretionACAdenylyl cyclaseAC_Hi_F1GTGTCTTACGTGGCTGAGGC223
AC_Hi_R1CTGCGGTGGGTATAGTCTGC
CCKARCholecystokinin A receptorCCKAR_Hi_F3CCCTCCTGATACCTGAAGATG172
CCKAR_Hi_R3GGATTCTCTGGTATTCTTGAC
M3RMuscarinic acetylcholine receptor M3M3R_Hi_F1GGAGTCGATCTCAATGGATC184
M3R_Hi_R1CTAGCAGTGTGGCGATGGAG
PLCPhospholipase CPLC_Hi_F1CTGTGTAGGTATTCACTCGTG173
PLC_Hi_R1CACAGATGAATGAACTGACC
PCLOPiccolo presynaptic cytomatrix proteinPCLO_Hi_F1GGCTGGTGATGGACGAAGAC226
PCLO_Hi_R1CCGCGATCTGGAAACGTCAG
SNP25Synaptosome-associated protein 25SNP25_Hi_F1GCAGAGCTGAGTGCCGTAGC232
SNP25_Hi_R1GCAACGATCCGAACTACTAC
VAMP3Vesicle-associated membrane protein 3VAMP3_Hi_F1CTAGTGCCAGTGACTGTGAC198
VAMP3_Hi_R1CCACCTCATTCACCTCTCTC
Table 3. Hippolyte inermis genes corresponding to human genes in the three functional pathways analyzed, along with the accession number from the shrimp transcriptome [27].
Table 3. Hippolyte inermis genes corresponding to human genes in the three functional pathways analyzed, along with the accession number from the shrimp transcriptome [27].
PathwayAccession NumberGeneH. inermisHuman
ApoptosisHippolyte_Body_TRINITY_DN6519_c0_g1Activating transcription factorATFCATF4
Hippolyte_Body_TRINITY_DN5045_c0_g2Cathepsin BCATBCTSB
Hippolyte_Body_TRINITY_DN6311_c0_g4Cytochrome CCyt-cCYC
Hippolyte_Body_TRINITY_DN112258_c0_g1Death receptor-associated nemesis-likeDroncCASP9
Hippolyte_Body_TRINITY_DN5290_c0_g1High-temperature requirement A2 serine peptidaseHTRA2HTRA2
Hippolyte_Body_TRINITY_DN11687_c0_g1Translocator proteinTSPOTSPO
FerroptosisHippolyte_Body_TRINITY_DN4632_c1_g1Gamma glutamylcysteine synthetaseGSHIGSX1
Hippolyte_Body_TRINITY_DN7730_c5_g1Glutathione peroxidase 4GPX4GPX4
Hippolyte_Body_TRINITY_DN28134_c0_g1Six-transmembrane epithelial antigen of prostate 3STEA3STEAP3
Hippolyte_Body_TRINITY_DN6660_c0_g1Spermidine/spermine N1-acetyltransferaseSATSAT
Insulin-like secretionHippolyte_Body_TRINITY_DN3141_c0_g1Adenylyl cyclaseACADCY1
Hippolyte_Body_TRINITY_DN83923_c0_g1Cholecystokinin A receptorCCKARCCKAR
Hippolyte_Body_TRINITY_DN80437_c0_g1Muscarinic acetylcholine receptor M3M3RCHRM3
Hippolyte_Body_TRINITY_DN22546_c0_g1Phospholipase CPLCPLCL1
Hippolyte_Body_TRINITY_DN186639_c0_g1Piccolo presynaptic cytomatrix proteinPCLOPCLO
Hippolyte_Body_TRINITY_DN5531_c0_g1Synaptosome-associated protein 25SNP25SNAP25
Hippolyte_Body_TRINITY_DN21906_c0_g1Vesicle-associated membrane protein 3VAMP3VAMP3
Table 4. Total RNA (ng/μL) purity and integrity (A260/280 and A260/230), with the two extraction methods, for four pools of individuals (1, 2, 3, and 4).
Table 4. Total RNA (ng/μL) purity and integrity (A260/280 and A260/230), with the two extraction methods, for four pools of individuals (1, 2, 3, and 4).
PL5 Replicate ng/μLA260/280A260/230
RNeasy Mini Kit 160.91.990.32
284.52.030.82
3161.62.080.55
4176.82.020.93
PureLink™ RNA Mini Kit 129.92.031.47
258.42.120.48
3872.132.07
4146.72.112.07
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Glaviano, F.; Esposito, R.; Somma, E.; Sagi, A.; Aflalo, E.D.; Costantini, M.; Zupo, V. Molecular Approaches Detect Early Signals of Programmed Cell Death in Hippolyte inermis Leach. Curr. Issues Mol. Biol. 2024, 46, 6169-6185. https://doi.org/10.3390/cimb46060368

AMA Style

Glaviano F, Esposito R, Somma E, Sagi A, Aflalo ED, Costantini M, Zupo V. Molecular Approaches Detect Early Signals of Programmed Cell Death in Hippolyte inermis Leach. Current Issues in Molecular Biology. 2024; 46(6):6169-6185. https://doi.org/10.3390/cimb46060368

Chicago/Turabian Style

Glaviano, Francesca, Roberta Esposito, Emanuele Somma, Amir Sagi, Eliahu D. Aflalo, Maria Costantini, and Valerio Zupo. 2024. "Molecular Approaches Detect Early Signals of Programmed Cell Death in Hippolyte inermis Leach" Current Issues in Molecular Biology 46, no. 6: 6169-6185. https://doi.org/10.3390/cimb46060368

Article Metrics

Back to TopTop